Chrysophanol-Induced Autophagy Disrupts Apoptosis via the PI3K/Akt/mTOR Pathway in Oral Squamous Cell Carcinoma Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Regents
2.2. Cell Culture
2.3. Cell Proliferation Assay
2.4. Colony-Formation Assay
2.5. Fluorescence Images
2.6. Gene Expression Analysis by Real-Time PCR
2.7. Western Blot Analysis
2.8. Immunofluorescence
2.9. Statistical Analysis
3. Results
3.1. Chrysophanol Reduced Cell Viability and Proliferation in OSCC Cells
3.2. Chrysophanol-Induced Apoptosis via the Caspase Activation in OSCC Cells
3.3. Chrysophanol-Induced Autophagy in OSCC Cells
3.4. Chrysophanol-Induced Autophagy Impeded Apoptosis in OSCC Cells
3.5. Chrysophanol Produced the Akt/mTOR Signaling Pathway in OSCC Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Pires, F.R.; Ramos, A.B.; Oliveira, J.B.; Tavares, A.S.; Luz, P.S.; Santos, T.C. Oral squamous cell carcinoma: Clinicopathological features from 346 cases from a single oral pathology service during an 8-year period. J. Appl. Oral Sci. 2013, 21, 460–467. [Google Scholar] [CrossRef]
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Montero, P.H.; Patel, S.G. Cancer of the oral cavity. Surg. Oncol. Clin. N. Am. 2015, 24, 491–508. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stathopoulos, P.; Smith, W.P. Analysis of Survival Rates Following Primary Surgery of 178 Consecutive Patients with Oral Cancer in a Large District General Hospital. J. Maxillofac. Oral Surg. 2017, 16, 158–163. [Google Scholar] [CrossRef] [PubMed]
- Ando, N.; Iizuka, T.; Ide, H.; Ishida, K.; Shinoda, M.; Nishimaki, T.; Takiyama, W.; Watanabe, H.; Isono, K.; Aoyama, N.; et al. Surgery plus chemotherapy compared with surgery alone for localized squamous cell carcinoma of the thoracic esophagus: A Japan Clinical Oncology Group Study—JCOG9204. J. Clin. Oncol. 2003, 21, 4592–4596. [Google Scholar] [CrossRef]
- Foy, J.P.; Bertolus, C.; William, W.N., Jr.; Saintigny, P. Oral premalignancy: The roles of early detection and chemoprevention. Otolaryngol. Clin. N. Am. 2013, 46, 579–597. [Google Scholar] [CrossRef] [Green Version]
- Pistritto, G.; Trisciuoglio, D.; Ceci, C.; Garufi, A.; D’Orazi, G. Apoptosis as anticancer mechanism function and dysfunction of its modulators and targeted therapeutic strategies. Aging 2016, 8, 603–619. [Google Scholar] [CrossRef] [Green Version]
- Kalimuthu, S.; Se-Kwon, K. Cell survival and apoptosis signaling as therapeutic target for cancer: Marine bioactive compounds. Int. J. Mol. Sci. 2013, 14, 2334–2354. [Google Scholar] [CrossRef] [Green Version]
- Plati, J.; Bucur, O.; Khosravi-Far, R. Apoptotic cell signaling in cancer progression and therapy. Integr. Biol. 2011, 3, 279–296. [Google Scholar] [CrossRef]
- Das, G.; Shravage, B.V.; Baehrecke, E.H. Regulation and function of autophagy during cell survival and cell death. Cold Spring Harb. Perspect. Biol. 2012, 4, a008813. [Google Scholar] [CrossRef]
- Colomb, D.B.M.a.M.I. A novel assay to study autophagy: Regulation of autophagosome vacuole size by amino acid deprivation. J. Cell Sci. 2001, 114, 3619–3629. [Google Scholar]
