Comparative Study of Denitrifying-MBBRs with Different Polyethylene Carriers for Advanced Nitrogen Removal of Real Reverse Osmosis Concentrate
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reactor Set-Up and Operation
2.2. The Characteristic of Reverse Osmosis Concentrate
2.3. Analyses of Water Quality
2.4. Microbial and Molecular Biology Analysis
2.4.1. Quantitative Polymerase Chain Reaction (Q-PCR) Analysis
2.4.2. High Throughput Analysis
3. Results and Discussion
3.1. Nitrogen Removal
3.1.1. NO3-–N and TN Removal
3.1.2. NO2-–N and NH4+–N Removal
3.2. Microbial Characteristics of Moving Bed Biofilm Reactor (MBBRs)
3.2.1. Biomass Analysis
3.2.2. Scanning Electron Microscopy (SEM) Observation
3.2.3. Q-PCR Analysis
3.2.4. High Throughput Analysis
4. Conclusions
- The MBBR C with Φ15 × 15 polyethylene as the carrier had the best removal performance on NO3-–N, NO2-–N, NH4+–N, and TN in real reverse osmosis concentrate, which was 78.0 ± 15.8%, 43.79 ± 9.30%, 55.56 ± 22.28%, and 68.9 ± 12.4%, respectively.
- The MBBR C had most abundant microorganisms (2.13 mg/g-carrier). SEM observations showed that many short rod bacteria were attached to the suspended filler. These were similar in shape and size to some denitrificants. The gene of the biofilm on reactor C was the most abundant, while the biofilm of reactor A had the worst gene richness. From high throughput analysis, Proteobacteria are the most abundant phylum, followed by Bacteroidetes, then Firmicutes.
- According to the N removal efficiency and biomass as well as the microbial characteristic of four poly-carriers, the Φ15 × 15 poly-filler in reactor C was recommended as the best MBBR carrier for denitrification.
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Zhou, Y.; Chang, C.C.; Ni, Y.; Li, J.; Wei, S.; Zhang, Y. Status and development for municipal wastewater reuse in China. Int. Symp. Water Resour. Env. Prot. 2011, 4, 3183–3186. [Google Scholar]
- Bixio, D.; Thoeye, C.; Koning, J.D.; Joksimovic, D.; Savic, D.; Wintgens, T.; Melin, T. Wastewater reuse in Europe. Desalination 2006, 187, 89–101. [Google Scholar] [CrossRef]
- Joss, A.; Baenninger, C.; Foa, P.; Koepke, S.; Krauss, M.; McArdell, C.; Rottermann, K.; Wei, Y.; Zapata, A.; Siegrist, H. Water reuse: >90% water yield in MBR/RO through concentrate recycling and CO addition as scaling control. Water Res. 2011, 45, 6141–6151. [Google Scholar] [CrossRef] [PubMed]
- Zhang, A.; Gu, Z.; Chen, W.; Li, Q.; Jiang, G. Removal of refractory organic pollutants in reverse-osmosis concentrated leachate by Microwave–Fenton process. Environ. Sci. Pollut. Res. 2018, 25, 28907–28916. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Wang, X.; Zhang, H.; Zhang, Z.; Ding, J.; Lu, J. Comparing the performance of various nanofiltration membranes in advanced oxidation-nanofiltration treatment of reverse osmosis concentrates. Environ. Sci. Pollut. Res. 2019, 26, 17472–17481. [Google Scholar] [CrossRef]
- Liu, H.; Jiang, W.; Wan, D.; Qu, J. Study of a combined heterotrophic and sulfur autotrophic denitrification technology for removal of nitrate in water. J. Hazard. Mater. 2009, 169, 23–28. [Google Scholar] [CrossRef]
- Umar, M.; Roddick, F.; Fan, L. Effect of coagulation on treatment of municipal wastewater reverse osmosis concentrate by UVC/H2O2. J. Hazard. Mater. 2014, 266, 10–18. [Google Scholar] [CrossRef]
