Submit to this Journal Review for this Journal Propose a Special Issue

Article Menu

Open AccessArticle

Peer-Review Record

Function of the NAC1 Gene from Fraxinus mandshurica in Cold Resistance and Growth Promotion in Tobacco

Forests 2024, 15(8), 1405; https://doi.org/10.3390/f15081405 (registering DOI)

by Yang Cao^1,2,3,†, Liming He^1,2,3,†, Shengdian Lu^1,2,3, Yuling Wang^1,2,3, Chenxi Zhang^1,2,3 and Yaguang Zhan^1,2,3,*

Reviewer 1: Anonymous

Reviewer 2:

Sujit Shah

Reviewer 3:

Priyanka Adhikari

Forests 2024, 15(8), 1405; https://doi.org/10.3390/f15081405 (registering DOI)

Submission received: 20 May 2024 / Revised: 7 August 2024 / Accepted: 9 August 2024 / Published: 10 August 2024

(This article belongs to the Section Genetics and Molecular Biology)

Round 1

Reviewer 1 Report (Previous Reviewer 3)

Comments and Suggestions for Authors

The present study investigates the influence of overexpression of FmNAC1 from Fraxinus mandshurica on cold resistance and growth promotion in tobacco. The manuscript presents interesting data for the future development of improved varieties of F. mandshurica and other plants with increased cold tolerance. I'm pleased to see that the manuscript has been improved, but there are still some flaws that need fixing.

Sections 2.7 and 2.8. Please provide information about the number of experiments, and the number of plants per line in each experiment.

Line 145, 160. Aligned using DANMAN or ClustalW?

Figure 10. Nb stands for Nicotiana benthamiana. The article conducts experiments with Nicotiana tabacum.

Table 2. FmTU - no GenBank accession number.

Line 568. The article does not measure the level of phytohormones.

Author Response

评论1:第2.7和2.8节。请提供有关实验数量的信息，以及每个实验中每条线的植物数量。

Response1:In Sections 2.7 and 2.8, for each group we randomly selected 30 tobacco plants.

Comments2: Line 145, 179. Aligned using DANMAN or ClustalW?

Response2:We used the ClustalW alignment.

Comments3: Figure 2-9. Nb stands for Nicotiana benthamiana. The article conducts experiments with Nicotiana tabacum.

Response3:It has already been modified in the article to "Nicotiana benthamiana".

Comments4: Table 5-2. FmTU - no GenBank accession number.

Response4:The GenBank accession number for NbTU is XM_016640346.1.

The primer design for FmTU utilizes the following sequence, which has not been uploaded to the NCBI database.

ATGAGAGAGTGCATTTCTATCCACATTGGTCAGGCCGGAATTCAAGTCGGAAATGCCTGCTGGGAATTGTACTGCCTTGAGCACGGGATTCAGCCTGATGGGCAAATGCCTGGAGACAAAACAGTCGGCGGTGGAGATGATGCCTTCAACACTTTCTTCAGTGAAACAGGTGCCGGAAAGCACGTTCCCCGCGCTGTCTTTGTGGATCTGGAGCCTACTGTTATAGATGAGGTCCGTACCGGTACATACCGCCAGCTCTTCCACCCGGAACAGCTGATCAGTGGCAAGGAGGACGCTGCCAACAACTTTGCTAGAGGGCATTATACCATCGGCAAAGAGATTGTTGATCTCTGCCTCGATAGGATCCGAAAGCTTGCGGATAACTGTACTGGACTGCAGGGGTTCCTAGTGTTCCATGCTGTTGGTGGAGGCACTGGATCTGGACTTGGATCTCTGTTGCTCGAGAGGCTTTCTGTTGACTATGGTAAGAAATCGAAGTTGGGTTTCACTATTTACCCTTCCCCTCAAGTTTCGACTGCTGTCGTTGAACCGTACAACTCTGTGCTCTCGACACACTCTCTCTTGGAGCACACTGATGTTGCTGTGCTTCTTGACAATGAGGCGATTTATGATATTTGCCGCAAGTCACTTGATATTGAGAGGCCCACGTATACAAATCTGAACAGGCTCATTTCCCAGGTGATTTCTTCTTTGACTGCA

TCCCTGCGATTTGATGGAGCTCTTAATGTGGATGTGAATGAGTTCCAGACTAACTTGGTTCCATACCCAAGGATTCACTTCATGCTTTCCTCTTATGCCCCAGTCATCTCTGCTGAGAAAGCATACCATGAGCAACTCTCTGTTGCTGAAATCACGAACACAGCATTCGAGCCATCTTCCATGATGGTTAAATGTGACCCTCGCCACGGGAAGTACATGGCTTGCTGTCTGATGTACAGGGGTGATGTGGTGCCAAAAGATGTGAATGCTGCAGTGGCCACAATCAAAACTAAGAGGACAATTCAGTTTGTCGATTGGTGCCCAACTGGCTTCAAATGTGGTATCAATTATCAGCCACCT

ACTGTGGTTCCTGGTGGGGACTTAGCTAAGGTTCAAAGGGCTGTTTGCATGATTTCTAACTCAACTAGTGTGGCTGAGGTGTTCTCCAGGATTGATCATAAGTTCGACTTGATGTATGCCAAGCGTGCATTCGTTCACTGGTACGTCGGTGAGGGCATGGAAGAAGGAGAATTCTCAGAGGCTAGAGAGGATTTGGCTGCTCTCGAGAAGGATTATGAGGAGGTCGGAGCTGAATCTGCTGAAGGAGAAGACGAAGAAGGGGAAGATTAC

Comments5: Line 588. The article does not measure the level of phytohormones.

Response5:At the moment we are only pre-preliminary experiments, after which we will make further measurements of plant hormone levels.

Author Response File: Author Response.pdf

Reviewer 2 Report (New Reviewer)

Comments and Suggestions for Authors

Dear Author

The manuscript has been well written

I have following points to make

1. You have taken NAC1 Gene from Fraxinus mandshurica to show its cold resistance properties in tobacco

To proof the phylogenetic relationship, FmNAC1 closely related to the OeNAC1 in Olea europaea in fig 2b. however you have compared the sequence and protein structure of FmNAC1 with that of OsNAC1 of Oryza sativa.

2. Moreover, the plant sp that you have taken in consider for phylogenetic relationship do not have Oryza sativa.

3. What parameter did you consider for phylogenetic study?

4. What is the bootstrap value of your tree?

Author Response

Dear Editors and Reviewers:

Thank you for your letter and for the reviewers’ comments concerning our manuscript entitled “Function of the NAC1 Gene from Fraxinus mandshurica in Cold Resistance and Growth Promotion in Tobacco” (ID: forests-3042749). Those comments are all valuable and very helpful for revising and improving our paper, as well as the important guiding significance to our researches. We have studied comments carefully and have made correction which we hope meet with approval. Revised portion are marked in red in the paper. The main corrections in the paper and the responds to the reviewer’s comments are as flowing:

Comments1: Line 142,178. You have taken NAC1 Gene from Fraxinus mandshurica to show its cold resistance properties in tobaccoTo proof the phylogenetic relationship, FmNAC1 closely related to the OeNAC1 in Olea europaea in fig 2b. however you have compared the sequence and protein structure of FmNAC1 with that of OsNAC1 of Oryza sativa. Moreover, the plant sp that you have taken in consider for phylogenetic relationship do not have Oryza sativa.