- Bialik, S.; Dasari, S.K.; Kimchi, A. Autophagy-dependent cell death—where, how and why a cell eats itself to death. J. Cell Sci. 2018, 131, jcs215152. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gozuacik, D.; Kimchi, A. Autophagy as a cell death and tumor suppressor mechanism. Oncogene 2004, 23, 2891–2906. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rosenfeldt, M.T.; O’Prey, J.; Morton, J.P.; Nixon, C.; MacKay, G.; Mrowinska, A.; Au, A.; Rai, T.S.; Zheng, L.; Ridgway, R.; et al. p53 status determines the role of autophagy in pancreatic tumour development. Nature 2013, 504, 296–300. [Google Scholar] [CrossRef] [PubMed]
- Maiuri, M.C.; Zalckvar, E.; Kimchi, A.; Kroemer, G. Self-eating and self-killing: Crosstalk between autophagy and apoptosis. Nat. Rev. Mol. Cell Biol. 2007, 8, 741–752. [Google Scholar] [CrossRef]
- Hanahan, D.; Weinberg, R.A. Hallmarks of cancer: The next generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [Green Version]
- Dannemann, N.; Hart, J.R.; Ueno, L.; Vogt, P.K. Phosphatidylinositol 4,5-bisphosphate-specific AKT1 is oncogenic. Int. J. Cancer 2010, 127, 239–244. [Google Scholar] [CrossRef] [Green Version]
- Porta, C.; Paglino, C.; Mosca, A. Targeting PI3K/Akt/mTOR Signaling in Cancer. Front. Oncol. 2014, 4, 64. [Google Scholar] [CrossRef] [Green Version]
- Hein, A.L.; Ouellette, M.M.; Yan, Y. Radiation-induced signaling pathways that promote cancer cell survival (review). Int. J. Oncol. 2014, 45, 1813–1819. [Google Scholar] [CrossRef] [Green Version]
- Dan, H.C.; Ebbs, A.; Pasparakis, M.; Van Dyke, T.; Basseres, D.S.; Baldwin, A.S. Akt-dependent activation of mTORC1 complex involves phosphorylation of mTOR (mammalian target of rapamycin) by IkappaB kinase alpha (IKKalpha). J. Biol. Chem. 2014, 289, 25227–25240. [Google Scholar] [CrossRef] [Green Version]
- Castedo, M.; Ferri, K.F.; Kroemer, G. Mammalian Target of Rapamycin (mTOR): Pro- and Anti-Apoptotic. Cell Death Differ. 2002, 9, 99–100. [Google Scholar] [CrossRef] [PubMed]
- Jung, C.H.; Ro, S.H.; Cao, J.; Otto, N.M.; Kim, D.H. mTOR regulation of autophagy. FEBS Lett. 2010, 584, 1287–1295. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Harsha, C.; Banik, K.; Ang, H.L.; Girisa, S.; Vikkurthi, R.; Parama, D.; Rana, V.; Shabnam, B.; Khatoon, E.; Kumar, A.P.; et al. Targeting AKT/mTOR in Oral Cancer: Mechanisms and Advances in Clinical Trials. Int. J. Mol. Sci. 2020, 21, 3285. [Google Scholar] [CrossRef] [PubMed]
- Hanikoglu, A.; Hanikoglu, F.; Ozben, T. Natural Product Inhibitors of Histone Deacetylases as New Anticancer Agents. Curr. Protein Pept. Sci. 2018, 19, 333–340. [Google Scholar] [CrossRef]
- Xiao, Z.; Morris-Natschke, S.L.; Lee, K.H. Strategies for the Optimization of Natural Leads to Anticancer Drugs or Drug Candidates. Med. Res. Rev. 2016, 36, 32–91. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ullah, A.; Ullah, N.; Nawaz, T.; Aziz, T. Molecular mechanisms of Sanguinarine in cancer prevention and treatment. Anticancer Agents Med. Chem. 2022, 22, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Ullah, A.; Leong, S.W.; Wang, J.; Wu, Q.; Ghauri, M.A.; Sarwar, A.; Su, Q.; Zhang, Y. Cephalomannine inhibits hypoxia-induced cellular function via the suppression of APEX1/HIF-1α interaction in lung cancer. Cell Death Dis. 2021, 12, 490. [Google Scholar] [CrossRef]
