Insights into National Laboratory Newborn Screening and Future Prospects
Abstract
:1. Introduction
2. The Historic Beginning of Laboratory NBS
3. Organizational Guidelines for NBS
4. Laboratory NBS Worldwide
5. Advances in Screening Methodology
Wilson and Jungner Criteria for Disease Screening
- The condition sought should be an important health problem.
- There should be an accepted treatment for patients with recognized disease.
- Facilities for diagnosis and treatment should be available.
- There should be a recognizable latent or early symptomatic stage.
- There should be a suitable test or examination.
- The test should be acceptable to the population.
- The natural history of the condition, including development from latent to declared disease, should be adequately understood.
- There should be an agreed policy on whom to treat as patients.
- The cost of case-finding (including diagnosis and treatment of patients diagnosed) should be economically balanced in relation to possible expenditure on medical care as a whole.
- Case-finding should be a continuing process and not a “once and for all” project.
6. National Laboratory NBS at Saudi Arabia
7. Reason for Limiting the Number of Screened National NBS Disorders
8. Prevalence and Geographical Distribution among Saudi Arabia
9. Current Methodologies in Laboratory Testing
Genetic Testing for NBS
10. NGS in Hemoglobinopathies
11. NGS in Aminoacidopathies
12. Is It Visible That Nucleic Acid Sequencing Will Replace the Current Available Methodologies for Newborn Testing?
13. Conclusions and Recommendations
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- American College of Medical Genetics Newborn Screening Expert Group. Newborn screening: Toward a uniform screening panel and system—Executive summary. Pediatrics 2006, 117 Pt 2, S296–S307. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tarini, B.A. The current revolution in newborn screening: New technology, old controversies. Arch Pediatr. Adolesc. Med. 2007, 161, 767–772. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- National Newborn Screening and Genetics Resource Center. National Newborn Screening Status Report. 3 January 2008. Available online: https://migrc.org/?s=Newborn+Screening+ (accessed on 5 September 2021).
- CDC (US Centers for Disease Control and Prevention). CDC Grand Rounds: Newborn Screening and Improved Outcomes. MMWR 2012, 61, 390–393. [Google Scholar]
- Guthrie, R. The Origin of Newborn Screening. Screening 1992, 1, 5–15. [Google Scholar] [CrossRef]
- Centerwall, W.R.; Chinnock, R.F.; Pusavat, A. Phenylketonuria: Screening programs and testing methods. Am. J. Public Health Nations Health 1960, 50, 1667–1677. [Google Scholar] [CrossRef]
- Balk, K.G. Recommended newborn screening policy change for the NICU infant. Policy Politics Nurs. Pract. 2007, 8, 210–219. [Google Scholar] [CrossRef]
- Balk, K.G. Newborn screening guidelines for the critically ill infant. Neonatal. Netw. 2005, 24, 39–42. [Google Scholar] [CrossRef]
- Anderson, R.; Rothwell, E.; Botkin, J.R. Newborn screening: Ethical, legal, and social implications. Annu. Rev. Nurs. Res. 2011, 29, 113–132. [Google Scholar] [CrossRef]
- Patch, C. Newborn screening policy in the United Kingdom & the United States: Two different communities of practice. MCN Am. J. Matern Child Nurs. 2006, 31, 164–168. [Google Scholar]
- De Jesús, V.R.; Mei, J.V.; Bell, C.J.; Hannon, W.H. Improving and Assuring Newborn Screening Laboratory Quality Worldwide: 30-Year Experience at the Centers for Disease Control and Prevention. Semin. Perinatol. 2010, 34, 125–133. [Google Scholar] [CrossRef] [Green Version]
- Campos, H.D. Tamiz de los errores innatos del metabolismo por espectrometría de masas en tándem: Principales biomarcadores [Tandem mass spectrometry as screening for inborn errors of metabolism]. Rev. Med. Chil. 2011, 139, 1356–1364. [Google Scholar] [CrossRef] [Green Version]
- Frazier, D.M. Tyrosine Results in MS/MS Newborn Screening: The Highs and Lows. Newborn Screening and Genetic Testing Symposium. [Monograph on the Internet] Minneapolis. 2007. Available online: https://www.aphl.org/conferences/proceedings/Documents/2007/NBS-Genetic-Testing-Symposium/Tyrosine_Results_in_NBS.pdf (accessed on 5 September 2021).
- Wang, T.; Ma, J.; Zhang, Q.; Gao, A.; Wang, Q.I.; Li, H.; Xiang, J.; Wang, B. Expanded newborn screening for inborn errors of metabolism by tandem mass spectrometry in Suzhou, China: Disease spectrum, prevalence, genetic characteristics in a Chinese population. Front. Genet. 2019, 10, 1052. [Google Scholar] [CrossRef] [PubMed]
- Sarar, M.; Wafa, E.; Al-Aqeel, A.I.; Alhashem, A.M.; Ali, A.; Lujane, A.; Maher, A.; Fahad, A.; Horia, A.; Amer, A.; et al. Incidence of newborn screening disorders among 56632 infants in Central Saudi Arabia. Saudi Med. J. 2020, 41, 703–708. Available online: https://applications.emro.who.int/imemrf/Saudi_Med_J/Saudi-Med-J-2020-41-7-703-708-eng.pdf (accessed on 5 September 2021).