Response1:He three-dimensional structure of Oryza sativa L. is known and more detailed and abundant, so we chose to compare with the three-dimensional structure of the Oryza sativa L. NAC1 protein, but because the Fraxinus mandshurica Rupr. is a woody plant, we chose a variety of woody plants and Fraxinus mandshurica Rupr. to establish an evolutionary tree to verify the phylogenetic relationship of the FmNAC1 protein, and we did not choose Oryza sativa L. in the evolutionary tree because it is a gramineous family, so we did not choose Oryza sativa L.

Comments2: Line 178. What parameter did you consider for phylogenetic study?

Response2:In the phylogenetic evolutionary tree we considered parameters such as Gap penalty, Substitution matrix, Bootstrap, re-sampling, Bayesian posterior probability, Outgroup selection, etc.

Comments3: Line 178. What is the bootstrap value of your tree?

Response3:The results showed that the amino acid sequence of FmNAC1 of Fraxinus mandshurica was similar to that of the Olea europaea（XP_022848339.1）、Sesamum indicum（XP_011095676.1）、Coffea arabic（XP_027061236.1）、Nicotiana tomentosiformis（XP_009605814.1 ）、Camellia sinensis（XP_028081260.1 ）、Beta vulgaris subsp. Vulgaris（XP_010666181.1 ）、Nelumbo nucifera （XP_010258675.1 ）、Theobroma cacao（XP_007022298.1 ）、Herrania umbratica（XP_021288005.1）、Populus euphratica（XP_011012784.1 ）、Populus alba（XP_034910133.1 ）、Populus trichocarpa（XP_002310688.1 ）、Manihot esculenta （XP_021606973.1 ）、Medicago truncatula（XP_003595973.1 ）、Hevea brasiliensis （XP_021644348.1 ）、Jatropha curcas（XP_012072721.1 ）、Ricinus communis （XP_002529954.1 ）、Pyrus x bretschneideri（XP_009336675.1 ）、Prunus avium （XP_021832498.1 ）、Juglans regia （XP_018838950.1 ）、Juglans microcarpa x Juglans regia （XP_040989265.1 ）、Carya illinoinensis（XP_042951768.1 ）、Quercus lobata（XP_030961789.1 ）、Lupinus angustifolius （XP_019443758.1）、Cicer arietinum（XP_004488843.1 ）、Abrus precatorius （XP_027343628.1 ）、Glycine soja（XP_028244150.1 ）、Cajanus cajan（XP_020223961.1 ）、Phaseolus vulgaris（XP_007149262.1）、Vigna angularis（XP_017423259.1） homologies were 85.14%、61.23%、61.76%、59.52%、62.94%、56.36%、59.18%、57.61%、59.67%、61.34%、61.66%、61.66%、58.6%、57.5%、61.66%、59.28%、58.07%、57.06%、56.02%、58.97%、60.26%、59.55%、56.8%、57.28%、58.46%、58.28%、59.74%、59.18%、60.65%、61.09%. FmNAC1 was most closely related to OeNAC1 (XP_022848339.1) in Olea europaea var., with a homology of 85.14%.

Author Response File: Author Response.pdf

Reviewer 3 Report (New Reviewer)

Comments and Suggestions for Authors

Dear Editor

The manuscript " Function of the NAC1 Gene from Fraxinus mandshurica in Cold 2 Resistance and Growth Promotion in Tobacco" is a very nice work. The manuscript is nicely described. I have some suggestions for the authors

1. In the methodology part, briefly describe the Abiotic Stresses and Hormone Signal Treatments and add one schematic diagram for clear understanding.

2. Part 5.5 also needs to be subdivided into two parts with two different subheadings and one schematic diagram for clear understanding.

3. Results are described nicely but at the same time, discussion is missing.

4. The author can add details on plant biomass.

5. In 5.7 Analysis of Low-Temperature Tolerance in Transgenic Tobacco Plants, no need to write 0 minutes, start here from 1 minute.

6. If the unit for time is min, so, no need to write in hr after 45 min. keep the uniformity in the whole manuscript.

7. Authors are free to combine two or three figures into a single panel if they choose. One figure may be Figure 5-8.

8. Here authors have checked the subcellular Localization of the FmNAC1 Protein, they can also add localization percentage, in different treatments.

Comments on the Quality of English Language

Can be imoroved

Author Response

Comments1: Line 525. In the methodology part, briefly describe the Abiotic Stresses and Hormone Signal Treatments and add one schematic diagram for clear understanding.

Response1:A schematic diagram has been added here.

Comments2: Line 527. Part 5.5 also needs to be subdivided into two parts with two different subheadings and one schematic diagram for clear understanding.

Response2:Has been modified into two parts.

Comments3: Line 378. Results are described nicely but at the same time, discussion is missing.

Response3:I have written each part of the discussion uniformly in the last part of the discussion.

Comments4: Line 279, 293. The author can add details on plant biomass.

Response4:We randomly selected 30 tobacco plants from each group.

Comments5: Line 580. In 5.7 Analysis of Low-Temperature Tolerance in Transgenic Tobacco Plants, no need to write 0 minutes, start here from 1 minute.

Response5:The "0 minutes" has already been deleted.

Comments6: Line 580.If the unit for time is min, so, no need to write in hr after 45 min. keep the uniformity in the whole manuscript.

Response6:Our experiments were set up for longer periods of time, and if converted to minutes 24 hours would be converted to 1440 minutes, which is too large a value. Putting it in the picture affects the beauty of the picture.

Comments7: Line 143. Authors are free to combine two or three figures into a single panel if they choose. One figure may be Figure 5-8.

Response7:It has been modified.

Comments8: Line 212. Here authors have checked the subcellular Localization of the FmNAC1 Protein, they can also add localization percentage, in different treatments.

Response8:Eighty-four per cent of the fluorescent signals of the FmNAC1-GFP fusion protein were detected in the nuclei of onion epidermis.

Author Response File: Author Response.pdf

Round 2

Reviewer 2 Report (New Reviewer)

Comments and Suggestions for Authors

Please include these explanations "three-dimensional structure of Oryza sativa L. is known and more detailed and abundant, so we chose to compare with the three-dimensional structure of the Oryza sativa L. NAC1 protein, but because the Fraxinus mandshurica Rupr. is a woody plant, we chose a variety of woody plants and Fraxinus mandshurica Rupr. to establish an evolutionary tree to verify the phylogenetic relationship of the FmNAC1 protein, and we did not choose Oryza sativa L. in the evolutionary tree because it is a gramineous family, so we did not choose Oryza sativa L." in your discussion to correlate the comparison of protein structure with Oryza sativa but not included in a phylogenetic tree.