- Naidu, G.; Zhong, X.; Vigneswaran, S. Comparison of membrane distillation and freeze crystallizer as alternatives for reverse osmosis concentrate treatment. Desalination 2018, 427, 10–18. [Google Scholar] [CrossRef]
- Herrero-Gonzalez, M.; Admon, N.; Dominguez-Ramos, A.; Ibanez, R.; Wolfson, A.; Irabien, A. Environmental sustainability assessment of seawater reverse osmosis brine valorization by means of electrodialysis with bipolar membranes. Environ. Sci. Pollut. Res. 2019, 27, 1256–1266. [Google Scholar] [CrossRef]
- Li, M.; Zhou, L.; Wang, K. Effect of reverse osmosis high-salinity-water on wastewater biochemical treatment system. Gui Zhou Chem. Ind. 2011, 36, 47–49. [Google Scholar]
- Kim, I.H.; Lee, S.I.; Kim, D.K. Biological treatment of reverse osmosis concentrate from low salinity water. Desalin. Water Treat. 2016, 57, 7667–7678. [Google Scholar] [CrossRef]
- Cai, Q.Q.; Wu, M.Y.; Li, R.; Deng, S.H.; Lee, B.C.Y.; Ong, S.L.; Hu, J.Y. Potential of combined advanced oxidation – Biological process for costeffective organic matters removal in reverse osmosis concentrate produced from industrial wastewater reclamation: Screening of AOP pre-treatment technologies. Chem. Eng. J. 2020, 389, 123419. [Google Scholar] [CrossRef]
- Ye, L.; Hu, S.; Poussade, Y.; Keller, J.; Yuan, Z. Evaluating a strategy for maintaining nitrifier activity during long-term starvation in a moving bed biofilm reactor (MBBR) treating reverse osmosis concentrate. Water Sci. Technol. 2012, 66, 837–842. [Google Scholar] [CrossRef] [PubMed]
- Odegaard, H. Innovations in wastewater treatment: The moving bed biofilm process. Water Sci. Technol. 2006, 53, 17. [Google Scholar] [CrossRef]
- Mcquarrie, J.P.; Boltz, J.P. Moving bed biofilm reactor technology: Process applications, design, and performance. Water Environ. Res. A Res. Publ. Water Environ. Fed. 2011, 83, 560–575. [Google Scholar] [CrossRef]
- Zhao, Y.; Yuan, Q.; He, Z.; Wang, H.; Yan, G.; Chang, Y.; Chu, Z.; Ling, Y.; Wang, H. Influence of carrier filling ratio on the advanced nitrogen removal from wastewater treatment plant effluent by denitrifying MBBR. Int. J. Environ. Res. Public Health 2019, 16, 3244. [Google Scholar] [CrossRef] [Green Version]
- Kopec, L.; Kopec, A.; Drewnowski, J. The application of Monod equation to denitrification kinetics description in the moving bed biofilm reactor (MBBR). Int. J. Environ. Sci. Technol. 2018, 16, 1479–1486. [Google Scholar] [CrossRef] [Green Version]
- Su, J.F.; Luo, X.X.; Wei, L.; Ma, F.; Zheng, S.C.; Shao, S.C. Performance and microbial communities of Mn(II)-based autotrophic denitrification in a Moving Bed Biofilm Reactor (MBBR). Bioresour. Technol. 2016, 211, 743–750. [Google Scholar] [CrossRef]
- Zhang, S.; Wang, Y.; He, W.; Xing, M.; Wu, M.; Yang, J.; Gao, N.; Sheng, G.; Yin, D.; Liu, S. Linking nitrifying biofilm characteristics and nitrification performance in moving-bed biofilm reactors for polluted raw water pretreatment. Bioresour. Technol. 2013, 146, 416–425. [Google Scholar] [CrossRef]
- Chatterjee, P.; Ghangrekar, M.M.; Rao, S. Organic matter and nitrogen removal in a hybrid upflow anaerobic sludge blanket—Moving bed biofilm and rope bed biofilm reactor. J. Environ. Chem. Eng. 2016, 4, 3240–3245. [Google Scholar] [CrossRef]