- Shi, X.T.; Cai, J.; Wang, Y.Y.; Tu, W.J.; Wang, W.P.; Gong, L.M.; Wang, D.W.; Ye, Y.T.; Fang, S.G.; Jing, P.W. Newborn screening for inborn errors of metabolism in mainland China: 30 years of experience. JIMD Rep. 2012, 6, 79–83. [Google Scholar] [PubMed] [Green Version]
- Rastogi, M.V.; LaFranchi, S.H. Congenital hypothyroidism. Orphanet J. Rare Dis. 2010, 5, 17. [Google Scholar] [CrossRef] [Green Version]
- American College of Medical Genetics (ACMG). Newborn Screening: Towards a Uniform Screening Panel and System. Genet. Med. 2006, 8, S12–S252. [Google Scholar]
- Therrell, B.L.; Johnson, A.; Williams, D. Status of Newborn Screening Programs in the United States. Pediatrics 2006, 117, S212–S252. [Google Scholar] [CrossRef] [Green Version]
- Nomenclature for Conditions based upon. Naming and Counting Disorders (Conditions) Included in Newborn Screening Panels. Pediatrics 2006, 117, S308–S314. Available online: https://www.hrsa.gov/advisory-committees/heritable-disorders/rusp/index.html (accessed on 5 September 2021). [CrossRef] [Green Version]
- Alfadhel, M.; Al Saif, S.; Al Zaben, A. Manual of Establishing A Newborn Screening Program, Diagnosis and Management of Screened Disorders; King Fahad Library: Riyadh, Saudi Arabia, 2016. [Google Scholar]
- Gelb, M.H.; Turecek, F.; Scott, C.R.; Chamoles, N.A. Direct Multiplex Assay of Enzymes in Dried Blood Spots by Tandem Mass Spectrometry for the Newborn Screening of Lysosomal Storage Disorders. J. Inheritable Metab. Dis. 2006, 29, 397–404. [Google Scholar] [CrossRef] [Green Version]
- McCann, M.R.; George De la Rosa, M.V.; Rosania, G.R.; Stringer, K.A. L-Carnitine and Acylcarnitines: Mitochondrial Biomarkers for Precision Medicine. Metabolites 2021, 11, 51. [Google Scholar] [CrossRef]
- Banta-Wright, S.A.; Steiner, R.D. Mass Spectrometry in Newborn Screening, A Primer of Neonatal and Perinatal Nurses. J. Perinat. Neonatal Nurs. 2004, 18, 41–58. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wilson, J.M.G.; Jungner, G. Principles and Practice of Screening for Disease; WHO: Geneva, Switzerland, 1968. Available online: http://www.who.int/bulletin/volumes/86/4/07-050112BP.pdf (accessed on 5 September 2021).
- Lewis, M.H.; Botkin, J.R. Newborn Screening in the United States: Ethical Issues. In The Oxford Handbook of Public Health Ethics; Anna, C.M., Jeffrey, P.K., Nancy, E.K., Eds.; Oxford University Press: Oxford, UK, 2019. [Google Scholar]
- NIH (National Institutes of Health). Genomic Sequencing and Newborn Screening Disorders Request for Applications; NIH: Bethesda, MD, USA, 2012. Available online: https://grants.nih.gov/grants/guide/rfa-files/RFA-HD-13-010.html (accessed on 5 September 2021).
- Botkin, J.R.; Rothwell, E. Whole Genome Sequencing and Newborn Screening. Curr. Genet. Med. Rep. 2016, 4, 1–6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gardner, P.; Oitmaa, E.; Messner, A.; Hoefsloot, L.; Metspalu, A.; Schrijver, I. Simultaneous multigene mutation detection in patients with sensorineural hearing loss through a novel diagnostic microarray: A new approach for newborn screening follow-up. Pediatrics 2006, 118, 985–994. [Google Scholar] [CrossRef] [PubMed]
- Alexander, D.; Van Dyck, P.C. A vision of the future of newborn screening. Pediatrics 2006, 117, S350–S354. [Google Scholar] [CrossRef] [Green Version]
- Green, N.S.; Pass, K.A. Neonatal screening by DNA microarray: Spots and chips. Nat. Rev. Genet. 2005, 6, 147–151. [Google Scholar] [CrossRef]
- Burke, W.; Diekema, D.S. Ethical issues arising from the participation of children in genetic research. J. Pediatr. 2006, 149, S34–S38. [Google Scholar] [CrossRef]
- MOH: National Newborn Screening Program Continues. Available online: https://www.moh.gov.sa/en/Ministry/MediaCenter/News/Pages/News-2017-11-27-003.aspx (accessed on 5 September 2021).
- Gosadi, I.M. National screening programs in Saudi Arabia: Overview, outcomes, and effectiveness. J. Infect. Public Health 2019, 12, 608–614. [Google Scholar] [CrossRef]
- Saudi Ministry of Health. National Transformation Programs in Health Sector. Available online: https://www.moh.gov.sa/en/Ministry/vro/Pages/manual.aspx (accessed on 30 April 2019).
- Saudi Vision 2030. National Transformation Program: Strategic Objectives. Available online: https://www.vision2030.gov.sa/media/nhyo0lix/ntp_eng_opt.pdf (accessed on 30 March 2019).