Author Response

Dear Editors and Reviewers:

Thank you for your letter and for the reviewers’ comments concerning our manuscript entitled “Function of the NAC1 Gene from Fraxinus mandshurica in Cold Resistance and Growth Promotion in Tobacco” (ID: forests-3042749 ). Those comments are all valuable and very helpful for revising and improving our paper, as well as the important guiding significance to our researches. We have studied comments carefully and have made correction which we hope meet with approval. Revised portion are marked in red in the paper. The main corrections in the paper and the responds to the reviewer’s comments are as flowing:

Comments 1:Please include these explanations "three-dimensional structure of Oryza sativa L. is known and more detailed and abundant, so we chose to compare with the three-dimensional structure of the Oryza sativa L. NAC1 protein, but because the Fraxinus mandshurica Rupr. is a woody plant, we chose a variety of woody plants and Fraxinus mandshurica Rupr. to establish an evolutionary tree to verify the phylogenetic relationship of the FmNAC1 protein, and we did not choose Oryza sativa L. in the evolutionary tree because it is a gramineous family, so we did not choose Oryza sativa L." in your discussion to correlate the comparison of protein structure with Oryza sativa but not included in a phylogenetic tree.

Respones 1: When using SWISS-MODEL software to compare the FmNAC1 protein, the closest protein result provided was the NaC1 protein of Oryza sativa L. this protein was used to construct our FmNAC1 protein of Fraxinus mandshurica. Construction of evolutionary tree the protein sequence with high similarity of FmNAC1 protein of Fraxinus mandshurica that we mainly searched in NCBI database is the sequence I used to build the evolutionary tree. I think that the different software makes the different sequences searched.

This manuscript is a resubmission of an earlier submission. The following is a list of the peer review reports and author responses from that submission.

Round 1

Reviewer 1 Report

Comments and Suggestions for Authors

Following are few suggestions towards the improvement of manuscript entitled “Functional Characterization of the FmNAC1 Gene in Cold Resistance and Growth Promotion in Fraxinus mandshurica”.

Anticipate your needful action in this regard.

Comments:

1. Authors were advised to use recently accepted authors citation on Fraxinus mandshurica.

2. Authors were instructed to not write both the genus and species name in the same paregraph several time.

3. Figure 1. (A) should be improved because the sequences details were not visible.

4. In Figure 6 authors were instructed to provide the rooting stage photograph.

5. On line number 188: authors were advised to insert the sequence of the FmNAC1 promoter.

6. On line number 477: authors were advised to care about sentence construction because few words were superscript.

7. Authors were advised to incorporated a greater number of recent articles in the introduction and discussion parts.

8. All references should be written as per the journal format.

Comments on the Quality of English Language

minor typological errors were there it should be taken care.

Author Response

Author Response File: Author Response.pdf

Reviewer 2 Report

Comments and Suggestions for Authors

Manuscript ID forests-2956767

In the present manuscript entitled “Functional Characterization of the FmNAC1 Gene in Cold Resistance and Growth Promotion in Fraxinus mandshurica” the authors report on functional characterization of a member of NAC family transcription factor of Fraxinus mandshurica plant species. The authors present data on the cloning, phylogenetic analysis, intracellular localization, relative gene expression under abiotic stress conditions in Fraxinus mandshurica as well as the functional characterization of Fm NAC1 in transgenic tobacco plant Three lines of transgenic tobacco plants were evaluate for growth phenotype , cold resistance and finally the relative expression level of tobacco genes known to be abiotic stress related were also detected at different time.

In the context of climate change, the scientific research that improve ours known on how the plants respond to the abiotic stress condition are very appreciate. The involvement of members of NAC transcription factor in various plant process, like apical shoots meristem development, floral organ, lateral roots and as well as in cold, drought, salts stress condition are extensively reported in the literature for various plant species.

Although the authors have well planned the experimental activity to characterize the involvement of a member of NAC transcription factor of Fraxinus mandshurica plant species under abiotic stress the manuscript in the present form shows many critical issues.

It is very difficult to mention all the comments that the authors should be considered, I will try to indicate some of the main points.

1) The abstract should be revised, there are few information about the interest to characterize the NAC Transcription factor in Fraxinus mandshurica, on the contrary the results information are presented with many detail. Please follow the manuscript preparation as indicated in the journal home page.

2) The introduction section should be carefully revised.

Line 62-63; NAC domain proteins form one of the largest families of plant-specific transcription factors and have been identified in various plant species, such as Arabidopsis, tobacco, Populus, and soybean [16]. The reference 16 is not appropriate to the scientific context.

Line 66-67; please add more information.

Line 79-80-81; Additionally, many NAC transcription factors are reportedly induced by cold stress and are crucial for plant responses to such conditions. (Ref 28)

The ref 28 an also ref 26 are not appropriate to the scientific context.

Line 103-109, this paragraph report scientific information, but all the references are not appropriate.

Please revised all the introduction section.

3) The results section should be revised.

2.1 cloning….

The nucleotide sequence of the FmNAC1 is already deposited in the NCBI database ( MG269829.1) so the accession number should be indicated. Figure 1 show the comparation of the tertiary structure with Oryza sativa NAC protein. Please show the different region with different colors on the amino acid sequence of FmNAC1. As reported in “Materials and Methods” tow primers (Fw-Fr) were used to amplified and cloning the FmNAC1 using cDNA as template. There are not correspondence between primers and coding sequence FmNAC1. I don’t know how the authors can amplified and cloning the FmNAC1 gene. Please let me Know!!!!!!!

Line 145-147… please indicate which is the correct sequence that was closely related.

2.4 Exspression pattern……

It is not clear how the hormones treatment was conducted. No information was reported in “Materials and Methods”.

2.5 cloning ……

Again, how the authors have cloned the promoter region of FmN1 gene. Which primers they have used?..............

There are numerous other critical issues throughout the manuscript that the authors should review. Finally, many sentences in the discussion lack bibliographical references.

Comments on the Quality of English Language

In many sentences the English is very difficult to understand/incomprehensible.