- Yuan, Q.; Wang, H.; Hang, Q.; Deng, Y.; Liu, K.; Li, C.; Zheng, S. Comparison of the MBBR denitrification carriers for advanced nitrogen removal of wastewater treatment plant effluent. Environ. Sci. Pollut. Res. 2015, 22, 13970–13979. [Google Scholar] [CrossRef]
- Dong, Z.; Lu, M.; Huang, W.; Xu, X. Treatment of oilfield wastewater in moving bed biofilm reactors using a novel suspended ceramic biocarrier. J. Hazard. Mater. 2011, 196, 123–130. [Google Scholar] [CrossRef]
- Zhao, Y.; Cao, D.; Liu, L.; Jin, W. Municipal wastewater treatment by moving-bed-biofilm reactor with diatomaceous earth as carriers. Water Environ. Res. 2006, 78, 392. [Google Scholar] [CrossRef]
- Rouse, J.D.; Burica, O.; Strazar, M.; Levstek, M. A pilot-plant study of a moving-bed biofilm reactor system using PVA gel as a biocarrier for removals of organic carbon and nitrogen. Water Sci. Technol. A J. Int. Assoc. Water Pollut. Res. 2007, 55, 135–141. [Google Scholar] [CrossRef]
- Feng, Q.; Wen, S.; Bai, X.; Chang, W.; Cui, C.; Zhao, W. Surface modification of smithsonite with ammonia to enhance the formation of sulfidization products and its response to flotation. Miner. Eng. 2019, 137, 1–9. [Google Scholar] [CrossRef]
- Zhao, W.; Liu, D.; Feng, Q.; Wen, S.; Chang, W. DFT insights into the electronic properties and adsorption mechanism of HS− on smithsonite (101) surface. Miner. Eng. 2019, 141, 105846. [Google Scholar] [CrossRef]
- Baeza, R.; Jarpa, M.; Vidal, G. Polyhydroxyalkanoate Biosynthesis from Paper Mill Wastewater Treated by a Moving Bed Biofilm Reactor. Environ. Lett. 2012, 47, 2052–2059. [Google Scholar] [CrossRef]
- Zhuang, H.; Han, H.; Jia, S.; Zhao, Q.; Hou, B. Advanced treatment of biologically pretreated coal gasification wastewater using a novel anoxic moving bed biofilm reactor (ANMBBR)–biological aerated filter (BAF) system. Bioresour. Technol. 2014, 157, 223–230. [Google Scholar] [CrossRef]
- Tang, K.; Ooi, G.T.H.; Litty, K.; Sundmark, K.; Kaarsholm, K.; Sund, C.; Kragelund, C.; Christensson, M.; Bester, K.; Andersen, H. Removal of pharmaceuticals in conventionally treated wastewater by a polishing moving bed biofilm reactor (MBBR) with intermittent feeding. Bioresour. Technol. 2017, 236, 77–86. [Google Scholar] [CrossRef] [Green Version]
- Lei, G.; Ren, H.; Ding, L.; Wang, F.; Zhang, X. A full-scale biological treatment system application in the treated wastewater of pharmaceutical industrial park. Bioresour. Technol. 2010, 101, 5852–5861. [Google Scholar] [CrossRef]
- Rusten, B.; Eikebrokk, B.; Ulgenes, Y.; Lygren, E. Design and operations of the Kaldnes moving bed biofilm reactors. Aquac. Eng. 2006, 34, 322–331. [Google Scholar] [CrossRef]
- Vendramel, S.M.R.; Justo, A.; González, O.; Sans, C.; Esplugas, S. Reverse osmosis concentrate treatment by chemical oxidation and moving bed biofilm processes. Water Sci. Technol. 2013, 68, 2421. [Google Scholar] [CrossRef]
- Young, B.; Banihashemi, B.; Forrest, D.; Kennedy, K.; Stintzi, A.; Delatolla, R. Meso and micro-scale response of post carbon removal nitrifying MBBR biofilm across carrier type and loading. Water Res. 2016, 91, 235–243. [Google Scholar] [CrossRef]
