The Influence of Curcumin on the Downregulation of MYC, Insulin and IGF-1 Receptors: A Possible Mechanism Underlying the Anti-Growth and Anti-Migration in Chemoresistant Colorectal Cancer Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Cell Culture
2.3. Cell Cytotoxic Analysis and Determination of IC50 Dose for 5-FU
2.4. Flow Cytometric Cell Analysis
2.5. RNA Extraction and Real-Time PCR Analysis
2.6. Wound Healing Assay
2.7. Colony Formation Assay
2.8. Statistical Analysis
3. Results
3.1. Isolation of 5-FU-Resistant SW480 Colon Cancer Cell Line (5FU-SW480)
3.2. Curcumin Exerted Cytotoxic Effects on Both SW480 and 5FU-SW480
3.3. Curcumin Induced Apoptosis in SW480 and 5FU-SW480
3.4. Colony Formation of SW480 and 5FU-SW480 was Decreased by Curcumin
3.5. Curcumin Decreased Cell Migration in SW480 and 5FU-SW480
3.6. Curcumin Decreased Expression of Insulin and IGF-1 Receptors in Addition to MYC
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Marley, A.R.; Nan, H. Epidemiology of colorectal cancer. Int. J. Mol. Epidemiol. Genet. 2016, 7, 105. [Google Scholar] [PubMed]
- McCarty, M.F. Targeting multiple signaling pathways as a strategy for managing prostate cancer: Multifocal signal modulation therapy. Integr. Cancer Ther. 2004, 3, 349–380. [Google Scholar] [CrossRef] [PubMed]
- Boyanapalli, S.S.; Kong, A.-N.T. “Curcumin, the king of spices”: Epigenetic regulatory mechanisms in the prevention of cancer, neurological, and inflammatory diseases. Curr. Pharmacol. Rep. 2015, 1, 129–139. [Google Scholar] [CrossRef] [PubMed]
- Mohanty, C.; Das, M.; Sahoo, S.K. Emerging role of nanocarriers to increase the solubility and bioavailability of curcumin. Expert Opin. Drug Deliv. 2012, 9, 1347–1364. [Google Scholar] [CrossRef]
- Brouet, I.; Ohshima, H. Curcumin, an anti-tumor promoter and anti-inflammatory agent, inhibits induction of nitric oxide synthase in activated macrophages. Biochem. Biophys. Res. Commun. 1995, 206, 533–540. [Google Scholar] [CrossRef]
- Sharma, R.A.; Euden, S.A.; Platton, S.L.; Cooke, D.N.; Shafayat, A.; Hewitt, H.R.; Marczylo, T.H.; Morgan, B.; Hemingway, D.; Plummer, S.M. Phase I clinical trial of oral curcumin: Biomarkers of systemic activity and compliance. Clin. Cancer Res. 2004, 10, 6847–6854. [Google Scholar] [CrossRef] [PubMed]
- Carroll, R.E.; Benya, R.V.; Turgeon, D.K.; Vareed, S.; Neuman, M.; Rodriguez, L.; Kakarala, M.; Carpenter, P.M.; McLaren, C.; Meyskens, F.L. Phase IIa clinical trial of curcumin for the prevention of colorectal neoplasia. Cancer Prev. Res. 2011, 4, 354–364. [Google Scholar] [CrossRef] [PubMed]
- Gall Troselj, K.; Novak Kujundzic, R. Curcumin in combined cancer therapy. Curr. Pharm. Des. 2014, 20, 6682–6696. [Google Scholar] [CrossRef]
- Muñoz, P.; Iliou, M.S.; Esteller, M. Epigenetic alterations involved in cancer stem cell reprogramming. Mol. Oncol. 2012, 6, 620–636. [Google Scholar] [CrossRef]
- Takebe, N.; Miele, L.; Harris, P.J.; Jeong, W.; Bando, H.; Kahn, M.; Yang, S.X.; Ivy, S.P. Targeting Notch, Hedgehog, and Wnt pathways in cancer stem cells: Clinical update. Nat. Rev. Clin. Oncol. 2015, 12, 445. [Google Scholar] [CrossRef]
- Adachi, Y.; Lee, C.T.; Coffee, K.; Yamagata, N.; Ohm, J.E.; Park, K.H.; Dikov, M.M.; Nadaf, S.R.; Arteaga, C.L.; Carbone, D.P. Effects of genetic blockade of the insulin-like growth factor receptor in human colon cancer cell lines. Gastroenterology 2002, 123, 1191–1204. [Google Scholar] [CrossRef]
- Orrù, S.; Nigro, E.; Mandola, A.; Alfieri, A.; Buono, P.; Daniele, A.; Mancini, A.; Imperlini, E. A functional interplay between IGF-1 and adiponectin. Int. J. Mol. Sci. 2017, 18, 2145. [Google Scholar] [CrossRef] [PubMed]