Author Response

Dear Editors and Reviewers: Thank you for your letter and for the reviewers’ comments concerning our manuscript entitled “Function of the NAC1 Gene from Fraxinus mandshurica in Cold Resistance and Growth Promotion in Tobacco” (ID: forests-2956767 ). Those comments are all valuable and very helpful for revising and improving our paper, as well as the important guiding significance to our researches. We have studied comments carefully and have made correction which we hope meet with approval. Revised portion are marked in red in the paper. The main corrections in the paper and the responds to the reviewer’s comments are as flowing: 1) The abstract should be revised, there are few information about the interest to characterize the NAC Transcription factor in Fraxinus mandshurica, on the contrary the results information are presented with many detail. Please follow the manuscript preparation as indicated in the journal home page. Response： To elucidate the function of cold resistance regulatory gene FmNAC1 from Fraxinus mandshurica, the roles of over-expression of FmNAC1 gene in tobacco growth and cold stress regulation were identified.The cloned FmNAC1 gene from F. mandshurica is 891 bp in length and encodes 296 amino acids. Subcellular localization analysis confirmed that FmNAC1 is located primarily in the nucleus and functions as a transcription factor. The FmNAC1 is responsive to cold and NaCl stress, as well as to the induction of IAA, GA, and ABA hormone signals. To further elucidate its function in cold resistance, the four transgenic tobacco lines of FmNAC1 overexpression（FmNAC1-OE）were generated through the tissue culture after agrobacterium-mediated transformation of wild-type (WT) tobacco. These FmNAC1-OE plants exhibited accelerated growth post transplantation. When exposed to low-temperature conditions at -5°C for 24 hours, the wilting and yellowing of the FmNAC1-OE plants were significantly lower than those of the WT tobacco plants. Additionally, the membrane integrity, osmotic regulation, and reactive oxygen species (ROS) scavenging abilities of the FmNAC1-OE tobacco lines were greater than those of the WT plants, indicating the potential of the FmNAC1 gene for improving plant cold resistance. Results of gene expressions further revealed that the FmNAC1 transcription factor exhibits regulatory interactions with growth-related genes such as IAA and AUX1, cold resistance-related genes such as ICE, DREB, and CBF1, and genes involved in reactive oxygen species (ROS) clearance such as CAT and SOD. All these evidence showed that the over expression of FmNAC1 transcription factor from F. mandshurica played key roles in contributing to the enhancement of growth, cold resistance, and ROS clearance in transgenic tobacco plants. 2) The introduction section should be carefully revised. Line 62-63; NAC domain proteins form one of the largest families of plant-specific transcription factors and have been identified in various plant species, such as Arabidopsis, tobacco, Populus, and soybean [16]. The reference 16 is not appropriate to the scientific context. Line 66-67; please add more information. Response: We have improved this section by removing reference 16, replacing it with a new citation, and adding more information. The results are as follows: The NAC (NAM, no apical meristem; ATAF 1/2, Arabidopsis transcription activation factor; CUC2, cup-shaped cotyledon) family of transcription factors is pivotal in plant development and hormonal signal responses[14]-[16]. Representing one of the largest families of plant-specific transcription factors, NAC domain proteins have been identified across various plant species including Arabidopsis, rice[17], Populus[18], chestnut[19], Cyclocarya paliurus[20],and Catharanthus roseus[21]. These proteins feature a conserved N-terminal NAC domain responsible for DNA and protein binding, serving as a distinguishing hallmark for their identification. Furthermore, they exhibit a diverse array of C-terminal domains. Contrary to a classical helix-turn-helix motif, the NAC domain presents a unique transcription factor fold comprising distorted β-sheets encircled by helical elements[22]. NAC proteins categorize into six significant branches: MAM/CUC3, secondary wall NAC (SWN), TIP, SNAC (Stress-Responsive NAC), ANAC034, and OsNAC4[23]. Line 79-80-81; Additionally, many NAC transcription factors are reportedly induced by cold stress and are crucial for plant responses to such conditions. (Ref 28) The ref 28 an also ref 26 are not appropriate to the scientific context. Response: We have improved this section by removing references 26 and 28, replacing them with new citations, and adding more information. The results are as follows: The involvement of NAC proteins spans across the transcriptional regulation of diverse plant processes, encompassing the development of shoot apical meristems, floral organs, and lateral roots. Additionally, they play a pivotal role in the plant's stress response, modulating pathways associated with stress tolerance, thus enhancing the plant's resilience to environmental challenges[24]-[28]. Consequently, the NAC family of transcription factors emerges as indispensable in coordinating plant growth, development, and adaptation to fluctuating environmental conditions [29]. Line 103-109, this paragraph report scientific information, but all the references are not appropriate. Response: We have removed this paragraph and added other relevant content and references to the manuscript. Please revised all the introduction section. Response: We have rewritten the introduction section and added relevant literature to help provide a better understanding of the background of this paper. 3) The results section should be revised. 2.1 cloning…. The nucleotide sequence of the FmNAC1 is already deposited in the NCBI database ( MG269829.1) so the accession number should be indicated. Figure 1 show the comparation of the tertiary structure with Oryza sativa NAC protein. Please show the different region with different colors on the amino acid sequence of FmNAC1. As reported in “Materials and Methods” tow primers (Fw-Fr) were used to amplified and cloning the FmNAC1 using cDNA as template. There are not correspondence between primers and coding sequence FmNAC1. I don’t know how the authors can amplified and cloning the FmNAC1 gene. Please let me Know!!!!!!! Response: Figure 1 has been revised to compare the protein sequences of FmNAC1 and Oryza sativa NAC protein, as shown in Figure 1D. We have reorganized and revised the cloning process of the gene, including the specific steps for RNA extraction, cDNA reverse transcription, and the cloning primer sequences and temperature conditions. The details are as follows: 5.1. Cloning and Identification of FmNAC1 Gene The MiniBEST Plant RNA Extraction Kit (Takara Bio, Inc., Japan) was used for total RNA extraction. The cDNA synthesized was created using the PrimeScript First Strand cDNA Synthesis Kit (Takara Bio Inc., Shiga, Japan). The full-length cDNA of FmNAC1 was obtained by PCR using the primers are shown in Table 1 .Then, the cDNA was used as a template, and the FmNAC1 gene was amplified by upstream and downstream primers. The PCR system included buffer (2 μL), Taq (0.2 μL), dNTPs (1.6 μL), FmNAC1-F (1 μL), FmNAC1-R (1 μL), cDNA template (1 μL), and ddH2O (up to 20 μL). The PCR program was as follows: cycle 30×; predenaturation at 94°C for 5 min; denaturation at 94°C for 30 s; annealing at 53°C for 45 s; extension at 72°C for 30 s; and extension at 72°C for 10 min at 4°C.The sequence of the FmNAC1 gene was submitted to GenBank with the accession number MG269829.1. Table 1. The primers corresponding to the coding region of the cloned FmNAC1 gene. Primer name Primer sequences TM price FmNAC1-F 5'-TCTATCACCTCCGCCATC -3' 53.1 FmNAC1-R 5'-TCAATAATGGTTCCACTGC -3' 52.3 Line 145-147… please indicate which is the correct sequence that was closely related. Response: We have modified the sentences as follows: To analyze the phylogenetic relationships between FmNAC1 and homologous NAC1 sequences in other plants, a phylogenetic tree was constructed using MEGA 5.0 software. The gene sequences of FmNAC1 and others were included in the analysis. FmNAC1 was found to be most closely related to OeNAC1 (,XP_022848339.1) in Olea europaea (Figure 2B ).Their homology was 85.14%. 2.4 Exspression pattern…… It is not clear how the hormones treatment was conducted. No information was reported in “Materials and Methods”. Response: We have enhanced it as follows: 5.4. Abiotic Stresses and Hormone Signal Treatments 30-day-old and uniformly growing manchurian seedlings were subjected to hormone and abiotic stress treatments. For low-temperature stress treatment, manchurian seedlings were transferred to liquid MS medium and placed in a 4℃ low-temperature culture chamber. For salt stress, seedlings were transferred to MS liquid medium containing 200 mmol/L NaCl. For hormone treatments, seedlings were respectively transferred to MS liquid medium containing 100 mmol/L ABA, 100 pmol/L GA3, and 100 pmol/L IAA. For the control group, untreated seedlings were transferred to MS liquid medium and cultured at 25℃under long-day photoperiod conditions (16h light/8h dark). All materials were treated for 48 hours, and samples of the treated manchurian seedlings were taken at 1 h, 3 h, 1 h, 6 h, 12 h, 24 h, and 48 h, respectively, and stored in liquid nitrogen and then stored in a -80℃ freezer for later use. Each treatment group was set up with 5 biological replicates. 2.5 cloning …… Again, how the authors have cloned the promoter region of FmN1 gene. Which primers they have used?.............. Response: We have reorganized and revised the cloning process of the gene promoter, including the cloning primer sequences and temperature conditions. However, one reviewer suggested that we remove the promoter section as we did not conduct any relevant research on it in the paper. We only performed a simple simulated analysis, which has minimal impact on the overall gene function interpretation. 5.1. Experimental Methods for Gene Promoter Cloning For cloning of the full-length FmNAC1 promoter, primers were first designed using primer 5, and the results are shown. Table 2. The primers corresponding to the cloned FmNAC1 promoter. Primer name Primer sequences TM price FmNAC1-Qi-F 5'-TATTACAATTGAGAGTACAATAATG -3' 53.4 FmNAC1-Qi-R 5'-GGCAGCTTTGCCTCTATC -3' 52.9 Then, the DNA was used as a template, and the FmNAC1 gene was amplified by upstream and downstream primers. The PCR system included buffer (2 μL), Taq (0.2 μL), dNTPs (1.6 μL), FmNAC1-Qi-F (1 μL), FmNAC1-Qi-R (1 μL), DNA template (1 μL), and ddH2O (up to 20 μL). The PCR program was as follows: cycle 30×; predenaturation at 94°C for 5 min; denaturation at 94°C for 30 s; annealing at 53°C for 45 s; extension at 72°C for 30 s; and extension at 72°C for 10 min at 4°C. There are numerous other critical issues throughout the manuscript that the authors should review. Finally, many sentences in the discussion lack bibliographical references. Response: The specific text grammar titles have been carefully revised and highlighted in red in the text. The word Interspecific has been modified in the text.The missing references have also been added. We tried our best to improve the manuscript and made some changes in the manuscript. These changes will not influence the content and framework of the paper. And here we did not list the changes but marked in red in revised paper. We appreciate for Editors/Reviewers’ warm work earnestly, and hope that the correction will meet with approval. Once again, thank you very much for your comments and suggestions.