- Abu-Osba, Y.K.; Mallouh, A.; Salamah, M.; Hann, R.; Thalji, A.; Hamdan, J.; Sa’di, A.A. Comprehensive newborn screening program: ARAMCO experience, the national need and recommendations. Ann. Saudi Med. 1992, 12, 235–240. [Google Scholar] [CrossRef]
- Muzaffer, M.A. Neonatal screening of glucose-6-phosphate dehydrogenase deficiency in Yanbu, Saudi Arabia. J. Med. Screen. 2005, 12, 170–171. [Google Scholar] [CrossRef] [Green Version]
- Al-Maghamsi, M.S.; Al-Hawsawi, Z.M.; Ghulam, G.N.; Okasha, A.M. Screening for congenital hypothyroidism in North-West region of Saudi Arabia. Saudi Med. J. 2002, 23, 1518–1521. [Google Scholar]
- Afifi, A.M.; Abdul-Jabbar, M.A. Saudi newborn screening. A national public health program: Needs, costs, and challenges. Saudi Med. J. 2007, 28, 1167–1170. [Google Scholar] [PubMed]
- Alfadhel, M.; Al Othaim, A.; Al Saif, S.; Al Mutairi, F.; Alsayed, M.; Rahbeeni, Z.; Alzaidan, H.; Alowain, M.; Al-Hassnan, Z.; Saeedi, M.; et al. Expanded Newborn Screening Program in Saudi Arabia: Incidence of screened disorders. J. Paediatr. Child Health 2017, 53, 585–591. [Google Scholar] [CrossRef] [PubMed]
- Alratrout, R.; Alsadah, Z.; Ansari, N. The frequency of inherited metabolic and endocrine disorders in the eastern and north-western Jawf provinces of Saudi Arabia: Four years data from the newborn screening department, Ministry of Health, Dammam. Curr. Pediatr. Res. 2017, 21, 665–673. [Google Scholar]
- Levy, H.L. Ethical and Psychosocial Implications of Genomic Newborn Screening. Int. J. Neonatal Screen. 2021, 7, 2. [Google Scholar] [CrossRef] [PubMed]
- Trujillano, D.; Perez, B.; González, J.; Tornador, C.; Navarrete, R.; Escaramis, G.; Ossowski, S.; Armengol, L.; Cornejo, V.; Desviat, L.R.; et al. Accurate molecular diagnosis of phenylketonuria and tetrahydrobiopterin-deficient hyperphenylalaninemias using high-throughput targeted sequencing. Eur. J. Hum. Genet. 2014, 22, 528–534. [Google Scholar] [CrossRef] [Green Version]
- Bashir, A.; Weissbecker, K.; Abdul-Mageed, A.; Andersson, H. Towards a Uniform Newborn Screening Panel in the Kingdom of Saudi Arabia. Acad. J. Ped. Neonatol. 2018, 6, 555753. [Google Scholar] [CrossRef]
- Saunders, C.J.; Miller, N.A.; Soden, S.E.; Dinwiddie, D.L.; Noll, A.; Alnadi, N.A.; Andraws, N.; Patterson, M.L.; Krivohlavek, L.A.; Fellis, J.; et al. Rapid whole-genome sequencing for genetic disease diagnosis in neonatal intensive care units. Sci. Transl. Med. 2012, 4, 154ra135. [Google Scholar] [CrossRef] [Green Version]
- Tadmouri, G.O.; Nair, P.; Obeid, T.; Al Ali, M.T.; Al Khaja, N.; Hamamy, H.A. Consanguinity and reproductive health among Arabs. Reprod. Health 2009, 6, 17. [Google Scholar] [CrossRef] [Green Version]
- Banjar, H.; Al-Mogarri, I.; Nizami, I.; Al-Haider, S.; AlMaghamsi, T.; Alkaf, S.; Al-Enazi, A.; Moghrabi, N. Geographic distribution of cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in Saudi Arabia. Int. J. Pediatr. Adolesc. Med. 2021, 8, 25–28. [Google Scholar] [CrossRef]
- Furnier, S.M.; Durkin, M.S.; Baker, M.W. Translating Molecular Technologies into Routine Newborn Screening Practice. Int. J. Neonatal Screen. 2020, 6, 80. [Google Scholar] [CrossRef]
- Ye, S.; Dhillon, S.; Ke, X.; Collins, A.R.; Day, I.N. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res. 2001, 29, e88. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Therrell Jr, B.L.; Lloyd-Puryear, M.A.; Camp, K.M.; Mann, M.Y. Inborn errors of metabolism identified via newborn screening: Ten-year incidence data and costs of nutritional interventions for research agenda planning. Mol. Genet. Metab. 2014, 113, 14–26. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Strauss, K.A.; Carson, V.J.; Soltys, K.; Young, M.E.; Bowser, L.E.; Puffenberger, E.G.; Brigatti, K.W.; Williams, K.B.; Robinson, D.L.; Hendrickson, C.; et al. Branched-chain α-ketoacid dehydrogenase deficiency (maple syrup urine disease): Treatment, biomarkers, and outcomes. Mol. Genet. Metab. 2020, 129, 193–206. [Google Scholar] [CrossRef] [PubMed]