- Salvetti, R.; Azzellino, A.; Canziani, R.; Bonomo, L. Effects of temperature on tertiary nitrification in moving-bed biofilm reactors. Water Res. 2006, 40, 2981–2993. [Google Scholar] [CrossRef]
- Sun, H.; Wu, Q.; Yu, P.; Zhang, L.; Ye, L.; Zhang, X.; Ren, H. Denitrification using excess activated sludge as carbon source: Performance and the microbial community dynamics. Bioresour. Technol. 2017, 238, 624–632. [Google Scholar] [CrossRef]
- Huang, S.; Chen, C.; Yang, X.; Wu, Q.; Zhang, R. Distribution of typical denitrifying functional genes and diversity of the nirS-encoding bacterial community related to environmental characteristics of river sediments. Biogeosciences 2011, 8, 3041–3051. [Google Scholar] [CrossRef] [Green Version]
- Vrieze, J.D.; Pinto, A.J.; Sloan, W.T.; Ijaz, U.Z. The active microbial community more accurately reflects the anaerobic digestion process: 16S rRNA (gene) sequencing as a predictive tool. Microbiome 2018, 6, 63. [Google Scholar] [CrossRef]
- Xiang, L.; Hang, M.; Yong, H.; Liang, Z.; Peng-bing, Y.; Qiang, Z. Characteristics of a Combined Heterotrophic and Sulfur Autotrophic Denitrification Technology for Removal of High Nitrate in Water. Huanjing Kexue 2016, 37, 2646. [Google Scholar]
- Scala, D.J.; Kerkhof, L.J. Nitrous oxide reductase (nosZ) gene-specific PCR primers for detection of denitrifiers and three nosZ genes from marine sediments. FEMS Microbiol. Lett. 2010, 162, 61–68. [Google Scholar] [CrossRef] [Green Version]
- Vilar-Sanz, A.; Puig, S.; García-Lledó, A.; Trias, R.; Balaguer, M.D.; Colprim, J.; Baneras, L. Denitrifying Bacterial Communities Affect Current Production and Nitrous Oxide Accumulation in a Microbial Fuel Cell. PLoS ONE 2013, 8, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Satoshi, I.; Naoaki, A.; Shigeto, O.; Keishi, S. Isolation of oligotrophic denitrifiers carrying previously uncharacterized functional gene sequences. Appl. Environ. Microbiol. 2011, 77, 338–342. [Google Scholar]
- Hang, Q.; Wang, H.; Chu, Z.; Hou, Z.; Zhou, Y.; Li, C. Nitrate-rich agricultural runoff treatment by Vallisneria -sulfur based mixotrophic denitrification process. Sci. Total Environ. 2017, 587, 108–117. [Google Scholar] [CrossRef] [PubMed]
- Schloss Patrick, D.; Westcott, S.; Ryabin, T.; Hall, J.; Hartmann, M.; Hollister, E.; Lesniewski, R.; Oakley, B.; Parks, D.; Robinson, C.; et al. Introducing mothur: Open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 2009, 75, 7537–7541. [Google Scholar] [CrossRef] [Green Version]
- Bassin, J.P.; Kleerebezem, R.; Rosado, A.S.; van Loosdrecht, M.C.M.; Dezotti, M. Effect of different operational conditions on biofifilm development, nitrifification, and nitrifying microbial population in moving-bed biofilm reactors. Environ. Sci. Technol. 2012, 46, 1546–1555. [Google Scholar] [CrossRef]
- Kumar, M.; Lin, J.G. Co-existence of anammox and denitrification for simultaneous nitrogen and carbon removal—Strategies and issues. J. Hazard. Mater. 2010, 178, 1–9. [Google Scholar] [CrossRef]
- Adabju, S. Specific Moving Bed Biofilm Reactor for Organic Removal from Synthetic Municipal Wastewater. Ph.D. Thesis, University of Technology, Sydney, Australia, 2013. [Google Scholar]