Author Response File: Author Response.pdf

Reviewer 3 Report

Comments and Suggestions for Authors

The present study investigates the influence of overexpression of FmNAC1 from Fraxinus mandshurica on cold resistance and growth promotion in tobacco. Article has serious flaws.

Comments for author File: Comments.pdf

Author Response

Dear Editors and Reviewers: Thank you for your letter and for the reviewers’ comments concerning our manuscript entitled “Function of the NAC1 Gene from Fraxinus mandshurica in Cold Resistance and Growth Promotion in Tobacco” (ID: forests-2956767). Those comments are all valuable and very helpful for revising and improving our paper, as well as the important guiding significance to our researches. We have studied comments carefully and have made correction which we hope meet with approval. Revised portion are marked in red in the paper. The main corrections in the paper and the responds to the reviewer’s comments are as flowing: 1. The title of the article is misleading because the article does not contain data on overexpression of the gene FmNAC1 in the Fraxinus mandshurica. Response: The title has been revised to: Function of the NAC1 Gene from Fraxinus mandshurica in Cold Resistance and Growth Promotion in Tobacco 2. The article is written carelessly. For example, some errors in the text: • Line 313. «MAD content» Response: This section has been revised to: A: MDA content; B: relative conductivity; C: POD activities; D: SOD activities; E: soluble protein content; F: soluble sugar content. • Lines 188-189. “[Please insert the sequence]” Response: This section has been deleted. • Lines 145-147. “FmNAC1 was found to be most closely related to SiNAC1 (Sesamum indicum, XP_011095676.1) in Olea europaea (Figure 2). “ Response: This section has been revised to: The gene sequences of FmNAC1 and others were included in the analysis. FmNAC1 was found to be most closely related to OeNAC1 (XP_022848339.1) in Olea europaea (Figure 2B ).Their homology was 85.14%. • Line 139. “Tertiary structure of the conserved NAC1 domain in response to Oryza sativa L” Response: This section has been revised to: The tertiary structure of the conserved domain of Oryza sativa L. stress-responsive NAC1 protein. • Line 543. “and field studies on plants complied with the relevant guidelines and regulations.” – There is no field research in this article. Response: This section has been deleted. • Lines 252-254. It says here that one transgenic line went into further analysis. Although 3 transgenic lines are analyzed further. Response: This section has been revised to:Consequently, we selected the three strains with the highest expression, No. 1, 2 and 5 lines were selected for further investigation. 3. The results in Figure 6 are very doubtful and are not discussed in anyway.The authors claim that the transgenic lines were obtained in 30 days, which is a very fast result. For example: • https://link.springer.com/protocol/10.1385/0-89603-321-X:39 - in this work, the following is stated: «It takes about 2 moto obtain rooted plantlets that can be transferred to soil. » . • https://link.springer.com/article/10.1007/BF02669766 - in another work, the following is stated: «A minimum of nine weeks was required until the first plantlet was transferred to the greenhouse.» . Experiments with transgenic lines began to be conducted immediately after receiving transgenic lines, which also casts doubt on the authenticity of the results. Response: We found inaccuracies in the recorded time points. Based on the corrected time points, we have recalculated the developmental timeline, resulting in the following figure time points: 4. There is no statistical verification of the results in Figures 8B, 10, 11B-F. Response:We have incorporated statistical verification into Figures 8B, 10, and 11B-F through calculations. *Indicates a significant difference between control and Transgenic Tobacco (p < 0.05).The results are as follows: Figure 8. Changes in Plant Height of FmNAC1 Transgenic Tobacco Plants after Transplanting. Figure 10. Analysis of the physiological indexes of transgenic tobacco plants under low-temperature stress. Figure 11. Gene Expression Levels in FmNAC1 Transgenic Tobacco Under Cold Stress Conditions. 5. In Figure 2, there is no statistical verification of the clades (the bootstrap method), and the distances between the branches do not reflect the number of nucleotide substitutions, so the selected clades maybe questionable. Response: The specific sequences aligned are listed to generate the following figure: 6. The results in Figure 3 are also highly questionable. I don't see any fluorescence signals in PBI121-GFP. Response: The original image was adjusted for clarity and brightness to enhance the fluorescence signals in PBI121-GFP, resulting in the following figure: 7. Lines 186-219. In the article, the transgene contains a viral promoter. The information obtained in silico is isolated from the rest of the results and is not discussed in anyway. It is recommended to delete it. Response: Your suggestion is very good; we have decided to delete the promoter section. 8. The materials and methods are not described insufficient detail. The methods of DNA and RNA isolation are not described. The process of obtaining plasmid vectors, experimental conditions and PCR conditions are not described in detail. It is impossible to repeat the work according to this description. Response: Based on your suggestion, we have rephrased this part as follows: 5.1. Cloning and Identification of FmNAC1 Gene The MiniBEST Plant RNA Extraction Kit (Takara Bio, Inc., Japan) was used for total RNA extraction. The cDNA synthesized was created using the PrimeScript First Strand cDNA Synthesis Kit (Takara Bio Inc., Shiga, Japan). The full-length cDNA of FmNAC1 was obtained by PCR using the primers are shown in Table 1 .Then, the cDNA was used as a template, and the FmNAC1 gene was amplified by upstream and downstream primers. The PCR system included buffer (2 μL), Taq (0.2 μL), dNTPs (1.6 μL), FmNAC1-F (1 μL), FmNAC1-R (1 μL), cDNA template (1 μL), and ddH2O (up to 20 μL). The PCR program was as follows: cycle 30×; predenaturation at 94°C for 5 min; denaturation at 94°C for 30 s; annealing at 53°C for 45 s; extension at 72°C for 30 s; and extension at 72°C for 10 min at 4°C.The sequence of the FmNAC1 gene was submitted to GenBank with the accession number MG269829.1. Table 1. The primers corresponding to the coding region of the cloned FmNAC1 gene. Primer name Primer sequences TM price FmNAC1-F 5'-TCTATCACCTCCGCCATC -3' 53.1 FmNAC1-R 5'-TCAATAATGGTTCCACTGC -3' 52.3 (1)The process of obtaining PBI121-FmNAC1-GFP vectors The FmNAC1 coding region was introduced into the PBI121-GFP expression vector driven by the CaMV-35S promoter and fused to the 5’ green fluorescence protein (GFP) gene to generate 35S::FmNAC1-GFP using the specific primers PBNAC1-GFP-F (5’- tacccgggtcgactgactagtATGAGTAGTTTGAGCATGATAGAGGC-3’) and PBNAC1-GFP-R (5’- gcccttgctcaccatactagtTCAATAATGGTTCCACTGCAATCC-3’). (2)The process of obtaining pROKII-FmNAC1-GUS vectors The FmNAC1 coding region was introduced into the pROKII-GUS expression vector driven by the CaMV-35S promoter and fused to the β-glucuronidase (GUS) gene to generate 35S::FmNAC1-GUS using the specific primers pRNAC1-GUS-F (5’- gagaacacgggggactctagaATGAGTAGTTTGAGCATGATAGAGGC-3’) and pRNAC1-GUS-R (5’- catggtcaagagtccggtaccTCAATAATGGTTCCACTGCAATCC-3’). The constructed pROKII-GUS expression vector 35S::FmNAC1-GUS weas used in overexpression of FmNAC1 plants, respectively, and the vector was transformed into Agrobacterium tumefaciens. 9. Table 3. The melting temperatures of the primers are not described. It also does not describe how the design of the primers was carried out or links to sources from where the pairs of primers were taken. Response: By searching the existing transcriptome data in our lab, we identified the desired sequence similar to FmNAC1. Using Primer5 software, we designed corresponding primers for cloning, with the cDNA of Fraxinus mandshurica as the template. Table 1. The primers corresponding to the coding region of the cloned FmNAC1 gene. Primer name Primer sequences TM price FmNAC1-F 5'-TCTATCACCTCCGCCATC -3' 53.1 FmNAC1-R 5'-TCAATAATGGTTCCACTGC -3' 52.3 10. There are statements in the discussion without references to sources. Response: The word Interspecific has been modified in the text.The missing references have also been supplemented. We tried our best to improve the manuscript and made some changes in the manuscript. These changes will not influence the content and framework of the paper. And here we did not list the changes but marked in red in revised paper. We appreciate for Editors/Reviewers’ warm work earnestly, and hope that the correction will meet with approval. Once again, thank you very much for your comments and suggestions. • Lines 356-357. «Transcription factors in the NAC family are known to play a crucial role in plant development and stress response.» • Lines 383-385. “The NAC1 gene has been shown to stimulate root growth, thereby improving the plant's capacity to absorb nutrients, promoting rapid growth, and enhancing cold resistance.” • Lines 412-418. “GmNAC20 plays a role in enhancing stress tolerance by controlling the expression of the COR genes DREBIA/CBF3 and DREB1C/CBF2. It directly interacts with the promoters of DREB1A/CBF3 and DREB1C/CBF2, leading to increased CBF3 transcription and decreased CBF2 transcription. In banana, MaNNAC1 is regulated by MaICE1, and this protein interacts with MaCBF1 to govern cold tolerance in banana fruit. Additionally, the PbeNAC1 protein can increase the transcription level of stress-related genes by interacting with PbDREB1 and PbDREB2A, thereby enhancing the tolerance of transgenic tobacco.” • Line 361. The reference [41] does not support the statement.

