Screen of Pinus massoniana for Resistance to Pinewood Nematode: In Vitro Propagation and Evaluation of Regenerated Microshoots
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials and PWN
2.2. Seed Disinfection and In Vitro Germination
2.3. Axillary Bud Formation and Elongation
2.4. Shoot Multiplication
2.5. DNA Isolation and Quantification
2.6. SSR Amplification and Fragment Analysis
2.7. Acquisition of Sterilized Nematodes
2.8. In Vitro Tolerance Assay with Nematodes
2.9. Statistical Analysis
3. Results
3.1. Formation of Axillary Buds and Elongation of Shoots
3.2. Shoot Proliferation
3.3. Genetic Stability in Regenerated Shoots
3.4. Acquisition of Sterilized Nematodes
3.5. PWN Tolerance of Regenerated Shoots
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Maleki, S.S.; Mohammadi, K.; Ji, K.S. Study on factors influencing transformation efficiency in Pinus massoniana using Agrobacterium tumefaciens. PCTOC 2018, 133, 437–444. [Google Scholar] [CrossRef]
- Wang, Y.; Yao, R.L. Optimization of rhizogenesis for in vitro shoot culture of Pinus massoniana Lamb. J. For. Res. 2021, 32, 203–209. [Google Scholar] [CrossRef]
- Mamiya, Y.; Kiyohara, T. Description of Bursaphelenchus lignicolus n. sp. (Nematoda: Aphelenchoididae) from pine wood and histopathology of nematode-infested trees. Nematologica 1972, 18, 120–124. [Google Scholar] [CrossRef]
- Tamura, H. Pathogenicity of aseptic Bursaphelenchus xylophilus and associated bacteria to pine seedlings. Jpn. Nematol. 1983, 13, 1–5. [Google Scholar]
- Yang, B.J. Advance in research of pathogenetic mechanism of pine wood nematode (in Chinese with English abstract). For. Pest. Dis. 2002, 1, 27–31. [Google Scholar]
- Faria, J.M.S.; Sena, I.; Silva, I.V.; Ribeiro, B.; Barbosa, P.; Ascensao, L.; Bennett, R.N.; Mota, M.; Figueiredo, A.C. In vitro co-cultures of Pinus pinaster with Bursaphelenchus xylophilus: A biotech-nological approach to study pine wilt disease. Planta 2015, 241, 1325–1336. [Google Scholar] [CrossRef]
- Proença, D.N.; Grass, G.; Morais, P.V. Understanding pine wilt disease: Roles of the pine endophytic bacteria and of the bacteria carried by the disease-causing pinewood nematode. MicrobiologyOpen 2016, 6, e00415. [Google Scholar] [CrossRef]
- Zhao, B.G.; Wang, H.L.; Han, S.F.; Han, Z.M. Distribution and pathogenicity of bacteria species carried by Bursaphelenchus xylophilus in China. Nematology 2003, 5, 899–906. [Google Scholar] [CrossRef]
- Zhao, B.; Lin, F. Mutualistic symbiosis between Bursaphelenchus xylophilus and bacteria of the genus Pseudomonas. For. Path. 2005, 35, 39–345. [Google Scholar] [CrossRef]
- Nascimento, F.X.; Hasegawa, K.; Mota, M.; Vicente, C.S.L. Bacterial role in pine wilt disease development review and future perspectives. Env. Microbiol. Rep. 2015, 7, 51–63. [Google Scholar] [CrossRef]
- Futai, K. Pine Wilt in Japan: From First Incidence to the Present. In Pine Wilt Disease; Zhao, B.G., Futai, K., Sutherland, J.R., Takeuchi, Y., Eds.; Springer: Tokyo, Japan, 2008; pp. 5–12. [Google Scholar]