- Higgs, D.R.; Engel, J.D.; Stamatoyannopoulos, G. Thalassaemia. Lancet 2012, 379, 373–383. [Google Scholar] [CrossRef]
- Williams, T.N.; Weatherall, D.J. World distribution, population genetics, and health burden of the hemoglobinopathies. Cold Spring Harb. Perspect. Med. 2012, 2, a011692. [Google Scholar] [CrossRef] [Green Version]
- El-Hazmi, M.A.F. Haemoglobinopathies, Thalassaemias and Enzymopathies in Saudi Arabia: The Present Status. Acta Haematol. 1987, 78, 130–134. [Google Scholar] [CrossRef]
- Al-Qurashi, M.M.; El-Mouzan, M.I.; Al-Herbish, A.S.; Al-Salloum, A.A.; Al-Omar, A.A. The prevalence of sickle cell disease in Saudi children and adolescents. A community-based survey. Saudi Med. J. 2008, 29, 1480–1483. [Google Scholar]
- Nasserullah, Z.; Al Jame, A.; Abu Srair, H.; Al Qatari, G.; Al Naim, S.; Al Aqib, A.; Mokhtar, M. Neonatal screening for sickle cell disease, glucose-6-phosphate dehydrogenase deficiency and a-thalassemia in Qatif and Al Hasa. Ann. Saudi Med. 1998, 18, 289–292. [Google Scholar] [CrossRef]
- Shang, X.; Peng, Z.; Ye, Y.; Zhang, X.; Chen, Y.; Zhu, B.; Cai, W.; Chen, S.; Cai, R.; Guo, X.; et al. Rapid Targeted Next-Generation Sequencing Platform for Molecular Screening and Clinical Genotyping in Subjects with Hemoglobinopathies. EBioMedicine 2017, 23, 150–159. [Google Scholar] [CrossRef] [Green Version]
- Cao, A.; Kan, Y.W. The prevention of thalassemia. Cold Spring Harb. Perspect. Med. 2013, 3, a011775. [Google Scholar] [CrossRef]
- Korf, B.R.; Rehm, H.L. New approaches to molecular diagnosis. JAMA 2013, 309, 1511–1521. [Google Scholar] [CrossRef] [PubMed]
- Stark, Z.; Tan, T.Y.; Chong, B.; Brett, G.R.; Yap, P.; Walsh, M.; Yeung, A.; Peters, H.; Mordaunt, D.; Cowie, S.; et al. A prospective evaluation of whole-exome sequencing as a first-tier molecular test in infants with suspected monogenic disorders. Genet. Med. 2016, 18, 1090–1096. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chong, J.X.; Ouwenga, R.; Anderson, R.L.; Waggoner, D.J.; Ober, C. A population-based study of autosomal-recessive disease-causing mutations in a founder population. Am. J. Hum. Genet. 2012, 91, 608–620. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Haque, I.S.; Lazarin, G.A.; Kang, H.P.; Evans, E.A.; Goldberg, J.D.; Wapner, R.J. Modeled fetal risk of genetic diseases identified by expanded carrier screening. JAMA 2016, 316, 734–742. [Google Scholar] [CrossRef] [Green Version]
- Claire Miranda Shooter. Application of Next Generation Sequencing in the Characterizations of Variants Causing Haemoglobinopathies. Ph.D. Thesis, Research Portal, King’s College London, London, UK, 2016.
- Yubero, D.; Brandi, N.; Ormazabal, A.; Garcia-Cazorla, À.; Pérez-Dueñas, B.; Campistol, J.; Ribes, A.; Palau, F.; Artuch, R.; Armstrong, J.; et al. Targeted Next Generation Sequencing in Patients with Inborn Errors of Metabolism. PLoS ONE 2016, 11, e0156359. [Google Scholar] [CrossRef]
- Yavarna, T.; Al-Dewik, N.; Al-Mureikhi, M.; Ali, R.; Al-Mesaifri, F.; Mahmoud, L.; Shahbeck, N.; Lakhani, S.; AlMulla, M.; Nawaz, Z.; et al. High diagnostic yield of clinical exome sequencing in Middle Eastern patients with Mendelian disorders. Hum. Genet. 2015, 134, 967–980. [Google Scholar] [CrossRef]
- Lee, H.; Deignan, J.L.; Dorrani, N.; Strom, S.P.; Kantarci, S.; Quintero-Rivera, F.; Das, K.; Toy, T.; Harry, B.; Yourshaw, M.; et al. Clinical exome sequencing for genetic identification of rare Mendelian disorders. JAMA 2014, 312, 1880–1887. [Google Scholar] [CrossRef]
