A Benzimidazole-Based N-Heterocyclic Carbene Derivative Exhibits Potent Antiproliferative and Apoptotic Effects against Colorectal Cancer
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Cell Culture
2.3. IMBZC Synthesis and Preparation
2.4. MTT Cytotoxicity Assay
2.5. Scratch Wound-Healing Assay
2.6. Clonogenic Assay
2.7. Real-Time Reverse Transcription–Quantitative Polymerase Chain Reaction (RT-qPCR)
2.8. Western Blot Technology
2.9. Statistical Analysis
3. Results
3.1. IMBZC Compound Inhibits CRC Cell Viability in a Dose-Dependent Manner
3.2. IMBZC Compound Decreases CRC Cell Migration and Inhibits Colony Formation
3.3. IMBZC Downregulates the Expression Levels of Anti-Apoptotic Bcl-2 and Bcl-xL While Upregulating Pro-Apoptotic Bax and p53 in a Dose-Dependent Manner
3.4. IMBZC Enhances the Cytotoxic Effects of Conventional CRC Drugs 5-FU, IRI, and OXA
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Ahmad, R.; Singh, J.K.; Wunnava, A.; Al-Obeed, O.; Abdulla, M.; Srivastava, S.K. Emerging trends in colorectal cancer: Dysregulated signaling pathways. Int. J. Mol. 2021, 47, 14. [Google Scholar] [CrossRef] [PubMed]
- Xi, Y.; Xu, P. Global colorectal cancer burden in 2020 and projections to 2040. Transl. Oncol. 2021, 14, 101174. [Google Scholar] [CrossRef] [PubMed]
- Deo, S.V.S.; Sharma, J.; Kumar, S. GLOBOCAN 2020 report on global cancer burden: Challenges and opportunities for surgical oncologists. Ann. Surg. Oncol. 2022, 29, 6497–6500. [Google Scholar] [CrossRef] [PubMed]
- Islami, F.; Goding Sauer, A.; Miller, K.D.; Siegel, R.L.; Fedewa, S.A.; Jacobs, E.J.; McCullough, M.L.; Patel, A.V.; Ma, J.; Soerjomataram, I.; et al. Proportion and number of cancer cases and deaths attributable to potentially modifiable risk factors in the United States. CA Cancer J. Clin. 2018, 68, 31–54. [Google Scholar] [CrossRef]
- Edward, C.; Sartorelli, A.C. Cancer chemotherapy. Lange’s Basic Clin. Pharmacol. 2018, 948–976. [Google Scholar]
- Aldahhan, R.; Almohazey, D.; Khan, F.A. Emerging trends in the application of gold nanoformulations in colon cancer diagnosis and treatment. In Seminars in Cancer Biology; Academic Press: Cambridge, MA, USA, 2022; Volume 86, pp. 1056–1065. [Google Scholar]
- Branca, J.J.V.; Carrino, D.; Gulisano, M.; Ghelardini, C.; Di Cesare Mannelli, L.; Pacini, A. Oxaliplatin-induced neuropathy: Genetic and epigenetic profile to better understand how to ameliorate this side effect. Front. Mol. Biosci. 2021, 8, 643824. [Google Scholar] [CrossRef]
- Bukowski, K.; Kciuk, M.; Kontek, R. Mechanisms of multidrug resistance in cancer chemotherapy. Int. J. Mol. Sci. 2020, 21, 3233. [Google Scholar] [CrossRef]
- Liu, J.; Xing, X.N.; Huang, J.H.; Lu, L.Q.; Xiao, W.J. Light opens a new window for N-heterocyclic carbene catalysis. Chem. Sci. 2020, 11, 10605–10613. [Google Scholar] [CrossRef]
- Lenis-Rojas, O.A.; Cordeiro, S.; Horta-Meireles, M.; Fernández, J.A.A.; Fernández Vila, S.; Rubiolo, J.A.; Cabezas-Sainz, P.; Sanchez, L.; Fernandes, A.R.; Royo, B. N-heterocyclic carbene iron complexes as anticancer agents: In vitro and in vivo biological studies. Molecules 2021, 26, 5535. [Google Scholar] [CrossRef]
- Chen, J.; Huang, Y. N-Heterocyclic Carbenes as Brønsted Base Catalysts; Wiley-VCH: Weinheim, Germany, 2018. [Google Scholar]
- Barik, S.; Biju, A.T. N-Heterocyclic carbene (NHC) organocatalysis using aliphatic aldehydes. Chem. Commun. 2020, 56, 15484–15495. [Google Scholar] [CrossRef]