Author Response File: Author Response.pdf

Round 2

Reviewer 3 Report

Comments and Suggestions for Authors

The article has been improved, but it still has serious flaws.

1. The article requires proofreading, because there are many small errors in it. For example:

Line 141. "FmNAC1.and OsNAC1."

Line 133. "gene (>MG269829.1)"

Line 151. "(Figure 2B ).Their homology was 85.14%."

etc.

2. Please make the same species order in Figure 2a and 2b, and indicate the species in italics in 2b.

3. Which progeny of plants is used in the experiments?

4. Table 1 and Table 2. Please indicate in the supporting materials the complete sequences with the GenBank accession numbers where the primers should be annealed. Mark the primers on the sequences in different colors.

Table 1. "TM price"?

Table 2. Add melting temperatures for PCR primers.

5. Section 5.1. The cloning process is not described.

Line 436. "Experimental Approach for FmNAC1 Protein Subcellular Localization"

Lines 437-441. Please add a map of the T-DNA region with restriction sites. Describe what cloning technology, restrictases and Agrobacterium strain were used.

Lines 442-447. Specify the method reference, please.

Lines 494-499. DNA extraction method and PCR conditions not described.

6. Please check carefully for the correctness of the citation of all references. For example:

Lines 501-505. The references do not describe the methods.

Lines 372-374. The reference [46] describes a method for the quantification of microgram quantities of protein, not MDA accumulation and relative conductivity during cold stress.

Lines 377-379. The reference [51] describes microRNA profiling, not the sugar content in plants under cold stress.

Author Response

Dear Editors and Reviewers:

Thank you for your letter and for the reviewers’ comments concerning our manuscript entitled “Function of the NAC1 Gene from Fraxinus mandshurica in Cold Resistance and Growth Promotion in Tobacco” (ID: forests-2956767). Those comments are all valuable and very helpful for revising and improving our paper, as well as the important guiding significance to our researches. We have studied comments carefully and have made correction which we hope meet with approval. Revised portion are marked in red in the paper. The main corrections in the paper and the responds to the reviewer’s comments are as flowing:

The article requires proofreading, because there are many small errors in it. For example:

Line 141. "FmNAC1.and OsNAC1."

Line 133. "gene (>MG269829.1)"

Line 151. "(Figure 2B ).Their homology was 85.14%."

Response: The article has been carefully reviewed, and the aforementioned issues have been addressed and marked in the text.

Please make the same species order in Figure 2aand 2b, and indicate the species in italics in 2b.

Response: The Figure 2a and 2b has been modified as follows:

Which progeny of plants is used in the experiments?

Response: Materials and methods have been added to the text as follows:

5.1. Plant Material and Growth Conditions

Nicotiana tabacum and F. mandshurica seeds from the Northeast Forestry University experimental forest farm were used. The seeds were surface sterilized and grown at 25℃ under long-day conditions (16h light/8h dark) on a standard field.