- Iqbal, H.; Menaa, F.; Khan, N.U.; Razzaq, A.; Khan, Z.U.; Ullah, K.; Kamal, R.; Sohail, M.; Thiripuranathar, G.; Uzair, B.; et al. Two Promising Anti-Cancer Compounds, 2-Hydroxycinnaldehyde and 2- Benzoyloxycinnamaldehyde: Where do we stand? Comb. Chem. High Throughput Screen. 2022, 25, 808–818. [Google Scholar] [CrossRef]
- Iqbal, H.; Razzaq, A.; Khan, N.U.; Rehman, S.U.; Webster, T.J.; Xiao, R.; Menaa, F. pH-responsive albumin-coated biopolymeric nanoparticles with lapatinab for targeted breast cancer therapy. Biomater. Adv. 2022, 139, 213039. [Google Scholar] [CrossRef]
- Gu, M.; Zhou, Y.; Liao, N.; Wei, Q.; Bai, Z.; Bao, N.; Zhu, Y.; Zhang, H.; Gao, L.; Cheng, X. Chrysophanol, a main anthraquinone from Rheum palmatum L. (rhubarb), protects against renal fibrosis by suppressing NKD2/NF-κB pathway. Phytomedicine 2022, 105, 154381. [Google Scholar] [CrossRef]
- Prateeksha; Yusuf, M.A.; Singh, B.N.; Sudheer, S.; Kharwar, R.N.; Siddiqui, S.; Abdel-Azeem, A.M.; Fernandes Fraceto, L.; Dashora, K.; Gupta, V.K. Chrysophanol: A Natural Anthraquinone with Multifaceted Biotherapeutic Potential. Biomolecules 2019, 9, 68. [Google Scholar] [CrossRef]
- Song, G.; Zhang, Y.; Yu, S.; Lv, W.; Guan, Z.; Sun, M.; Wang, J. Chrysophanol attenuates airway inflammation and remodeling through nuclear factor-kappa B signaling pathway in asthma. Phytother. Res. 2019, 33, 2702–2713. [Google Scholar] [CrossRef] [PubMed]
- Zeng, C.; Guo, B.; Chen, J.; He, W. Antitumor Effects of Chrysophanol in Malignant Optic Nerve Meningioma Cell Lines are Mediated via Caspase Activation, Induction of Mitochondrial Mediated Apoptosis, Mitochondrial Membrane Depolarization and Targeting the Mitogen-Activated Protein Kinase Signaling Pathway. Pharmacology 2019, 104, 28–35. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.S.; Cha, E.Y.; Sul, J.Y.; Song, I.S.; Kim, J.Y. Chrysophanic acid blocks proliferation of colon cancer cells by inhibiting EGFR/mTOR pathway. Phytother. Res. 2011, 25, 833–837. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.S. Chrysophanic Acid Induces Necrosis but not Necroptosis in Human Renal Cell Carcinoma Caki-2 Cells. J. Cancer Prev. 2016, 21, 81–87. [Google Scholar] [CrossRef] [Green Version]
- Lim, W.; Yang, C.; Bazer, F.W.; Song, G. Chrysophanol Induces Apoptosis of Choriocarcinoma Through Regulation of ROS and the AKT and ERK1/2 Pathways. J. Cell Physiol. 2017, 232, 331–339. [Google Scholar] [CrossRef]
- Lim, W.; An, Y.; Yang, C.; Bazer, F.W.; Song, G. Chrysophanol induces cell death and inhibits invasiveness via mitochondrial calcium overload in ovarian cancer cells. J. Cell Biochem. 2018, 119, 10216–10227. [Google Scholar] [CrossRef]
- Lu, C.C.; Yang, J.S.; Huang, A.C.; Hsia, T.C.; Chou, S.T.; Kuo, C.L.; Lu, H.F.; Lee, T.H.; Wood, W.G.; Chung, J.G. Chrysophanol induces necrosis through the production of ROS and alteration of ATP levels in J5 human liver cancer cells. Mol. Nutr. Food Res. 2010, 54, 967–976. [Google Scholar] [CrossRef] [Green Version]
- Ren, L.; Li, Z.; Dai, C.; Zhao, D.; Wang, Y.; Ma, C.; Liu, C. Chrysophanol inhibits proliferation and induces apoptosis through NF-kappaB/cyclin D1 and NF-kappaB/Bcl-2 signaling cascade in breast cancer cell lines. Mol. Med. Rep. 2018, 17, 4376–4382. [Google Scholar] [CrossRef] [Green Version]