- Zhang, F.J.; Yasuhiro, M.; Yuji, T.; Ryuichiro, K. A rapid in vitro bioassay system for testing resistance factors of pine trees to Bursaphelenchus xylophilus. Nematology 2013, 15, 665–670. [Google Scholar]
- Ceng, H.R.; Lin, M.S.; Ni, W.Q.; Fang, Z.D. First report of pine wilt disease from Pinus thunbergii Parl in Nanjing. For. Pest Dis. 1983, 4, 1–5. [Google Scholar]
- Zhao, L.; Mota, M.; Vieira, P.; Butcher, R.A.; Sun, J. Interspecific communication between pinewood nematode, its insect vector, and associated microbes. Trends Parasitol. 2014, 30, 299–308. [Google Scholar] [CrossRef] [PubMed]
- Yoshimura, A.; Kawasaki, K.; Takasu, F.; Togashi, K.; Futai, K.; Shigesada, N. Modeling the spread of pine wilt disease caused by nematodes with pine sawyers as vector. Ecology 1999, 80, 1691–1702. [Google Scholar] [CrossRef]
- Mota, M.M.; Braasch, H.; Bravo, M.A.; Penas, A.C.; Burgermeister, W.; Metge, K.; Sousa, E. First report of Bursaphelenchus xylophilus in Portugal and in Europe. Nematology 1999, 1, 727–734. [Google Scholar] [CrossRef]
- Abelleira, A.; Picoaga, A.; Mansilla, J.P.; Aguin, O. Detection of Bursaphelenchus xylophilus, causal agent of pine wilt disease on Pinus pinaster in Northwestern Spain. Plant Dis. 2011, 95, 776. [Google Scholar] [CrossRef]
- Li, H.; Zhou, G.Y.; Liu, J.A.; Zhang, H.Y. Study on pine wilt disease and its control situation. Appl. Mech. Mater. 2011, 55–57, 567–572. [Google Scholar] [CrossRef]
- Li, S.; Sun, H.; Zhou, Y.T.; Li, X.J.; Yu, Z.J.; Dong, Z.H. Occurrence of major forestry pests in China in 2021 and forecast of their occurrence trend in 2022. For. Pest Dis. 2022, 41, 44–47. [Google Scholar]
- Gao, R.H.; Shi, J.; Huang, R.F.; Wang, Z.; Luo, Y.Q. Effects of pine wilt disease invasion on soil properties and masson pine forest communities in the Three Gorges reservoir region, China. Ecol. Evol. 2015, 5, 1702–1716. [Google Scholar] [CrossRef]
- Kurinobu, S. Current status of resistance breeding of Japanese pine species to pine wilt disease. For. Sci. Technol. 2008, 4, 51–57. [Google Scholar] [CrossRef]
- Xu, L.Y.; Zhang, J.; Gao, J.B.; Hao, Y.P.; Chen, X.L.; Jiang, C.W. Research progress on resistance breeding to pinewood nematodiasis in Anhui Province. Anhui For. Sci. Technol. 2013, 39, 8–10. [Google Scholar]
- Wang, Y.; Yao, R.L. Establishment of an effecctive protocol for cultivation of tissue cultured seedlings in Pinus massoniana superior provenance. J. Beijing For. Univ. 2020, 42, 43–51. [Google Scholar]
- Wang, Y.; Yao, R.L. Plantlet regeneration of adult Pinus massoniana Lamb. trees using explants collected in March and thidiazuron in culture medium. J. For. Res. 2017, 28, 1169–1175. [Google Scholar] [CrossRef]
- Cortizo, M.; Diego, N.; Moncalea’n, P.; Orda´s, R.J. Micropropagation of adult Stone Pine (Pinus pinea L.). Trees 2009, 23, 835–842. [Google Scholar] [CrossRef]
- De Diego, N.; Montalbán, I.A.; Moncalebá, P. Improved micropropagation protocol for maritime pine using zygotic embryos. Scand. J. For. Res. 2011, 26, 202–211. [Google Scholar] [CrossRef]