- Stinson, B.; Peric, M.; Neupane, D.; Laquidara, M.; Locke, E.; Murthy, S. Design and operating coiderations for a post denitrification MBBR to achieve limit of technology effluent NOx 1 mg/l and effluent TP 0. In 18 mg/l. In Proceedings of the Water Environment Federation, WEFTEC 2009, Orlando, FL, USA, 10–14 October 2009; Volume 4, pp. 1225–1254. [Google Scholar]
- Shrestha, A.; Riffat, R.; Bott, C.; Takacs, I.; Stinson, B.; Peric, M.; Neupane, D.; Murthy, S. Denitrification Stoichiometry and Kinetics of Moving Bed Biofilm Reactor. Proc. Water Environ. Fed. 2009, 2009, 153–165. [Google Scholar] [CrossRef]
- Peric, M.; Neupane, D.; Stinson, B.; Locke, E.; Kharkar, S.; Passarelli, N.; Sultan, M.; Shih, G.; Murthy, S.; Bailey, W.; et al. Phosphorous Requirements in a Post Denitrification MBBR at a Combined Limit of Technology Nitrogen and Phosphorous Plant. Proc. Water Environ. Fed. 2009, 2009, 237–251. [Google Scholar] [CrossRef]
- Welander, U.; Mattiasson, B. Denitrification at low temperatures using a suspended carrier biofilm process. Water Res. 2003, 37, 2394–2398. [Google Scholar] [CrossRef]
- Duan, L.; Jiang, W.; Song, Y.; Xia, S.; Hermanowicz, S. The characteristics of extracellular polymeric substances and soluble microbial products in moving bed biofilm reactor-membrane bioreactor. Bioresour. Technol. 2013, 148, 436–442. [Google Scholar] [CrossRef]
- Lydmark, P.; Almstrand, R.; Samuelsson, K.; Mattsson, A.; Srensson, F.; Lindgren, P.; Hermansson, M. Effects of environmental conditions on the nitrifying population dynamics in a pilot wastewater treatment plant. Environ. Microbiol. 2007, 9, 2220–2233. [Google Scholar] [CrossRef]
- Chu, L.; Wang, J. Denitrification of groundwater using PHBV blends in packed bed reactors and the microbial diversity. Chemosphere 2016, 155, 463–470. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.M.; Shao, F.; Ye, L. 454 pyrosequencing reveals bacterial diversity of activated sludge from 14 sewage treatment plants. ISME J. 2012, 6, 1137–1147. [Google Scholar] [CrossRef] [PubMed]
- Karanasios, K.A.; Vasiliadou, I.A.; Pavlou, S.; Vayenas, D. Hydrogenotrophic denitrification of potable water: A review. J. Hazard. Mater. 2010, 180, 20–37. [Google Scholar] [CrossRef] [PubMed]
- Tang, B.; Yu, C.; Bin, L.; Zhao, Y.; Feng, X.; Huang, S.; Fu, F.; Ding, J.; Chen, C.; Li, P.; et al. Essential factors of an integrated moving bed biofilm reactor–membrane bioreactor: Adhesion characteristics and microbial community of the biofilm. Bioresour. Technol. 2016, 211, 574–583. [Google Scholar] [CrossRef] [PubMed]
- Biswas, K.; Taylor, M.W.; Turner, S.J. Successional development of biofilms in moving bed biofilm reactor (MBBR) systems treating municipal wastewater. Appl. Microbiol. Biotechnol. 2014, 98, 1429–1440. [Google Scholar] [CrossRef]
- Wang, Q.; Feng, C.; Zhao, Y.; Hao, C. Denitrifification of nitrate contaminated groundwater with a fifiber-based biofifilm reactor. Bioresour. Technol. 2009, 100, 2223–2227. [Google Scholar] [CrossRef]
- Bramucci, M.G.; Nagarajan, V. Industrial wastewater bioreactors: Sources of novel microorganisms for biotechnology. Trends Biotechnol. 2000, 18, 501–505. [Google Scholar] [CrossRef]
- Langille, M.G.I.; Zaneveld, J.; Caporaso, J.G.; McDonald, D.; Knights, D.; Reyes, J.; Clemente, J.; Burkepile, D.; Vega Thurber, R.; Knight, R.; et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nat. Biotechnol. 2013, 31, 814–821. [Google Scholar] [CrossRef]