- Elmore, S. Apoptosis: A Review of Programmed Cell Death. Toxicol. Pathol. 2007, 35, 495–516. [Google Scholar] [CrossRef]
- Elefantova, K.; Lakatos, B.; Kubickova, J.; Sulova, Z.; Breier, A. Detection of the Mitochondrial Membrane Potential by the Cationic Dye JC-1 in L1210 Cells with Massive Overexpression of the Plasma Membrane ABCB1 Drug Transporter. Int. J. Mol. Sci. 2018, 19, 1985. [Google Scholar] [CrossRef] [PubMed]
- Paglin, S.; Hollister, T.; Delohery, T.; Hackett, N.; McMahill, M.; Sphicas, E.; Domingo, D.; Yahalom, J. A Novel Response of Cancer Cells to Radiation Involves Autophagy and Formation of Acidic Vesicles. Cancer Res. 2001, 61, 439–444. [Google Scholar] [PubMed]
- Cheng, N.-T.; Meng, H.; Ma, L.-F.; Zhang, L.; Yu, H.-M.; Wang, Z.-Z.; Guo, A. Role of autophagy in the progression of osteoarthritis: The autophagy inhibitor, 3-methyladenine, aggravates the severity of experimental osteoarthritis. Int. J. Mol. Med. 2017, 39, 1224–1232. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Newmeyer, D.D.; Ferguson-Miller, S. Mitochondria: Releasing power for life and unleashing the machineries of death. Cell 2003, 112, 481–490. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Giddings, L.A.; Newman, D.J. Microbial natural products: Molecular blueprints for antitumor drugs. J. Ind. Microbiol. Biotechnol. 2013, 40, 1181–1210. [Google Scholar] [CrossRef]
- Butler, M.S. Natural products to drugs: Natural product-derived compounds in clinical trials. Nat. Prod. Rep. 2008, 25, 475–516. [Google Scholar] [CrossRef]
- Ni, C.H.; Chen, P.Y.; Lu, H.F.; Yang, J.S.; Huang, H.Y.; Wu, S.H.; Ip, S.W.; Wu, C.T.; Chiang, S.Y.; Lin, J.G.; et al. Chrysophanol-induced necrotic-like cell death through an impaired mitochondrial ATP synthesis in Hep3B human liver cancer cells. Arch. Pharm. Res. 2012, 35, 887–895. [Google Scholar] [CrossRef] [PubMed]
- Tait, S.W.; Green, D.R. Mitochondria and cell death: Outer membrane permeabilization and beyond. Nat. Rev. Mol. Cell Biol. 2010, 11, 621–632. [Google Scholar] [CrossRef]
- Kang, M.H.; Reynolds, C.P. Bcl-2 Inhibitors: Targeting Mitochondrial Apoptotic Pathways in Cancer Therapy. Clin. Cancer Res. 2009, 15, 1126–1132. [Google Scholar] [CrossRef] [Green Version]
- Ly, J.D.; Grubb, D.R.; Lawen, A. The mitochondrial membrane potential (∆ψm) in apoptosis; an update. Apoptosis 2003, 8, 115–128. [Google Scholar] [CrossRef]
- Kim, H.-E.; Jiang, X.; Du, F.; Wang, X. PHAPI, CAS, and Hsp70 Promote Apoptosome Formation by Preventing Apaf-1 Aggregation and Enhancing Nucleotide Exchange on Apaf-1. Mol. Cell 2008, 30, 239–247. [Google Scholar] [CrossRef] [PubMed]
- Kim, C.H.; Ko, A.R.; Lee, S.Y.; Jeon, H.M.; Kim, S.M.; Park, H.G.; Han, S.I.; Kang, H.S. Hypoxia switches glucose depletion-induced necrosis to phosphoinositide 3-kinase/Akt-dependent apoptosis in A549 lung adenocarcinoma cells. Int. J. Oncol. 2010, 36, 117. [Google Scholar] [PubMed]
- Amaravadi, R.; Kimmelman, A.C.; White, E. Recent insights into the function of autophagy in cancer. Genes Dev. 2016, 30, 1913–1930. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Levy, J.M.M.; Towers, C.G.; Thorburn, A. Targeting autophagy in cancer. Nat. Rev. Cancer 2017, 17, 528–542. [Google Scholar] [CrossRef] [PubMed]