- Porchia, M.; Pellei, M.; Marinelli, M.; Tisato, F.; Del Bello, F.; Santini, C. New insights in Au-NHCs complexes as anticancer agents. Eur. J. Med. Chem. 2018, 146, 709–746. [Google Scholar] [CrossRef]
- Gürbüz, N.; Kaloğlu, N.; Kızrak, Ü.; Özdemir, İ.; Türkmen, N.B.; Çiftçi, O.; Özdemir, I.; Mansour, L.; Naceur, H. Silver (I) N-heterocyclic carbene complexes: Synthesis, characterization and cytotoxic properties. J. Organomet. Chem. 2020, 923, 121434. [Google Scholar] [CrossRef]
- Tahlan, S.; Kumar, S.; Kakkar, S.; Narasimhan, B. Benzimidazole scaffolds as promising antiproliferative agents: A review. BMC Chem. 2019, 13, 66. [Google Scholar] [CrossRef] [PubMed]
- Li, S.R.; Tan, Y.M.; Zhang, L.; Zhou, C.H. Comprehensive Insights into Medicinal Research on Imidazole-Based Supramolecular Complexes. Pharmaceutics 2023, 15, 1348. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.; Wang, H.; Addla, D.; Zhou, C. Current Researches and Applications of Azole-BasedSupermolecules as Medicinal Agents. Chin. J. Org. Chem. 2016, 36, 1. [Google Scholar] [CrossRef]
- Abdulla, M.H.; Alzailai, A.A.; Vaali-Mohammed, M.A.; Ahmad, R.; Fatima, S.; Zubaidi, A.; Khan, Z. The platinum coordination complex inhibits cell invasion-migration and epithelial-to-mesenchymal transition by altering the TGF-β-SMAD pathway in colorectal cancer. Front. Pharmacol. 2023, 14, 1178190. [Google Scholar] [CrossRef]
- Boubakri, L.; Chakchouk-Mtibaa, A.; Al-Ayed, A.S.; Mansour, L.; Abutaha, N.; Harrath, A.H.; Mellouli, L.; Özdemir, I.; Yasar, S.; Hamdi, N. Ru (II)–N-heterocyclic carbene complexes: Synthesis, characterization, transfer hydrogenation reactions and biological determination. RSC Adv. 2019, 9, 34406–34420. [Google Scholar] [CrossRef]
- Slimani, I.; Mansour, L.; Abutaha, N.; Harrath, A.H.; Al-Tamimi, J.; Gürbüz, N.; Özdemir, I.; Hamdi, N. Synthesis, structural characterization of silver (I)-NHC complexes and their antimicrobial, antioxidant and antitumor activities. J. King Saud Univ. -Sci. 2020, 32, 1544–1554. [Google Scholar] [CrossRef]
- Al-Obeed, O.; El-Obeid, A.S.; Matou-Nasri, S.; Vaali-Mohammed, M.A.; AlHaidan, Y.; Elwatidy, M.; Al Dosary, H.; Alehaideb, Z.; Alkhayal, K.; Haseeb, A.; et al. Herbal melanin inhibits colorectal cancer cell proliferation by altering redox balance, inducing apoptosis, and modulating MAPK signaling. Cancer Cell Int. 2020, 20, 1–17. [Google Scholar] [CrossRef]
- Al-Khayal, K.; Vaali-Mohammed, M.A.; Elwatidy, M.; Bin Traiki, T.; Al-Obeed, O.; Azam, M.; Khan, Z.; Abdulla, M.; Ahmad, R. A novel coordination complex of platinum (PT) induces cell death in colorectal cancer by altering redox balance and modulating MAPK pathway. Bmc Cancer 2020, 20, 1–17. [Google Scholar] [CrossRef]
- Varna, D.; Zainuddin, D.I.; Hatzidimitriou, A.G.; Psomas, G.; Pantazaki, A.A.; Papi, R.; Angaridis, P.; Aslanidis, P. Homoleptic and heteroleptic silver (I) complexes bearing diphosphane and thioamide ligands: Synthesis, structures, DNA interactions and antibacterial activity studies. Mater. Sci. Eng. C 2019, 99, 450–459. [Google Scholar] [CrossRef]
- Zou, T.; Lok, C.N.; Wan, P.K.; Zhang, Z.F.; Fung, S.K.; Che, C.M. Anticancer metal-N-heterocyclic carbene complexes of gold, platinum and palladium. Curr. Opin. Chem. Biol. 2018, 43, 30–36. [Google Scholar] [CrossRef] [PubMed]
- Asif, M.; Iqbal, M.A.; Hussein, M.A.; Oon, C.E.; Haque, R.A.; Ahamed, M.B.K.; Majid, A.S.A.; Majid, A.M.S.A. Human colon cancer targeted pro-apoptotic, anti-metastatic and cytostatic effects of binuclear Silver (I)–N-Heterocyclic carbene (NHC) complexes. Eur. J. Med. Chem. 2016, 108, 177–187. [Google Scholar] [CrossRef] [PubMed]