- Tang, W.; Whetten, R.; Sederoff, R. Genotypic control of high-frequency adventitious shoot regeneration via somatic organogenesis in loblolly pine. Plant Sci. 2001, 161, 267–272. [Google Scholar] [CrossRef]
- Humánez, A.; Blasco, M.; Brisa, C.; Segura, J.; Arrillaga, I. Thidiazuron enhances axillary and adventitious shoot proliferation in juvenile explants of Mediterranean provenances of maritime pine Pinus pinaster. Plant 2011, 47, 569–577. [Google Scholar] [CrossRef]
- Wu, R.J. Embryo Tissue Culture of Pinus massoniana. J. Fujian Coll. For. 1993, 13, 98–100. [Google Scholar]
- Huang, J.Q.; Wei, Z.M.; Xu, Z.H. Somatic embryogenesis and plantlet regeneration from callus of mature zygotic embryos of masson pine. Chin. Bull. Bot. 1995, 37, 289–294. [Google Scholar]
- Zhang, Y.; Wei, Z.M.; Xi, M.L.; Shi, J.S. Direct organogenesis and plantlet regeneration from mature zygotic embryos of masson pine (Pinus massoniana L.). PCTOC 2006, 84, 119–123. [Google Scholar] [CrossRef]
- Jin, X.C.; Li, Z.H.; Yang, M.H.; Zhang, D.L.; Ding, G.J. Embryonic callus induction of immature embryo of Pinus massoniana. J. Cent. South Univ. For. Technol. 2010, 30, 80–84. [Google Scholar]
- Zhu, L.H.; Wu, X.Q.; Qu, H.Y.; Ji, J.; Ye, J.R. Micropropagation of Pinus massoniana and mycorrhiza formationin vitro. PCTOC 2010, 102, 121–128. [Google Scholar] [CrossRef]
- Yao, R.L.; Wang, Y. An effective protocol for regenerating mature Pinus massoniana L. trees by tissue culture. Res. J. Biotechnol. 2006, 11, 75–80. [Google Scholar]
- Wang, Y.; Yao, R.L. Increased endogenous gibberellin level inhibits root growth of Pinus massoniana Lamb. plantlets during long-term subculture. Vitr. Cell. Dev. Biol. Plant 2020, 56, 470–479. [Google Scholar] [CrossRef]
- Goto, S.; Thakur, R.C.; Ishii, K. Determination of genetic stability in long-term micropropagated shoots of Pinus thunbergii Parl. using RAPD markers. Plant Cell Rep. 1998, 18, 193–197. [Google Scholar] [CrossRef] [PubMed]
- Rahman, M.H.; Rajora, O.P. Microsatelite DNA somaclonal variation in micropropagated trembling aspen (Populus tremuloides). Plant Cell Rep. 2001, 20, 531–536. [Google Scholar] [CrossRef]
- El-Dougdoug, K.A.; El-Harthi, H.M.S.; Korkar, H.M.; Taha, R.M. Detection of somaclonal variations in banana tissue culture using isozyme and DNA fingerprint analysis. J. Appl. Sci. Res. 2007, 3, 622–627. [Google Scholar]
- Cuesta, C.; Orda´s, R.J.; Ferna´ndez, B.; Rodrı´guez, A. Clonal micropropagation of six selected half-sibling families of Pinus pinea and somaclonal variation analysis. PCTOC 2008, 95, 125–130. [Google Scholar] [CrossRef]
- Bai, T.D.; Xu, L.A.; Xu, M.; Wang, Z.R. Characterization of masson pine (Pinus massoniana Lamb.) microsatellite DNA by 454 genome shotgun sequencing. Tree Genet. Genomes 2014, 10, 429–437. [Google Scholar] [CrossRef]
- Marum, L.; Rocheta, M.; Maroco, J.; Oliveira, M.M.; Miguel, C. Analysis of genetic stability at SSR loci during somatic embryogenesis in maritime pine (Pinus pinaster). Plant Cell Rep. 2009, 28, 673–682. [Google Scholar] [CrossRef]