Table 1and Table 2. Please indicate in the supporting materials the complete sequences with the GenBank accession numbers where the primers should be annealed. Mark the primers on the sequences in different colors.

Table 1. "TM price"?

Table 2. Add melting temperatures for PCR primers.

Response: Table 1. "TM price" has been changed to "melting temperatures". GenBank accession numbers and melting temperatures have been added to the table. The modified table is as follows:

Table 1. The primers corresponding to the coding region of the cloned FmNAC1 gene.

Gene	GenBank accession numbers	Primer name	Primer sequences	Melting temperatures
FmNAC1-F	MG269829.1	FmNAC1-F	5'-TCTATCACCTCCGCCATC -3'	53.1℃
		FmNAC1-R	5'-TCAATAATGGTTCCACTGC-3'	52.3℃

Table 2. Sequences of Primers used for qRT-PCR.

Gene	GenBank accession numbers	Primer Name	Primer Sequence	Melting temperatures
NbIAA	XM_016592822.1	q NbIAA -F	5' GCCTCCTTCCACATTCCC 3'	57℃
NbIAA		q NbIAA -R	5' AGTCCACGTTTCGCACCA 3'	57.4℃
NbAUX1	NM_001326023.1	qNbAUX1-F	5' AGGCTACTGCCCTACCAC 3'	52℃
NbAUX1		qNbAUX1-R	5' CAGCAACTGTATTCCCACA 3'	51.8℃
NbICE	XM_016610394.1	q NbICE-F	5' CCCATCATTCCATTTGCT 3'	53.3℃
NbICE		q NbICE-R	5' CCATTATCCCACTTCCTCT 3'	51.1℃
NbDREB	NM_001325812.1	qNbDREB-F	5' GGCTTGGCACTTTCCCTT 3'	57.3℃
NbDREB		qNbDREB-R	5' AATAGCGCCTCCTCATCC 3'	54.3℃
NbCBF	NM_001325227.1	q NbCBF-F	5' GGGGAATAAGGAGGAGAA 3'	51℃
NbCBF		q NbCBF-R	5' CTGAAGTCGGGATGGGTA 3'	53.2℃
NbCAT	NM_001325412.1	q NbCAT-F	5' AATCATAGCCACGCCACC 3'	56.2℃
NbCAT		q NbCAT-R	5' CGAATAGTAAAGACCAGGGA 3'	52.2℃
NbSOD	XM_016581519.1	q NbSOD -F	5' GATCTGGGAAGAGGTGGA 3'	51.7℃
NbSOD		q NbSOD -R	5' CAGCCCTAATGATAAACTGA 3'	50.5℃
NbTU	qPT-PCR	qNbTU-F	5'TGGACTCTGGTGATGGTGTC.3'	51.3℃
NbTU		qNbTU-R	5' CCTCCAATCCAAACACTGTA 3'	52.4℃
FmNAC1	MG269829.1	qFmNAC1-F	5' AATGGATAATCGGCTGTG 3'	50.9℃
FmNAC1		qFmNAC1-R	5' CCTTACGAAGAATCGGTCTA 3'	52.4℃
FmTU	qPT-PCR	qFmTU-F	5' AGGACGCTGCCAACAACTTT 3'	53.1℃
FmTU		qFmTU-R	5' TTGAGGGGAAGGGTAAATAGTG 3'	52.4℃

Here are the sequences for the designed primers, with the primer portions marked in red.

Design of FmNAC1(MG269829.1) cloning primers

TCTCTCTCTCTCTCTCTTCTTTCTCTATCACCTCCGCCATCGCCACCGTGCCGGAAAATGAGTAGTTTGAGCATGATAGAGGCAAAGCTGCCGCCGGGGTTTAGGTTTCAGCCAAGAGATGAAGAATTGATATGTGATTACTTGATGAAATGGATAATCGGCTGTGGCCACCAGAACCACCCTCTGTTAATTGAAGTTGATCTCAACAAGTGCGAGCCTTGGGACGTTCCCAAATCAGCATGTGTAGGAGGTAAGGAGTGGTATTTTTACAGCCAACGCGATCGTAAATATGCAACAGGACTAAGAACAAATCGAGCGACACTAACGGGTTATTGGAAGGCCACCGGAAAAGATAGACCGATTCTTCGTAAGGGAATCCTAATGGGAATGAGAAAAACATTGGTATTTTACCAGGGCAGGGCTCCTAAAGGAACAAAAACTGATTGGGTCATGCATGAATTTCGCCTTGAAGGAGCCTTTGGCTCTCCTAAACCATCATCTGTCAAGGAGGATTGGGTTTTATGCAGATTGTTCTACAAAAAGGGAGAAGCTGAAGCCAAACCAGAAACAGGAAGCAGCCACGAAAAAGAAATCACCACTTCTCCTTCTTCTCTTCCTCCATTAATGAAACCCTGTCTCACCTTTGACCCATATCAGGCCACAACAGATGAGTATAATCATGAGCAAGTGCCCTGCTTCTCCATTTCGAACAATAATTTCTCACAAATCACAGAATCATCCAACGAATTCATGCCCACATTTGGAGGGTTGCCTGCAGATCATAATCTTGGAATGTGTTCATCATCATCAAACTCTGATCAGACGGTGATCAAAGCTCTAATCTATCATCTTACCAAAATGGACGAAAGCAATTGCTCCCCAAGTTTTGGGGATGGAAGTTCAGACAGTTATCTGTCTGAACTGGGATTGCAGTGGAACCATTATTGA

Primer name	Primer sequences	TM value
FmNAC1-F	5'-TCTATCACCTCCGCCATC -3'	53.1℃
FmNAC1-R	5'-TCAATAATGGTTCCACTGC -3'	52.3℃

Design of FmNAC1(MG269829.1) qRT-PCR primers

ATGGATAATCGGCTGTGGCCACCAGAACCACCCTCTGTTAATTGAAGTTGATCTCAACAAGTGCGAGCCTTGGGACGTTCCCAAATCAGCATGTGTAGGAGGTAAGGAGTGGTATTTTTACAGCCAACGCGATCGTAAATATGCAACAGGACTAAGAACAAATCGAGCGACACTAACGGGTTATTGGAAGGCCACCGGAAAAGATAGACCGATTCTTCGTAAGG

qFmNAC1-F	5' AATGGATAATCGGCTGTG 3'			50.9℃
qFmNAC1-R	5' CCTTACGAAGAATCGGTCTA 3'			52.4℃

Design of NbIAA(XM_016592822.1) qRT-PCR primers

CCTCCTTCCACATTCCCAAGCTTATATAGTAGCCAAAACATCAGACCCAACACTTCTCGTAGCCCATTTTTCACTTAGTAGCCACTAGCCAGGACTAGAAGATTTTCTAACAAAAGACTAGGAATCTTATTAACACCTTGTAGCCTACAGAAGTAGAATGTCATCGGAAAAAACAAAAACAAAGAACTTGTCGGAATCCGATGATTCCAGTCTCAGTTTCGAGGAAACTGAGCTCACTCTTGGGTTACGCCGAGATTCAGAAAGACAAATCTGTGGTGCGAAACGTGGACT