- Shen, Z.; Zhou, Y.; Hu, J.; Wang, J. Denitrification performance and microbial diversity in a packed-bed bioreactor using biodegradable polymer as carbon source and biofilm support. J. Hazard. Mater. 2013, 250, 431–438. [Google Scholar] [CrossRef]
- Xu, Z.; Dai, X.; Chai, X. Effect of different carbon sources on denitrification performance, microbial community structure and denitrification genes. Sci. Total Environ. 2018, 634, 195–204. [Google Scholar] [CrossRef]
- Ye, L.; Shao, M.F.; Zhang, T.; Tong, A.; Lok, S. Analysis of the bacterial community in a laboratory-scale nitrification reactor and a wastewater treatment plant by 454-pyrosequencing. Water Res. 2011, 45, 4390–4398. [Google Scholar] [CrossRef] [PubMed]
Reactor | Configurations (mm) | Density (g/cm3) | Specific Surface Area (m2/m3) | Porosity (%) | Number of Pores |
---|---|---|---|---|---|
A | Φ25 × 12 | 0.96–0.98 | >900 | >85% | 40 |
B | Φ25 × 4 | 0.96–0.98 | >500 | >90% | 19 |
C | Φ15 × 15 | 0.96–0.98 | >1200 | >85% | 64 |
D | Φ10 × 7 | 0.96–0.98 | >1000 | >85% | 5 |
Operation Time (d) | C/N | Salinity (‰) | TN (mg/L) | NH4+–N (mg/L) | NO3-–N (mg/L) | NO2-–N (mg/L) |
---|---|---|---|---|---|---|
1~227days | 6.6 | 0.5 ± 0.2 | 22.3 ± 6.4 | 2.2 ± 0.6 | 16.7 ± 5.9 | 3.8 ± 1.7 |
Gene | Primer | Sequence(5′-3′) | Reference |
---|---|---|---|
16s rRNA | 16s-f | ATGGCTGTCGTCAGCT | [40] |
16S-R | ACGGGGCGGTGTGTAC | ||
16S Archaea | 519F | CAGCMGCCGCGGTAA | [37] |
Arch915R | GTGCTCCCCCGCCAATTCCT | ||
narG | narG-F | TCGCCSATYCCGGCSATGTC | [40] |
narG-R | GAGTTGTACCAGTCRGCSGAYTCSG | ||
nirS | cd3AF | GTSAACGTSAAGGARACSGG | [41] |
R3cd | GASTTCGGRTGSGTCTTGA | ||
nirK | nirK1F | GGMATGGTKCCSTGGCA | [42] |
nirK5R | GCCTCGATCAGRTTRTGG |
Unit (copies/g-SS) | A (Φ25 × 12) | B (Φ25 × 4) | C (Φ15×15) | D (Φ10 × 7) |
---|---|---|---|---|
16S bacteria | 3.51 × 1010 | 1.25 × 1010 | 9.34 × 1010 | 1.6 × 1010 |
16S archaea | 6.10 × 1010 | 2.05 × 1010 | 1.45 × 1011 | 9.44 × 109 |
nirK | 2.06 × 105 | 2.37 × 106 | 3.70 × 105 | 2.24 × 105 |
nirS | 1.40 × 1010 | 2.98 × 109 | 5.53 × 1010 | 9.75 × 109 |
narG | 2.03 × 108 | 4.47 × 108 | 5.21 × 108 | 1.25 × 108 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, T.; Wu, T.; Wang, H.; Dong, W.; Zhao, Y.; Chu, Z.; Yan, G.; Chang, Y. Comparative Study of Denitrifying-MBBRs with Different Polyethylene Carriers for Advanced Nitrogen Removal of Real Reverse Osmosis Concentrate. Int. J. Environ. Res. Public Health 2020, 17, 2667. https://doi.org/10.3390/ijerph17082667
Wang T, Wu T, Wang H, Dong W, Zhao Y, Chu Z, Yan G, Chang Y. Comparative Study of Denitrifying-MBBRs with Different Polyethylene Carriers for Advanced Nitrogen Removal of Real Reverse Osmosis Concentrate. International Journal of Environmental Research and Public Health. 2020; 17(8):2667. https://doi.org/10.3390/ijerph17082667
Chicago/Turabian StyleWang, Tong, Tong Wu, Haiyan Wang, Weiyang Dong, Yaqian Zhao, Zhaosheng Chu, Guokai Yan, and Yang Chang. 2020. "Comparative Study of Denitrifying-MBBRs with Different Polyethylene Carriers for Advanced Nitrogen Removal of Real Reverse Osmosis Concentrate" International Journal of Environmental Research and Public Health 17, no. 8: 2667. https://doi.org/10.3390/ijerph17082667