- Sarfstein, R.; Belfiore, A.; Werner, H. Identification of insulin-like growth factor-I receptor (IGF-IR) gene promoter-binding proteins in estrogen receptor (ER)-positive and ER-depleted breast cancer cells. Cancers 2010, 2, 233–261. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.; Liu, J.; Wang, C.; Lin, B.; Liu, Q.; Hao, Y.; Zhang, S.; Iwamori, M. The stimulation of IGF-1R expression by Lewis (y) antigen provides a powerful development mechanism of epithelial ovarian carcinoma. Int. J. Mol. Sci. 2011, 12, 6781–6795. [Google Scholar] [CrossRef]
- Panda, A.; Grammatikakis, I.; Yoon, J.-H.; Abdelmohsen, K. Posttranscriptional regulation of insulin family ligands and receptors. Int. J. Mol. Sci. 2013, 14, 19202–19229. [Google Scholar] [CrossRef] [PubMed]
- Han, H.; Wei, W.; Chu, W.; Liu, K.; Tian, Y.; Jiang, Z.; Chen, J. Muscle Conditional Medium Reduces Intramuscular Adipocyte Differentiation and Lipid Accumulation through Regulating Insulin Signaling. Int. J. Mol. Sci. 2017, 18, 1799. [Google Scholar] [CrossRef]
- Subramani, R.; Lopez-Valdez, R.; Arumugam, A.; Nandy, S.; Boopalan, T.; Lakshmanaswamy, R. Targeting insulin-like growth factor 1 receptor inhibits pancreatic cancer growth and metastasis. PLoS ONE 2014, 9, e97016. [Google Scholar] [CrossRef]
- Larsson, S.C.; Orsini, N.; Wolk, A. Diabetes mellitus and risk of colorectal cancer: A meta-analysis. J. Natl. Cancer Inst. 2005, 97, 1679–1687. [Google Scholar] [CrossRef] [PubMed]
- Lu, C.-C.; Chu, P.-Y.; Hsia, S.-M.; Wu, C.-H.; Tung, Y.-T.; Yen, G.-C. Insulin induction instigates cell proliferation and metastasis in human colorectal cancer cells. Int. J. Oncol. 2017, 50, 736–744. [Google Scholar] [CrossRef] [PubMed]
- Xavier, S.; Sadanandan, J.; George, N.; Paulose, C.S. β2-Adrenoceptor and insulin receptor expression in the skeletal muscle of streptozotocin induced diabetic rats: Antagonism by vitamin D3 and curcumin. Eur. J. Pharmacol. 2012, 687, 14–20. [Google Scholar] [CrossRef] [PubMed]
- Mosmann, T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J. Immunol. Methods 1983, 65, 55–63. [Google Scholar] [CrossRef]
- Su, C.-C.; Chen, G.-W.; Lin, J.-G.; Wu, L.-T.; Chung, J.-G. Curcumin inhibits cell migration of human colon cancer colo 205 cells through the inhibition of nuclear factor kappa B/p65 and down-regulates cyclooxygenase-2 and matrix metalloproteinase-2 expressions. Anticancer Res. 2006, 26, 1281–1288. [Google Scholar] [PubMed]
- Mazieiro, R.; Frizon, R.R.; Barbalho, S.M.; Goulart, R.A. Is curcumin a possibility to treat inflammatory bowel diseases? J. Med. Food 2018, 21, 1077–1085. [Google Scholar] [CrossRef] [PubMed]
- Bachmeier, B.E.; Mohrenz, I.V.; Mirisola, V.; Schleicher, E.; Romeo, F.; Höhneke, C.; Jochum, M.; Nerlich, A.G.; Pfeffer, U. Curcumin downregulates the inflammatory cytokines CXCL1 and-2 in breast cancer cells via NFκB. Carcinogenesis 2007, 29, 779–789. [Google Scholar] [CrossRef]
- Codony-Servat, J.; Cuatrecasas, M.; Asensio, E.; Montironi, C.; Martínez-Cardús, A.; Marín-Aguilera, M.; Horndler, C.; Martínez-Balibrea, E.; Rubini, M.; Jares, P. Nuclear IGF-1R predicts chemotherapy and targeted therapy resistance in metastatic colorectal cancer. Br. J. Cancer 2017, 117, 1777. [Google Scholar] [CrossRef]
- Andres, S.F.; Simmons, J.G.; Mah, A.T.; Santoro, M.A.; Van Landeghem, L.; Lund, P.K. Insulin receptor isoform switching in intestinal stem cells, progenitors, differentiated lineages and tumors: Evidence that IR-B limits proliferation. J. Cell Sci. 2013, 126, 5645–5656. [Google Scholar] [CrossRef]
- Patel, B.B.; Gupta, D.; Elliott, A.A.; Sengupta, V.; Yu, Y.; Majumdar, A.P. Curcumin targets FOLFOX-surviving colon cancer cells via inhibition of EGFRs and IGF-1R. Anticancer Res. 2010, 30, 319–325. [Google Scholar]