- Yang, F.; Xia, X.R.; Ke, X.; Ye, J.; Zhu, L. Somatic embryogenesis in slash pine (Pinus elliottii Engelm): Improving initiation of embryogenic tissues and maturation of somatic embryos. PCTOC 2020, 143, 159–171. [Google Scholar] [CrossRef]
- Xia, X.R.; Yang, F.; Ke, X.; Chen, Y.M.; Ye, J.R.; Zhu, L.H. Somatic embryogenesis of masson pine (Pinus massoniana): Initiation, maturation and genetic stability analysis at SSR loci. PCTOC 2021, 145, 667–677. [Google Scholar] [CrossRef]
- Fenning, T.M. The use of tissue culture and in-vitro approaches for the study of tree diseases. PCTOC 2019, 136, 415–430. [Google Scholar] [CrossRef]
- Terho, M.; Pappinen, A.; von Weissenberg, K. Growth reactions of a Gremmeniella abietina isolate and Scots pine embryogenic tissue cultures differ in a host-parasite in-vitro system. For. Pathol. 2000, 30, 285–295. [Google Scholar] [CrossRef]
- Nagy, N.E.; Franceschi, V.R.; Kvaalen, H.; Solheim, H. Callus cultures and bark from Norway spruce clones show similar cellular features and relative resistance to fungal pathogens. Trees 2005, 19, 695–703. [Google Scholar] [CrossRef]
- Phillips, M.A.; Walter, M.H.; Ralph, S.; Dabrowska, P.; Luck, K.; Urós, E.M.; Boland, W.; Strack, D.; Rodríguez-Concepción, M.; Bohlmann, J.; et al. Functional identification and differential expression of 1-deoxy-D-xylulose 5-phosphate synthase in induced terpenoid resin formation of Norway spruce (Picea abies). Plant Mol. Biol. 2007, 65, 243–257. [Google Scholar] [CrossRef]
- Zhu, L.H.; Ye, J.; Negi, S.; Xu, X.L.; Wang, Z.L. Pathogenicity of aseptic Bursaphelenchus xylophilus. PLoS ONE 2012, 7, e38095. [Google Scholar] [CrossRef]
- Zhu, L.H.; Chu, X.F.; Sun, T.Y.; Ye, J.R.; Wu, X.Q. Micropropagation of Pinus densiflora and the evaluation of nematode resistance of regenerated microshoots in vitro. J. For. Res. 2019, 30, 519–528. [Google Scholar] [CrossRef]
- Gupta, P.K.; Durzan, D.J. Shoot multiplication from mature trees of Douglas fir (Pseudotsuga menziesii) and sugar pine (Pinus lambertiana). Plant Cell Rep. 1985, 4, 177–179. [Google Scholar] [CrossRef]
- Ni, Z.X.; Bai, T.D.; Cai, H.; Chen, S.F.; Xu, L.A. The transferability of Pinus massoniana SSR in other Pinus species. Mol. Plant Breed 2015, 13, 2811–2817. [Google Scholar]
- Kaul, K. Plant regeneration from eotyledon-hypocotyl explants of Pinus strobus L. Plant Cell Rep. 1987, 6, 5–7. [Google Scholar] [CrossRef]
- Tang, W.; Guo, Z.C. In vitro propagation of loblolly pine via direct somatic organogenesis from mature cotyledons and hypocotyls. Plant Growth Regul. 2001, 33, 25–31. [Google Scholar] [CrossRef]
- Tereso, S.; Goncalves, S.; Marum, L.; Oliveira, M.; Maroco, J.; Miguel, C. Improved axillary and adventitious bud regeneration from Portuguese genotypes of Pinus pinaster Ait. Propag. Ornam. Plants 2006, 6, 24–33. [Google Scholar]
- Liang, Y.; Bai, X.; Xu, X.; Xu, H.G.; Wang, J.; Pan, P. Direct in vitro organogenesis from sprouted seeds of a highly economical and ecological valued tree, Korean pine. PCTOC 2022, 148, 197–207. [Google Scholar] [CrossRef]
