Putrescine Promotes Betulin Accumulation in Suspension Cell Cultures of Betula platyphylla by Regulating NO and NH4+ Production
Abstract
:1. Introduction
2. Results
2.1. Put Enhanced Betulin Production
2.2. Put Induced NO Production
2.3. NO-Mediated Put Induced Betulin Accumulation
2.4. Put Induced NH4+ Production
2.5. NH4+ Induced NO and Betulin Production
3. Discussion
4. Materials and Methods
4.1. Plant Cell Culture
4.2. Chemical Reagents and Treatment
4.3. Betulin Estimation
4.4. Detection of NO
4.5. Detection of NH4+
4.6. Determination of Enzyme Activities
4.7. RNA Isolation and Real-Time Quantitative RT-PCR
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Abbreviations
Put | putrescine |
LUS | lupeol synthase |
NO | nitric oxide |
NR | nitrate reductase |
NOS | NO synthase |
cPTIO | 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline- 1-oxyl-3-oxide |
NaN3 | sodium azide |
L-NAME | NG-nitro-L-Arg methyl ester |
GOGAT | glutamine-2-oxoglutarate aminotransferase |
GDH | glutamate dehydrogenase |
NS | (NH4)2SO4 |
NCL | NH4Cl |
References
- Hussaina, S.S.; Ali, M.; Ahmad, M.; Siddique, K.H.M. Polyamines: Natural and engineered abiotic and biotic stress tolerance in plants. Biotechnol. Adv. 2011, 29, 300–311. [Google Scholar] [CrossRef] [PubMed]
- Silveira, V.; Santa-Catarina, C.; Tun, N.N.; Scherer, G.F.E.; Handro, W.; Guerra, M.P.; Floh, E.I.S. Polyamine effects on the endogenous polyamine contents, nitric oxide release, growth and differentiation of embryogenic suspension cultures of Araucaria angustifolia (Bert.) O. Ktze. Plant Sci. 2006, 171, 91–98. [Google Scholar] [CrossRef]
- Handa, A.K.; Mattoo, A.K. Differential and functional interactions emphasize the multiple roles of polyamines in plants. Plant Physiol. Bioch. 2010, 48, 540–546. [Google Scholar] [CrossRef] [PubMed]
- Pál, M.; Ivanovska, B.; Oláh, T.; Tajti, J.; Hamow, K.Á.; Szalai, G.; Khalil, R.; Vanková, R.; Dobrev, P.; Misheva, S.P.; et al. Role of polyamines in plant growth regulation of Rht wheat mutants. Plant Physiol. Bioch. 2019, 137, 189–202. [Google Scholar] [CrossRef] [PubMed]
- Pál, M.; Szalai, G.; Janda, T. Speculation: Polyamines are important in abiotic stress signaling. Plant Sci. 2015, 237, 16–23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, J.Q.; Shu, S.; Li, C.C.; Sun, J.; Guo, S.R. Spermidine-mediated hydrogen peroxide signaling enhances the antioxidant capacity of salt-stressed cucumber roots. Plant Physiol. Bioch. 2018, 128, 152–162. [Google Scholar] [CrossRef]
- Benkő, P.; Jee, S.; Kaszler, N.; Fehér, A.; Gémes, K. Polyamines treatment during pollen germination and pollen tube elongation in tobacco modulate reactive oxygen species and nitric oxide homeostasis. J. Plant Physiol. 2020, 244, 153085. [Google Scholar] [CrossRef]
- Domingos, P.; Prado, A.M.; Wong, A.; Gehring, C.; Feijo, J.A. Nitric oxide: A multitasked signaling gas in plants. Mol. Plant 2015, 8, 506–520. [Google Scholar] [CrossRef] [Green Version]
- Castello, F.D.; Nejamkin, A.; Cassia, R.; Correa-Aragunde, N.; Fernández, B.; Foresi, N.; Lombardo, C.; Ramirez, L.; Lamattina, L. The era of nitric oxide in plant biology: Twenty years tying up loose ends. Nitric Oxide 2019, 85, 17–27. [Google Scholar] [CrossRef]