- Dallas, N.A.; Xia, L.; Fan, F.; Gray, M.J.; Gaur, P.; Van Buren, G.; Samuel, S.; Kim, M.P.; Lim, S.J.; Ellis, L.M. Chemoresistant colorectal cancer cells, the cancer stem cell phenotype, and increased sensitivity to insulin-like growth factor-I receptor inhibition. Cancer Res. 2009, 69, 1951–1957. [Google Scholar] [CrossRef]
- Patel, B.B.; Sengupta, R.; Qazi, S.; Vachhani, H.; Yu, Y.; Rishi, A.K.; Majumdar, A.P. Curcumin enhances the effects of 5-fluorouracil and oxaliplatin in mediating growth inhibition of colon cancer cells by modulating EGFR and IGF-1R. Int. J. Cancer 2008, 122, 267–273. [Google Scholar] [CrossRef]
- Kugimiya, N.; Nishimoto, A.; Hosoyama, T.; Ueno, K.; Enoki, T.; Li, T.S.; Hamano, K. The c-MYC-ABCB5 axis plays a pivotal role in 5-fluorouracil resistance in human colon cancer cells. J. Cell. Mol. Med. 2015, 19, 1569–1581. [Google Scholar] [CrossRef]
- Walker, T.; White, J.; Esdale, W.; Burton, M.; DeCruz, E. Tumour cells surviving in vivo cisplatin chemotherapy display elevated c-myc expression. Br. J. Cancer 1996, 73, 610. [Google Scholar] [CrossRef] [PubMed]
- Pyndiah, S.; Tanida, S.; Ahmed, K.M.; Cassimere, E.K.; Choe, C.; Sakamuro, D. c-MYC suppresses BIN1 to release poly (ADP-ribose) polymerase 1: A mechanism by which cancer cells acquire cisplatin resistance. Sci. Signal. 2011, 4, ra19. [Google Scholar] [CrossRef] [PubMed]
- Wolfer, A.; Wittner, B.S.; Irimia, D.; Flavin, R.J.; Lupien, M.; Gunawardane, R.N.; Meyer, C.A.; Lightcap, E.S.; Tamayo, P.; Mesirov, J.P. MYC regulation of a “poor-prognosis” metastatic cancer cell state. Proc. Natl. Acad. Sci. USA 2010, 107, 3698–3703. [Google Scholar] [CrossRef]
- Kanwar, S.S.; Yu, Y.; Nautiyal, J.; Patel, B.B.; Padhye, S.; Sarkar, F.H.; Majumdar, A.P. Difluorinated-curcumin (CDF): A novel curcumin analog is a potent inhibitor of colon cancer stem-like cells. Pharm. Res. 2011, 28, 827–838. [Google Scholar] [CrossRef] [PubMed]
- Prakobwong, S.; Gupta, S.C.; Kim, J.H.; Sung, B.; Pinlaor, P.; Hiraku, Y.; Wongkham, S.; Sripa, B.; Pinlaor, S.; Aggarwal, B.B. Curcumin suppresses proliferation and induces apoptosis in human biliary cancer cells through modulation of multiple cell signaling pathways. Carcinogenesis 2011, 32, 1372–1380. [Google Scholar] [CrossRef]
- Sa, G.; Das, T. Anti cancer effects of curcumin: Cycle of life and death. Cell Div. 2008, 3, 14. [Google Scholar] [CrossRef]
Gene | Primer Sequence 5′-3′ |
---|---|
MYC | F: AGCGACTCTGAGGAGGAAC R: GCTGCGTAGTTGTGCTGATG |
IGF-1R | F: AGAAGGAGGAGGCTGAATAC R: GGTCGGTGATGTTGTAGGT |
IR | F: TAGAAGGCGAGAAGACCATC R: GTGACACCAGAGCGTAGG |
HPRT | F: CCTGGCGTCGTGATTAGTGA R: AAGACGTTCAGTCCTGTCCAT |
Treatment (CUR) | IC25 | IC50 |
---|---|---|
SW480 | 10.75 ± 0.53 | 20.04 ± 0.96 |
5FU-SW480 | 6.15 ± 1.34 | 17.56 ± 0.83 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hosseini, S.A.; Zand, H.; Cheraghpour, M. The Influence of Curcumin on the Downregulation of MYC, Insulin and IGF-1 Receptors: A Possible Mechanism Underlying the Anti-Growth and Anti-Migration in Chemoresistant Colorectal Cancer Cells. Medicina 2019, 55, 90. https://doi.org/10.3390/medicina55040090
Hosseini SA, Zand H, Cheraghpour M. The Influence of Curcumin on the Downregulation of MYC, Insulin and IGF-1 Receptors: A Possible Mechanism Underlying the Anti-Growth and Anti-Migration in Chemoresistant Colorectal Cancer Cells. Medicina. 2019; 55(4):90. https://doi.org/10.3390/medicina55040090
Chicago/Turabian StyleHosseini, Seyed Ahmad, Hamid Zand, and Makan Cheraghpour. 2019. "The Influence of Curcumin on the Downregulation of MYC, Insulin and IGF-1 Receptors: A Possible Mechanism Underlying the Anti-Growth and Anti-Migration in Chemoresistant Colorectal Cancer Cells" Medicina 55, no. 4: 90. https://doi.org/10.3390/medicina55040090