- Habib, A.; Nazari, M.; Iqbal, M.A.; Bhatti, H.N.; Ahmed, M.K.; Majid, A.A. Unsymmetrically substituted benzimidazolium based Silver (I)-N-heterocyclic carbene complexes: Synthesis, characterization and in vitro anticancer study against human breast cancer and colon cancer. J. Saudi Chem. Soc. 2019, 23, 795–808. [Google Scholar] [CrossRef]
- Vaali-Mohammed, M.A.; Abdulla, M.H.; Matou-Nasri, S.; Eldehna, W.M.; Meeramaideen, M.; Elkaeed, E.B.; El-Watidy, M.; Alhassan, N.S.; Alkhaya, K.; Al Obeed, O. The Anticancer Effects of the Pro-Apoptotic Benzofuran-Isatin Conjugate (5a) Are Associated With p53 Upregulation and Enhancement of Conventional Chemotherapeutic Drug Efficiency in Colorectal Cancer Cell Lines. Front. Pharmacol. 2022, 13, 923398. [Google Scholar] [CrossRef] [PubMed]
- Al-Obeed, O.; Vaali-Mohammed, M.A.; Eldehna, W.M.; Al-Khayal, K.; Mahmood, A.; Abdel-Aziz, H.A.; Zubaidi, A.; Alafeefy, A.; Abdulla, M.; Ahmad, R. Novel quinazoline-based sulfonamide derivative (3D) induces apoptosis in colorectal cancer by inhibiting JAK2–STAT3 pathway. OncoTargets Ther. 2018, 11, 3313–3322. [Google Scholar] [CrossRef]
- Zhu, S.; Li, T.; Tan, J.; Yan, X.; Zhang, D.; Zheng, C.; Chen, Y.; Xiang, Z.; Cui, H. Bax is essential for death receptor-mediated apoptosis in human colon cancer cells. Cancer Biother. Radiopharm. 2012, 27, 577–581. [Google Scholar]
- Cherbonnel-Lasserre, C.; Dosanjh, M.K. Suppression of apoptosis by overexpression of Bcl-2 or Bcl-xL promotes survival and mutagenesis after oxidative damage. Biochimie 1997, 79, 613–617. [Google Scholar] [CrossRef]
- Fadholly, A.; Ansori, A.N.; Jayanti, S.; Proboningrat, A.; Kusala, M.K.; Putri, N.; Rantam, F.A.; Sudjarwo, S.A. Cytotoxic effect of Allium cepa L. extract on human colon cancer (WiDr) cells: In vitro study. Res. J. Pharm. Technol. 2019, 12, 3483–3486. [Google Scholar] [CrossRef]
Target Gene | Primer Sequence 5′→3′ |
---|---|
GAPDH | GTCTCCTCTGACTTCAACAGCG (forward) |
ACCACCCTGTTGCTGTAGCCAA (reverse) | |
BAX | CCCGAGAGGTCTTTTTCCGAG (forward) |
CCAGCCCATGATGGTTCTGAT (reverse) | |
BCL2 | TCCGCATCAGGAAGGCTAGA (forward) |
AGGACCAGGCCTCCAAGCT (reverse) | |
BCL-xL | AGTTCCCTTGGCCTCAGAAT (forward) |
TCCTTTCTGGGGAAGAGGTT (reverse) | |
TP53 | CCTCAGCATCTTATCCGAGTGG (forward) |
TGAGGCTCACGTCCATCTCGTC (reverse) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Al-Nasser, S.; Abdulla, M.H.; Alhassan, N.; Vaali-Mohammed, M.-A.; Al-Omar, S.; Hamdi, N.; Elnakady, Y.; Matou-Nasri, S.; Mansour, L. A Benzimidazole-Based N-Heterocyclic Carbene Derivative Exhibits Potent Antiproliferative and Apoptotic Effects against Colorectal Cancer. Medicina 2024, 60, 1379. https://doi.org/10.3390/medicina60091379
Al-Nasser S, Abdulla MH, Alhassan N, Vaali-Mohammed M-A, Al-Omar S, Hamdi N, Elnakady Y, Matou-Nasri S, Mansour L. A Benzimidazole-Based N-Heterocyclic Carbene Derivative Exhibits Potent Antiproliferative and Apoptotic Effects against Colorectal Cancer. Medicina. 2024; 60(9):1379. https://doi.org/10.3390/medicina60091379
Chicago/Turabian StyleAl-Nasser, Sarah, Maha Hamadien Abdulla, Noura Alhassan, Mansoor-Ali Vaali-Mohammed, Suliman Al-Omar, Naceur Hamdi, Yasser Elnakady, Sabine Matou-Nasri, and Lamjed Mansour. 2024. "A Benzimidazole-Based N-Heterocyclic Carbene Derivative Exhibits Potent Antiproliferative and Apoptotic Effects against Colorectal Cancer" Medicina 60, no. 9: 1379. https://doi.org/10.3390/medicina60091379