- Santolini, J.; André, F.; Jeandroz, S.; Wendehenne, D. Nitric oxide synthase in plants: Where do we stand? Nitric Oxide 2017, 63, 30–38. [Google Scholar] [CrossRef]
- Cao, X.C.; Zhu, C.Q.; Zhong, C.; Zhang, J.H.; Wu, L.H.; Jin, Q.Y.; Ma, Q.X. Nitric oxide synthase-mediated early nitric oxide burst alleviates water stress-induced oxidative damage in ammonium-supplied rice roots. BMC Plant Biol. 2019, 19, 108. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, K.; Jiang, Y.; Yu, Z.Y.; Huang, Y.T.; Zhan, Y.G.; Fan, G.Z. H2S-induced NO/SNO positively promotes betulin production in Betula Platyphylla. Ind. Crops Prod. 2019, 140, 111608. [Google Scholar] [CrossRef]
- Krasuska, U.; Ciacka, K.; Gniazdowska, A. Nitric oxide-polyamines cross-talk during dormancy release and germination of apple embryos. Nitric Oxide 2017, 68, 38–50. [Google Scholar] [CrossRef] [PubMed]
- Chamizo-Ampudia, A.; Sanz-Luque, E.; Llamas, A.; Galvan, A.; Fernandez, E. Nitrate reductase regulates plant nitric oxide homeostasis. Trends Plant Sci. 2017, 22, 163–174. [Google Scholar] [CrossRef] [PubMed]
- Chandran, H.; Meena, M.; Barupal, T.; Sharma, K. Plant tissue culture as a perpetual source for production of industrially important bioactive compounds. Biotech. Rep. 2020, 26, e00450. [Google Scholar] [CrossRef] [PubMed]
- Thakur, M.; Bhattacharya, S.; Khosla, P.K.; Puri, S. Improving production of plant secondary metabolites through biotic and abiotic elicitation. J. Appl. Res. Med. Aroma. 2019, 12, 1–12. [Google Scholar] [CrossRef]
- Zhao, F.Q.; Mai, Q.Q.; Ma, J.H.; Xu, M.; Wang, X.; Cui, T.T.; Qiu, F.; Han, G. Triterpenoids from Inonotus obliquus and their antitumor activities. Fitoterapia 2015, 101, 34–40. [Google Scholar] [CrossRef]
- Fan, G.Z.; Liu, Y.T.; Wang, X.D.; Zhan, Y.G. Cross-talk of polyamines and nitric oxide in endophytic fungus-induced betulin production in Betula platyphylla plantlets. Trees-Struct. Funct. 2014, 28, 635–641. [Google Scholar] [CrossRef]
- Fan, G.Z.; Zhai, Q.L.; Zhan, Y.G. Gene expression of lupeol synthase and biosynthesis of nitric oxide in cell suspension cultures of Betula platyphylla in response to a Phomopsis elicitor. Plant Mol. Biol. Rep. 2013, 31, 296–302. [Google Scholar] [CrossRef]
- Navarro-León, E.; Barrameda-Medina, Y.; Lentini, M.; Esposito, S. Comparative study of Zn deficiency in L. sativa and B. oleracea plants NH4+ assimilation and nitrogen derived protective compounds. Plant Sci. 2016, 248, 8–16. [Google Scholar] [CrossRef]
- Yang, B.N.; Wu, J.Z.; Gao, F.M.; Wang, J.; Su, G.X. Polyamine-induced nitric oxide generation and its potential requirement for peroxide in suspension cells of soybean cotyledon node callus. Plant Physiol. Bioch. 2014, 79, 41–47. [Google Scholar] [CrossRef] [PubMed]
- Li, X.C.; Zhang, Y.G.; Wang, X.D.; Liu, Y.T.; Li, D.; Rong, L.Z.; Fan, G.Z. Effect of polyamine on growth of Betula platyphylla suspension cells and triterpenoid accumulation. Chin. Tradit. Herbal Drugs 2013, 44, 463–467. [Google Scholar]
- Zhu, X.F.; Dong, X.Y.; Wu, Q.; Shen, R.F. Ammonium regulates Fe deficiency responses by enhancing nitric oxide signaling in Arabidopsis thaliana. Planta 2019, 250, 1089–1102. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.Y.; Burgos, A.; Zhang, Q.F.; Tang, D.D.; Shi, Y.Z.; Ma, L.F.; Yi, X.Y.; Ruan, J.Y. Analyses of transcriptome profiles and selected metabolites unravel the metabolic response to NH4+ and NO3− as signaling molecules in tea plant (Camellia sinensis L.). Sci. Hortic. 2017, 218, 293–303. [Google Scholar] [CrossRef]