- Cheng, X.F.; Hua, X.M.; Li, W.D. Micropropagation and Mycorrhizae Formation of Pinus massoniana Lamb. In vitro. For. Res. 1995, 8, 241–246. [Google Scholar]
- Yao, R.L.; Wang, Y. An advanced protocol for the establishment of plantlets originating from somatic embryos in Pinus massoniana. 3 Biotech 2020, 10, 394. [Google Scholar] [CrossRef]
- Hu, C.; Liang, S.T.; Ye, J.R.; Zhu, L.H.; Tan, J.J. Plantlet regeneration of pine wilt disease-resistant Pinus massoniana in vitro. J. For. Eng. 2013, 27, 94–97. [Google Scholar]
- Thomas, T.D. The role of activated charcoal in plant tissue culture. Biotechnol. Adv. 2008, 26, 618–631. [Google Scholar] [CrossRef] [PubMed]
- Berlyni, G.P.; Beck, R.C.; Renfroe, M.H. Tissue culture and the propagation and genetic improvement of conifers: Problems and possibilities. Tree Physiol. 1986, 1, 227–240. [Google Scholar] [CrossRef] [PubMed]
- Lakshmanan, V.; Venkataramareddy, S.R.; Neelwarne, B. Molecular analysis of genetic stability in long-term micropropagated shoots of banana using RAPD and ISSR markers. Electron. J. Biotech. 2007, 10, 106–113. [Google Scholar] [CrossRef]
- Burg, K.; Helmersson, A.; Bozhkov, P.; von Arnold, S. Developmental and genetic variation in nuclear microsatellite stability during somatic embryogenesis in pine. J. Exp. Bot. 2007, 58, 687–698. [Google Scholar] [CrossRef] [PubMed]
- Hazubska-Przybył, T.; Dering, M. Somaclonal variation during Picea abies and P. omorika somatic embryogenesis and cryopreservation. Acta Biol. Crac. Ser. Bot. 2017, 59, 93–103. [Google Scholar] [CrossRef]
- Krutovsky, K.V.; Tretyakova, I.N.; Oreshkova, N.V.; Pak, M.E.; Kvitko, O.V.; Vaganov, E.A. Somaclonal variation of haploid in vitro tissue culture obtained from Siberian larch (Larix sibirica Ledeb.) megagametophytes for whole genome de novo sequencing. Vitr. Cell. Dev. Biol. Plant 2014, 50, 655–664. [Google Scholar] [CrossRef]
- Tang, W. In vitro regeneration of loblolly pine and random amplified polymorphic DNA analyses of regenerated plantlets. Plant Cell Rep. 2001, 20, 163–168. [Google Scholar] [CrossRef]
- Cheng, F.; Ye, J.R. Determination of resistance to brown-spot needle blight on culture seeding of slash pine. For. Pest Dis. 2018, 37, 1–23. [Google Scholar]
- Li, Q.Q.; Ye, J.R.; Zhu, L.H.; Wu, X.Q.; Chu, X.F. Resistance determination of wilt-resistant Pinus densiflora tissue culture seedling to Bursaphelenchus xylophilus. J. Northeast. For. Univ. 2013, 41, 45–47. [Google Scholar]
- Ragazzi, A.; Moricca, S.; Della, V.I. Growth of axenic cultures of Cronartium flaccidum on callus tissue from Pinus nigra var. Laricio and Pinus sylvestris. Eur. J. For. Path. 1995, 25, 31–37. [Google Scholar] [CrossRef]
- Qu, Y.J.; Meng, M.L.; Zhang, X.Y.; Chen, W.T.; Hu, J.; Ma, Z.W.; Chen, H. Indentification of potato resistance to blight caused by Fusarium oxysporum. Plant Protection 2015, 41, 149–153. [Google Scholar]