- Yu, H.; van Karnebeek, C.; Sinclair, G.; Hill, A.; Cui, H.; Zhang, V.W.; Wong, L.J. Detection of a novel intragenic rearrangement in the creatine transporter gene by next generation sequencing. Mol. Genet. Metab. 2013, 110, 465–471. [Google Scholar] [CrossRef]
- Wang, J.; Cui, H.; Lee, N.C.; Hwu, W.L.; Chien, Y.H.; Craigen, W.J.; Wong, L.J.; Zhang, V.W. Clinical application of massively parallel sequencing in the molecular diagnosis of glycogen storage diseases of genetically heterogeneous origin. Genet. Med. 2013, 15, 106–114. [Google Scholar] [CrossRef] [Green Version]
- Wong, L.J. Next generation molecular diagnosis of mitochondrial disorders. Mitochondrion 2013, 13, 379–387. [Google Scholar] [CrossRef]
- Feng, Y.; Chen, D.; Wang, G.L.; Zhang, V.W.; Wong, L.J.C. Improved molecular diagnosis by the detection of exonic deletions with target gene capture and deep sequencing. Genet. Med. 2015, 17, 99–107. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yohe, S.; Hauge, A.; Bunjer, K.; Kemmer, T.; Bower, M.; Schomaker, M.; Onsongo, G.; Wilson, J.; Erdmann, J.; Zhou, Y.; et al. Clinical validation of targeted next-generation sequencing for inherited disorders. Arch Pathol. Lab. Med. 2015, 139, 204–210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kingsmore, S.F.; Dinwiddie, D.L.; Miller, N.A.; Soden, S.E.; Saunders, C.J.; Children’s Mercy Genomic Medicine Team. Adopting orphans: Comprehensive genetic testing of Mendelian diseases of childhood by next-generation sequencing. Expert Rev. Mol. Diagn. 2011, 11, 855–868. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Berg, J.S.; Powell, C.M. Potential Uses and Inherent Challenges of Using Genome-Scale Sequencing to Augment Current Newborn Screening. Cold Spring Harb. Perspect. Med. 2015, 5, a023150. [Google Scholar] [CrossRef]
- Dean, D.D.; Agarwal, S. Next Generation Sequencing in New Born Screening—Current Insights. Genet. Clin. 2016, 9, 13–18. [Google Scholar]
- Green, R.C.; Berg, J.S.; Grody, W.W.; Kalia, S.S.; Korf, B.R.; Martin, C.L.; McGuire, A.L.; Nussbaum, R.L.; O’Daniel, J.M.; Ormond, K.E.; et al. ACMG Recommendations for Reporting of Incidental Findings in Clinical Exome and Genome Sequencing. Genet. Med. 2013, 15, 565–574. [Google Scholar] [CrossRef] [Green Version]
- van Campen, J.C.; Sollars, E.S.; Thomas, R.C.; Bartlett, C.M.; Milano, A.; Parker, M.D.; Dawe, J.; Winship, P.R.; Peck, G.; Grafham, D.; et al. Next Generation Sequencing in Newborn Screening in the United Kingdom National Health Service. Int. J. Neonatal Screen. 2019, 5, 40. [Google Scholar] [CrossRef] [Green Version]
- Bolze, A.; Byun, M.; McDonald, D.; Morgan, N.V.; Abhyankar, A.; Premkumar, L.; Puel, A.; Bacon, C.M.; Rieux-Laucat, F.; Pang, K.; et al. Whole-exome-sequencing-based discovery of human FADD deficiency. Am. J. Hum. Genet. 2010, 87, 873–881. [Google Scholar] [CrossRef] [Green Version]
- Byun, M.; Abhyankar, A.; Lelarge, V.; Plancoulaine, S.; Palanduz, A.; Telhan, L.; Boisson, B.; Picard, C.; Dewell, S.; Zhao, C.; et al. Whole-exome sequencing-based discovery of STIM1 deficiency in a child with fatal classic Kaposi sarcoma. J. Exp. Med. 2010, 207, 2307–2312. [Google Scholar] [CrossRef] [Green Version]
- Bamshad, M.J.; Ng, S.B.; Bigham, A.W.; Tabor, H.K.; Emond, M.J.; Nickerson, D.A.; Shendure, J. Exome sequencing as a tool for Mendelian disease gene discovery. Nat. Rev. Genet. 2011, 12, 745–755. [Google Scholar] [CrossRef]