- Radušienė, J.; Marksa, M.; Ivanauskas, L.; Jakštas, V.; Çalişkan, Ö.; Kurt, D.; Odabaş, M.S.; Çirak, C. Effect of nitrogen on herb production, secondary metabolites and antioxidant activities of Hypericum pruinatum under nitrogen application. Ind. Crops. Prod. 2019, 139, 111519. [Google Scholar] [CrossRef]
- Awasthi, V.; Gautam, I.K.; Sengar, R.S.; Garg, S.K. Influence of putrescine on enzymes of ammonium assimilation in maize seedling. Am. J. Plant Sci. 2013, 4, 297–301. [Google Scholar] [CrossRef] [Green Version]
- Zhao, J.; Davis, L.C.; Verpoorte, R. Elicitor signal transduction leading to production of plant secondary metabolites. Biotechnol. Adv. 2005, 23, 283–333. [Google Scholar] [CrossRef]
- Li, Y.Q.; Kong, D.X.; Fu, Y.; Sussman, M.R.; Wu, H. The effect of developmental and environmental factors on secondary metabolites in medicinal plants. Plant Physiol. Bioch. 2020, 148, 80–89. [Google Scholar] [CrossRef]
- Nagata, T.; Takebe, I. Cell Wall Regeneration and Cell Division in Isolated Tobacco Mesophyll Protoplasts. Planta 1970, 92, 301–308. [Google Scholar] [CrossRef]
- Hong, W.Y.; Yang, T.W.; Wang, C.M.; Syu, J.H.; Lin, Y.C.; Meng, H.F.; Tsai, M.J.; Cheng, H.; Zan, H.W.; Horng, S.F. Conversion of absorption to fluorescence probe in solid-state sensor for nitric oxide and nitrite. Org. Electron. 2013, 14, 1136–1141. [Google Scholar] [CrossRef]
- Zhao, M.G.; Chen, L.; Zhang, L.L.; Zhang, W.H. Nitric reductase-dependent nitric oxide production is involved in cold acclimation and freezing tolerance in Arabidopsis. Plant Physiol. 2009, 151, 755–767. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Zeng, F.S.; Nan, N.; Zhan, Y.G. Extraction of total RNA from mature leaves rich in polysaccharides and secondary metabolites of Betula platyphylla Suk. Plant Physiol. Commun. 2007, 43, 913–916. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆Ct method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Accession NO. | Primer Sequences (5′→3′) | Tm (°C) | Fragment Size (bp) |
---|---|---|---|---|
LUS | AB055511 | Forward: TTGAAGACGTGCAAGAACCTG | 58 | 195 |
Reverse: CATCAATGAGGGATAACAAGG | ||||
TU | FG067376 | Forward: TCAACCGCCTTGTCTCTCAGG | 54 | 190 |
Reverse:TGGCTCGAATGCACTGTTGG | ||||
UbQ | FG065618 | Forward: GATTGAGGGGAGGGATGCTG | 53 | 202 |
Reverse: GGAGGACAAGGTGGAGGGTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fan, G.; Zhang, T.; Liu, Y.; Zhan, Y.; Zheng, B. Putrescine Promotes Betulin Accumulation in Suspension Cell Cultures of Betula platyphylla by Regulating NO and NH4+ Production. Forests 2020, 11, 1336. https://doi.org/10.3390/f11121336
Fan G, Zhang T, Liu Y, Zhan Y, Zheng B. Putrescine Promotes Betulin Accumulation in Suspension Cell Cultures of Betula platyphylla by Regulating NO and NH4+ Production. Forests. 2020; 11(12):1336. https://doi.org/10.3390/f11121336
Chicago/Turabian StyleFan, Guizhi, Tingting Zhang, Yingtian Liu, Yaguang Zhan, and Baojiang Zheng. 2020. "Putrescine Promotes Betulin Accumulation in Suspension Cell Cultures of Betula platyphylla by Regulating NO and NH4+ Production" Forests 11, no. 12: 1336. https://doi.org/10.3390/f11121336