- Luo, S.L.; Chen, R.; ZhangSun, D.T. Screening test of resistance to antibiotics and PPT at different stages of tomato tissue culture. Nat. Sci. J. Hainan Univ. 2003, 21, 58–64. [Google Scholar]
- Han, Z.M.; Hong, Y.D.; Zhao, B.G. A Study on Pathogenicity of Bacteria Carried by Pine Wood Nematodes. J. Phytopathol. 2003, 151, 683–689. [Google Scholar] [CrossRef]
Locus | Primers (5′-3′) | Length (bp) | Annealing Temperature (°C) | Number of Cycles | Identification |
---|---|---|---|---|---|
P.Ma43 | F:GCAACCTCCATATTTCACTT | 234 | 51 | 26 | KC146075 |
R: CTTTCCAATCTTCCCTTACA | |||||
P.Ma51 | F: ACGCACGGATAAGATTGTG | 227 | 55 | 24 | KC146077 |
R: ATCAAGTTACCCTCATTTGGA | |||||
P.Ma65 | F: AAGGCACTCGATCTCCTC | 248 | 60 | 24 | KC146078 |
R: TGACCTGCTTCTACACCC | |||||
P.Ma77 | F: GACCGTACAACACTCACTTGA | 323 | 51 | 24 | KC146081 |
R: CCTCTTTCCCTTGTCCTG | |||||
P.Ma95 | F: CTACCGATGCGATAAGGG | 303 | 52 | 24 | KC146084 |
R: ACTCGTGACTGCGACAATAC | |||||
P.Ma96 | F: TGACCCAATAGACTCCCTC | 260 | 52 | 25 | KC146085 |
R:AGACCTATCTAAGCACAACCC |
Clone Code | Responsive Explants (%) | Average No. of Buds/Explant | Total Buds after 12 Months of Proliferation |
---|---|---|---|
8 | 66.7 | 3.7 ± 1.5 abc | 265 |
115 | 35.7 | 2.0 ± 1.0 cde | 98 |
202 | 57.1 | 3.3 ± 1.5 bcd | 162 |
207 | 72.1 | 5.3 ± 0.6 a | 826 |
220 | 30.0 | 1.7 ± 0.6 de | 72 |
222 | 41.7 | 3.7 ± 0.6 abc | 173 |
226 | 77.8 | 4.0 ± 1.0 ab | 294 |
227 | 38.5 | 1.0 ± 0.0 e | 45 |
253 | 60.8 | 4.3 ± 0.6 ab | 328 |
Clone | Individuals with Mutated Alleles | Loci | Original Alleles | Mutated Alleles |
---|---|---|---|---|
202 | A | P.Ma43 | 232/241 | 232/232 |
P.Ma51 | 215/224 | 215/239 | ||
P.Ma96 | 264/264 | 240/260 | ||
B | P.Ma51 | 215/224 | 215/239 | |
C | P.Ma51 | 215/224 | 224/239 | |
P.Ma65 | 244/244 | 244/251 | ||
D | P.Ma43 | 232/241 | 232/232 | |
207 | A | P.Ma96 | 273/273 | 271/271 |
222 | A | P.Ma51 | 215/224 | 224/224 |
P.Ma65 | 240/244 | 244/244 | ||
P.Ma95 | 288/288 | 288/292 | ||
253 | A | P.Ma51 | 215/224 | 215/239 |
Loci | ||||||
---|---|---|---|---|---|---|
P.Ma43 | P.Ma51 | P.Ma65 | P.Ma77 | P.Ma95 | P.Ma96 | |
No. analyzed shoots | 30 | 30 | 30 | 30 | 30 | 30 |
No. mutated shoots | 2 | 5 | 2 | 0 | 1 | 2 |
Variation frequency (%) | 6.7 | 16.7 | 6.7 | 0 | 3.3 | 6.7 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, J.-Y.; Zhu, Z.-H.; Chen, Y.-M.; Zhu, L.-H. Screen of Pinus massoniana for Resistance to Pinewood Nematode: In Vitro Propagation and Evaluation of Regenerated Microshoots. Forests 2023, 14, 1056. https://doi.org/10.3390/f14051056
Guo J-Y, Zhu Z-H, Chen Y-M, Zhu L-H. Screen of Pinus massoniana for Resistance to Pinewood Nematode: In Vitro Propagation and Evaluation of Regenerated Microshoots. Forests. 2023; 14(5):1056. https://doi.org/10.3390/f14051056
Chicago/Turabian StyleGuo, Jia-Yi, Zi-Hui Zhu, You-Mei Chen, and Li-Hua Zhu. 2023. "Screen of Pinus massoniana for Resistance to Pinewood Nematode: In Vitro Propagation and Evaluation of Regenerated Microshoots" Forests 14, no. 5: 1056. https://doi.org/10.3390/f14051056