- Tennessen, J.A.; Bigham, A.W.; O’Connor, T.D.; Fu, W.; Kenny, E.E.; Gravel, S.; McGee, S.; Do, R.; Liu, X.; Jun, G.; et al. Broad GO Seattle GO NHLBI Exome Sequencing Project Evolution and functional impact of rare coding variation from deep sequencing of human exomes. Science 2012, 337, 64–69. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koboldt, D.C.; Steinberg, K.M.; Larson, D.E.; Wilson, R.K.; Mardis, E.R. The next-generation sequencing revolution and its impact on genomics. Cell 2013, 155, 27–38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Belkadi, A.; Bolze, A.; Itan, Y.; Cobat, A.; Vincent, Q.B.; Antipenko, A.; Shang, L.; Boisson, B.; Casanova, J.L.; Abel, L. Whole-genome sequencing is more powerful than whole-exome sequencing for detecting exome variants. Proc. Natl. Acad. Sci. USA 2015, 112, 5473–5478. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gilissen, C.; Hehir-Kwa, J.Y.; Thung, D.T.; van de Vorst, M.; van Bon, B.W.; Willemsen, M.H.; Kwint, M.; Janssen, I.M.; Hoischen, A.; Schenck, A.; et al. Genome sequencing identifies major causes of severe intellectual disability. Nature 2014, 511, 344–347. [Google Scholar] [CrossRef] [PubMed]
- Clark, M.J.; Chen, R.; Lam, H.Y.; Karczewski, K.J.; Chen, R.; Euskirchen, G.; Butte, A.J.; Snyder, M. Performance comparison of exome DNA sequencing technologies. Nat. Biotechnol. 2011, 29, 908–914. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cooper, G.M.; Shendure, J. Needles in stacks of needles: Finding disease-causal variants in a wealth of genomic data. Nat. Rev. Genet. 2011, 12, 628–640. [Google Scholar] [CrossRef]
- Roman, T.S.; Crowley, S.B.; Roche, M.I.; Foreman, A.K.M.; O’Daniel, J.M.; Seifert, B.A.; Lee, K.; Brandt, A.; Gustafson, C.; DeCristo, D.M.; et al. Genomic Sequencing for Newborn Screening: Results of the NC NEXUS Project. Am. J. Hum. Genet. 2020, 107, 596–611. [Google Scholar] [CrossRef]
- Friedman, E. Next generation sequencing for newborn screening: Are we there yet? Genet. Res. 2015, 97, e17. [Google Scholar] [CrossRef]
- Tarini, B.A.; Goldenberg, A.J. Ethical issues with newborn screening in the genomics era. Annu. Rev. Genom. Hum. Genet. 2012, 13, 381–393. [Google Scholar] [CrossRef] [Green Version]
- Reinstein, E. Challenges of using next generation sequencing in newborn screening. Genet. Res. 2015, 97, e21. [Google Scholar] [CrossRef] [Green Version]
- Mackie, A. UK National Screening Committee Criteria: Clarification of two misunderstandings. Eur. J. Hum. Genet. 2017, 25, 791. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Taylor-Phillips, S.; Boardman, F.; Seedat, F.; Hipwell, A.; Gale, N.K.; Clarke, A.; Slowther, A.; Sime, M.; Thomas, S.; Davis, H.; et al. The Ethical, Social and Legal Issues with Expanding the Newborn Blood Spot Test; The University of Warwick: Warwick, UK, 2014. [Google Scholar]
- Laberge, A.-M.; Burke, W. Avoiding the Technological Imperative: Criteria for Genetic Screening Programs. OBM Genet. 2017, 1, 1. [Google Scholar] [CrossRef]
- Bassaganyas, L.; Freedman, G.; Vaka, D.; Wan, E.; Lao, R.; Chen, F.; Kvale, M.; Currier, R.J.; Puck, J.M.; Kwok, P.Y. Whole exome and whole genome sequencing with dried blood spot DNA without whole genome amplification. Hum. Mutat. 2018, 39, 167–171. [Google Scholar] [CrossRef]
- Trier, C.; Fournous, G.; Strand, J.M.; Stray-Pedersen, A.; Pettersen, R.D.; Rowe, A.D. Next-generation sequencing of newborn screening genes: The accuracy of short-read mapping. NPJ Genom. Med. 2020, 5, 36. [Google Scholar] [CrossRef] [PubMed]
- Mandelker, D.; Schmidt, R.J.; Ankala, A.; McDonald Gibson, K.; Bowser, M.; Sharma, H.; Duffy, E.; Hegde, M.; Santani, A.; Lebo, M.; et al. Navigating highly homologous genes in a molecular diagnostic setting: A resource for clinical next-generation sequencing. Genet. Med. 2016, 18, 1282–1289. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Knoppers, B.M.; Thorogood, A.; Chadwick, R. The Human Genome Organization: Towards next-generation ethics. Genome Med. 2013, 5, 38. [Google Scholar] [CrossRef] [Green Version]
Country | Disorders | Others |
---|---|---|
Saudi Arabia [15] | ASA-βKT–BTD–CAH–CH–CIT-GA1–GALT–HMG–IVA–MCAD–MCC–MMA–MSUD–PA–PKU–VLCAD | Tyr-I–HCU–PCD |