- Yousefi, S.; Perozzo, R.; Schmid, I.; Ziemiecki, A.; Schaffner, T.; Scapozza, L.; Brunner, T.; Simon, H.U. Calpain-mediated cleavage of Atg5 switches autophagy to apoptosis. Nat. Cell Biol. 2006, 8, 1124–1132. [Google Scholar] [CrossRef] [PubMed]
- Roy, S.; Debnath, J. Autophagy and tumorigenesis. Semin. Immunopathol. 2010, 32, 383–396. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yoshii, S.R.; Mizushima, N. Monitoring and Measuring Autophagy. Int. J. Mol. Sci. 2017, 18, 1865. [Google Scholar] [CrossRef]
- Islam, M.A.; Sooro, M.A.; Zhang, P. Autophagic Regulation of p62 is Critical for Cancer Therapy. Int. J. Mol. Sci. 2018, 19, 1405. [Google Scholar] [CrossRef] [Green Version]
- D’Arcy, M.S. Cell death: A review of the major forms of apoptosis, necrosis and autophagy. Cell Biol. Int. 2019, 43, 582–592. [Google Scholar] [CrossRef]
- Fan, X.J.; Wang, Y.; Wang, L.; Zhu, M. Salidroside induces apoptosis and autophagy in human colorectal cancer cells through inhibition of PI3K/Akt/mTOR pathway. Oncol. Rep. 2016, 36, 3559–3567. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Totoń, E.; Lisiak, N.; Sawicka, P.; Rybczynska, M. Beclin-1 and its role as a target for anticancer therapy. J. Physiol. Pharmacol. 2014, 65, 459–467. [Google Scholar] [PubMed]
- Kang, R.; Zeh, H.J.; Lotze, M.T.; Tang, D. The Beclin 1 network regulates autophagy and apoptosis. Cell Death Differ. 2011, 18, 571–580. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.Y.; Lin, J.H.; Muharram, A.; Liu, W.G. Beclin-1-mediated autophagy protects spinal cord neurons against mechanical injury-induced apoptosis. Apoptosis 2014, 19, 933–945. [Google Scholar] [CrossRef] [PubMed]
- Noguchi, M.; Hirata, N.; Suizu, F. The links between AKT and two intracellular proteolytic cascades: Ubiquitination and autophagy. Biochim. Biophys. Acta 2014, 1846, 342–352. [Google Scholar] [CrossRef] [Green Version]
- Paquette, M.; El-Houjeiri, L.; Pause, A. mTOR Pathways in Cancer and Autophagy. Cancers 2018, 10, 18. [Google Scholar] [CrossRef]
Target Gene | Primer Sequence (5′ to 3′) | |
---|---|---|
ATG5 | Forward | GGGGTGACTGGACTTGTTG |
Reverse | CACTTCCCGCCCTCTGGTATC | |
p62/SQSTM1 | Forward | AGCTCAGGAAGGTGCCATT |
Reverse | TTCTCAAGGCCCCATGTTGCAC | |
MAP1LC3B | Forward | AAGGCTTTCAGAGAGACCCTG |
Reverse | TTGCGCTTCCAACTCAGGC | |
GAPDH | Forward | GACAGTCAGCCGCATCTTCT |
Reverse | GCGCCCAATACGACCAAATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, D.-B.; Park, B.-S.; Kang, H.-M.; Kim, J.-H.; Kim, I.-R. Chrysophanol-Induced Autophagy Disrupts Apoptosis via the PI3K/Akt/mTOR Pathway in Oral Squamous Cell Carcinoma Cells. Medicina 2023, 59, 42. https://doi.org/10.3390/medicina59010042
Park D-B, Park B-S, Kang H-M, Kim J-H, Kim I-R. Chrysophanol-Induced Autophagy Disrupts Apoptosis via the PI3K/Akt/mTOR Pathway in Oral Squamous Cell Carcinoma Cells. Medicina. 2023; 59(1):42. https://doi.org/10.3390/medicina59010042
Chicago/Turabian StylePark, Dan-Bi, Bong-Soo Park, Hae-Mi Kang, Jung-Han Kim, and In-Ryoung Kim. 2023. "Chrysophanol-Induced Autophagy Disrupts Apoptosis via the PI3K/Akt/mTOR Pathway in Oral Squamous Cell Carcinoma Cells" Medicina 59, no. 1: 42. https://doi.org/10.3390/medicina59010042