USA | ASA–BTD–βKT–CAH–CCHD–CF–CH–CIT–CTD–CUD–GA1–GALT-Hb S/b Th–HCLS–HCU–HMG–IVA–LCHAD–MCC-MMA1-MMA2–MSUD–PA–PKU-SC Disease–SCA–TFP-Tyr1–VLCAD | https://www.hrsa.gov/advisory-committees/heritable-disorders/rusp/index.html (accessed on 5 September 2021) |
UK | CF–CH–GA1–HCU–IVA–MCAD–MSUD–PKU–SCA | https://www.gov.uk/government/collections/newborn-blood-spot-screening-programme-supporting-publications (accessed on 5 September 2021) |
China | ARG1–CTD-GA1–HCU–HHH–HPA–IVA–MCAD–MCC–MMA–MSUD–PA–SBCAD–SCAD–TFP–Tyr–VLCAD | https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3565663/ (accessed on 5 September 2021) |
Brazil | Phase I: PKU and CH-Phase II: SCA and other hemoglobinopathies-Phase III: CF-Phase IV: CAH and BTD | https://www.researchgate.net/publication/6145921_Newborn_screening_A_national_public_health_programme_in_Brazil (accessed on 5 September 2021) |
Australia | ARG1–ASA–βKT–CACT–cblC–CF–CH–CIT-CPT1-CPT2–CTD-GA1–GALT–HCLS–HCU–HMG–IBD–IVA–LCHAD–MADD–MCAD–MCC–MGH–MMA-MMA1–MSUD–PA–PKU-Pterin defect–SBCAD–SCAD–SCHADD–TFP-Tyr1-Tyrosine aminotransferase deficiency-VLCAD | https://www.racgp.org.au/getattachment/d717b2a9-c887-4510-805c-9378395a5c2f/attachment.aspx?disposition=inline (accessed on 5 September 2021) |
Qatar | CH–CAH-PKU–HPA-BS–ASA–MSUD-HCY-CIT–Tyr II-GALT-BIOT-MMA–PROP-GA1-IVA–3MCC-MAD-IBDH-MCAD–VLAD-LCHAD-SCAD-CTD-CPT-I,II-HMG-βKT | https://www.nature.com/articles/gim200998/tables/2 (accessed on 5 September 2021) |
Uruguay | BH4 deficiency–CAH–cblC–CF–CH–CIT–CUD–Hemoglobinopathies–HPA-Maternal B12 deficiency–MCAD–MCC–MMA1–PKU | https://doi.org/10.1590/2326-4594-JIEMS-2021-0008 (accessed on 5 September 2021) |
Location | Collection Period * | Sample Size | >1C,1C * | Overall * | Reference |
---|---|---|---|---|---|
Riyadh | 1983–1986 | 4497 | 31 | 54.3 [?] | [43] |
Riyadh | 1993 | 2001 | 28.4 | 51.1 [1C, 1.5C, 2C,<2C] | [44] |
1995 (?) | 3212 | 25.8 | 56.8 [1C, 1.5C, 2C,<2C] | [45] | |
Dammam | 1998 (?) | 1307 | 39.3 | 52 [1C,1.5C, 2C,<2C] | [46] |
Al-Baha | 2004–2005 | 487 | 29 | 42.1 [?] | [45] |
Al-Jawf | 2004–2005 | 593 | 34.8 | 53.5 [?] | [45] |
Assir | 2004–2005 | 833 | 24.6 | 44.5 [?] | [45] |
Eastern Province | 2004–2005 | 1032 | 33.3 | 57.8 [?] | [45] |
Gizan | 2004–2005 | 565 | 33 | 53.5 [?] | [45] |
Hail | 2004–2005 | 505 | 25.1 | 48.9 [?] | [45] |
Madinah | 2004–2005 | 618 | 39.2 | 67.2 [?] | [45] |
Makkah | 2004–2005 | 2278 | 32.4 | 55.9 [?] | [45] |
Najran | 2004–2005 | 472 | 28.4 | 66.7 [?] | [45] |
Northern Borders | 2004–2005 | 504 | 31.4 | 63.9 [?] | [45] |
Qassim | 2004–2005 | 713 | 29.6 | 46.7 [?] | [45] |
Riyadh | 2004–2005 | 2522 | 42.3 | 60 [?] | [45] |
Tabuk | 2004–2005 | 432 | 28.3 | 60 [?] | [45] |
All Saudi Arabia | 2004–2005 | 11,554 | 33.6 | 56 [?] | [45] |
Molecular Application | Example Condition | Molecular Marker | Technology |
---|---|---|---|
First-tier markers | Severe combined immunodeficiency | T-cell receptor excision circles | Real-time polymerase chain reaction (PCR) |
Spinal muscular atrophy | Homozygous SMN1 exon 7 deletion | Real-time PCR | |
Second-tier markers | Cystic fibrosis | CFTR variants | Next generation sequencing |
Supplemental “just-in-time” information * | Galactosemia | GALT c.563A>G, c.404C>T, and c.940A>G | Tetra-primer amplification refractory mutation system (Tetra-primer ARMS)–PCR |
Maple syrup urine disease | BCKDHA c.1325 T>A | Tetra-primer ARMS–PCR | |
Sickle cell disease | HBB c.20 A>T | Sanger sequencing | |
Pompe disease | GAA coding region and intron-exon junctions | Sanger sequencing | |
Spinal muscular atrophy | SMN2 copy number | Droplet digital PCR |
# | Disorder | Gene | Nucleic Acid Change | Effect |
---|---|---|---|---|
1 | ASA | ASL | c.1060C>T | p.Q354X |
c.556C>T | p.R186W | |||
c.343G>T | p.D115Y | |||
c.469G>A | p.G157R | |||
c.496C>A | p.P166S | |||
c.544C>T | p.R182X | |||
c.1081G>T | p.G361X | |||
IVS13+5G>C | ||||
2 | BD | BTD | c.654G>C | p.E218D |
c.466C>T | p.Q156X | |||
del490A-491G | Frame shift | |||
del544A | Frame shift | |||
Inser or del G76:d7i3 | ||||
c.38G>T | p.C33F | |||
3 | CAH | CYP21A2 | c.952 C>T | p.Q318X |
c.290-13 C>G | IVSK13C>G | |||
Exon 6&8 del | ||||
CYP11B1 | c.780 G>A | p.W260X | ||
4 | CIT | ASS1 | c.1087 C>A | p.R363W |
5 | GA-I | GCDH | c.1208A>G | p.H403R |
c.1169G>C | p.G390A | |||
c.1144G>A | p.A382T | |||
c.1060G>C | p.G354R | |||
c.937C>T | p.R313W | |||
6 | HMG | HMGCL | c.122G>A | p.R41Q |
F305 (shift K2) | ||||
7 | MCAD | ACADM | c.262C>T | p.T121I |
c.347G>A | p.C116Y | |||
MCCC2 | ||||
8 | MMA | MUT | c.329A>G | p.Y110C |
c.2200C>T | p.Q734X | |||
9 | PA | PCCA | c.350G>A | p.G117D |
c.425G>A | p.G142D | |||
10 | PKU | PAH | p.R261 | |
11 | VLCAD | ACADVL | IVS16+6GC del | |
c.65C>A | p.S22X | |||
12 | Classic Homocystinuria | CBS | c.969G>A | p.W323X |
13 | Familial chloride diarrhea | SLC26A3 | c.559G>T | p.G187X |
14 | GA-II | ETFDH | c.786G>T | p.L262F |
15 | Glycogen storage disease type III GSDIII | AGL | IVS32K12AA>G | |
16 | Lipoid congenital adrenal hyperplasia | STAR | c.545G>A | p.R182H |
17 | Maroteaux-Lamy Syndrome | ARSB | c.753C>G | p.Y251X |
18 | Niemann-Pick Type B | SMPD1 | c.1267C>T | p.H423Y |
c.1734G>C | p.K578N | |||
19 | Osteoporosis | CA2 | c.232+1G>A | |
20 | Papillon-Lefevre Syndrome | CTSC | c.815G>C | p.R272P |
21 | Sanjad-Sakati syndrome | TBCE | 155_166del | |
22 | Wilson disease | ATP7B | c.2230T>C | p.S744P |
c.4196A>G | p.Q1399R | |||
4193delC | ||||
23 | Wouldhouse-Sakati syndrome | DCAF17 | 436delC |
# | Gene | Mutation | Primer Label | Sequence |
---|---|---|---|---|
1 | ASL | D115Y | ASL_F1 | CCTCTGGGGGTATAGACCGT |
ASL_R1 | AAGGTTGGGACAACACGGAG | |||
G157R P166S R182X R186W | ASL_F2 | TCCACCCGAGCTTCTGCT | ||
ASL_R2 | CAGCTCTGTCAATCCCTAAGGCT | |||
IVS13+5G>C Q354X | ASL_F3 | GCTCCTGATGACCCTCAA | ||
ASL_R3 | GAGCGAGCACACCTCTCC | |||
G361X | ASL_F4 | CAGAGCCGAGTGGGTAAGAG | ||
ASL_R4 | TTTGCGGACCAGGTAATAGG | |||
2 | ACADM | C116Y | ACADM_F1 | CTGTAGGAGGTCTTGGACTTGG |
T121I | ACADM_R1 | GCCTCGAAATCAGAACTCCA | ||
3 | CBS | W323X | CBS_F1 | GGGTCCTACCGCCTAGACAC |
CBS_R1 | GTCGGTGGCTGACTGAGG | |||
4 | AGL | IVS32-2A>G | AGL_F1 | GCAGTGATATGGTTTACTGTGG |
AGL_R1 | GTCTTTGCAGTAGTCTCCGGG | |||
5 | HMGCL | R41Q | HMGCL_F1 | TGGGCACTTTACCAAAGCGG |
HMGCL_R1 | TGTCAACTGCCATTGCACCTA | |||
F305 (shift-2) | HMGCL_F2 | GGCATACCATGACTTACCGCA | ||
HMGCL_R2 | TGAGCCACTTTGGAGCTAGT | |||
6 | ATP7B | S744P | ATP7B_F1 | CTAGAACCTGACCCGGTGAC |
ATP7B_R1 | CTCATGTGACCTGACAGCTGCT | |||
4193delC p.Q1399R | ATP7B_F2 | AGAGGCCTTCACCAGGC | ||
ATP7B_R2 | GCTGACCTGGTCCCATGGTG | |||
7 | SLC26A3 | G187X | SLC26A3-F1 | CTGAGTATGATGGTGGGACTAGC |
SLC26A3-R1 | CAGTCAAGATGAACAGATTGAGGTG | |||
8 | CA2 | c.232+1G>A | CA2_F1 | CAGCCAAGTATGACCCTTCC |
CA2_R1 | GCTCGGAAAACAGCTACTGG | |||
9 | STAR | R182H | STAR_F1 | GGCTGAGTCGTGATTCTGGT |
STAR_R1 | CTGATGACACCCTTCTGCTCAG | |||
10 | DCAF17 | c.436delC | DCAF17_F1 | CACTGACTGCTCATAATTGGCT |
DCAF17_R1 | ATTTCATGGGCCACAGGTTTC | |||
11 | TBCE | c.155_166del12bp | TBCE_F1 | CAATCCCGAGAGAGGAAAGC |
TBCE_R1 | CTTGACTAAATGACCGTGCTGAT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the author. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mujamammi, A.H. Insights into National Laboratory Newborn Screening and Future Prospects. Medicina 2022, 58, 272. https://doi.org/10.3390/medicina58020272
Mujamammi AH. Insights into National Laboratory Newborn Screening and Future Prospects. Medicina. 2022; 58(2):272. https://doi.org/10.3390/medicina58020272
Chicago/Turabian StyleMujamammi, Ahmed H. 2022. "Insights into National Laboratory Newborn Screening and Future Prospects" Medicina 58, no. 2: 272. https://doi.org/10.3390/medicina58020272