qIAA-F	5' GCCTCCTTCCACATTCCC 3'			57℃
qIAA-R	5' AGTCCACGTTTCGCACCA 3'			57.4℃

Design of NbAUX1(NM_001326023.1) qRT-PCR primers

AGGCTACTGCCCTACCACCTGCTAGTGTTATGACCAGGCTCATTTTGATTATGGTGTGGCGAAAACTTATTAGGAACCCGAACACTTACTCCAGCATCATTGGCCTCACTTGGTCATTGGTTTCTTTCAAGTGGAATGTTCAAATGCCTGCGATTATAGCCAAATCGATATCGATCCTTTCTGATGCTGGCCTTGGAATGGCAATGTTTAGTCTTGGTTTGTTCATGGCATTGTCGCCTAGAATCATTGCCTGTGGGAATACAGTTGCTG

qAUX1-F	5' AGGCTACTGCCCTACCAC 3'			52℃
qAUX1-R	5' CAGCAACTGTATTCCCACA 3'			51.8℃

Design of NbCBF(NM_001325227.1) qRT-PCR primers

GGGGAATAAGGAGGAGAAATTCGAATAAGTGGGTTTGTGAAGTAAGAGAACCCAATAAGAAATCAAGAATCTGGCTGGGCACTTTCCCAACTGCAGAAATGGCAGCTCGAGCTCATGACGTGGCGGCCATAGCTCTAAGAGGCCGGTCAGCATGTTTGAACTTTGCTGATTCGGCTTGGAGGTTACCCATCCCGACTTCAG

qCBF-F	5' GGGGAATAAGGAGGAGAA 3'			51℃
qCBF-R	5' CTGAAGTCGGGATGGGTA 3'			53.2℃

Design of NbICE(XM_016610394.1) qRT-PCR primers

CCCATCATTCCATTTGCTACAATTGCCCCAAAATAGTAACACTGGGTTTAGTCCACTGGGGTTTAGTGATGGTTCTGTTAATGAGAATTCTCTGTTTCTCAATAGGTCCAAGTTGTTAAAACCACTTGATAATTTTACTTCAATTGGATCACAACCAACTCTTTTCCAAAAAAGGGCTGCTCTTAGGAAGAACTTAGCTAATAATAGTGGCAGTTTGGGGGATTTGGGAGGTGAAATTGGTGAGAAGGAAGAGGGTGAAATGAATGGAAAGAAGAGGAAGTGGGATAATGG

qICE-F	5' CCCATCATTCCATTTGCT 3'			53.3℃
qICE-R	5' CCATTATCCCACTTCCTCT 3'			51.1℃

Design of NbDREB(NM_001325812.1) qRT-PCR primers

GGCTTGGCACTTTCCCTTCTGCAGAAATGGCGGCTAGAGCGCATGACGTGGCGGCTATTGCATTAAGGGGCCGTTCTGCTTGCTTGAACTTCGCAGACTCTGCTTGGAAGTTGCCTGTTCCTGCTTCCTCCGACGCCAAGAATATTCAGAAGGCGGCTGCCGAGGCCGCCGAGGCTTTCCGGTCATCGGAGGCCGAAAACATGCCGGAATACACAGGAGAAGATTCAAAGGAAGTGAACACTACTCCTGAAAATATGTTTTATATGGATGAGGAGGCGCTATT

qDREB-F	5' GGCTTGGCACTTTCCCTT 3'			57.3℃
qDREB-R	5' AATAGCGCCTCCTCATCC 3'			54.3℃

Design of NbCAT(NM_001325412.1) qRT-PCR primers

AATCATAGCCACGCCACCAAGGATCTCTACGATTCGATTGCTGCTGGAAACTATCCCGAGTGGAAACTTTTTATCCAAATTATGGACACTGAGGATGTAGACAAATTCGACTTTGATCCTCTTGATGTAACCAAGACCTGGCCTGAGGATATCTTGCCATTGATGCCAGTTGGACGATTGGTACTTAACAGGAATATCGATAACTTCTTTGCTGAGAACGAGCAGCTCGCGTTTAACCCTGGCCATATTGTCCCTGGTCTTTACTATTCG

qCAT-F	5' AATCATAGCCACGCCACC 3'			56.2℃
qCAT-R	5' CGAATAGTAAAGACCAGGGA 3'			52.2℃

Design of NbSOD(XM_016581519.1) qRT-PCR primers

GATCTGGGAAGAGGTGGACATGAACTTAGTAAGTCAACTGGGAATGCCGGTGCAAGAGTTGGCTGTGGCGTTATTGGGCTTCAGTCATCTGTTTAGTACTTGTGTTACTCACTTCATCATGTTGCTCCTGTCAAAGTACTCGTTGTAGCTATACTTAACTTTCAGACATTCTTTACCTTTGTATATTATCTTCAGAAATTGGCATCAGTATCAGTTTATCATTAGGGCTG

qSOD-F	5' GATCTGGGAAGAGGTGGA 3'			51.7℃
qSOD-R	5' CAGCCCTAATGATAAACTGA 3'			50.5℃

Section 5.1. The cloning process is not described.

Response: The cloning process has been re-detailed as follows:

The MiniBEST Plant RNA Extraction Kit (Takara Bio, Inc., Japan) was used for total RNA extraction. The cDNA synthesized was created using the PrimeScript First Strand cDNA Synthesis Kit (Takara Bio Inc., Shiga, Japan). Then, PCR was performed to amplify the F. mandshurica cDNA (template) for 40 cycles using 2× Phanta Flash Master Mix (Dye Plus; Vazyme, Nanjing, China) and FmNAC1 primers (Table 1).The PCR program was as follows: predenaturation at 94°C for 5 min; denaturation at 94°C for 30s; annealing at 53°C for 45s; extension at 72°C for 30s; After electrophoresis on 2% agarose gel, the PCR products were purified using the Zymoclea Gel DNA Recovery Kit (ZYMO), cloned into the pCE2 TA/Blunt-Zero Vector (Vazyme), and transformed into Escherichia coli DH5a cells.The sequence of the FmNAC1 gene was submitted to GenBank with the accession number MG269829.1.

Line 436. "Experimental Approach for FmNAC1 Protein Subcellular Localization"

Response: Thank you very much. The modifications have been made.

Lines 437-441. Please add a map of the T-DNA region with restriction sites. Describe what cloning technology, restrictases and Agrobacterium strain were used.

Response: We have made modifications to the construction process of the expression vector, as follows:

The Thermo Scientific^TM Spel single enzyme-cut PBI121-GFP plasmid was incubated at 37°C for 15 minutes and then heat-inactivated at 80°C for 5 minutes. The linearized vector obtained from single enzyme digestion was designed for homologous recombination of the target gene according to the ClonExpress principle. Primers for the target gene were designed as follows: PBNAC1-GFP-F (5’-tacccgggtcgactgactagtATGAGTAGTTTGAGCATGATAGAGGC-3’) and PBNAC1-GFP-R (5’- gcccttgctcaccatactagtTCAATAATGGTTCCACTGCAATCC-3’) . The insert fragment was obtained via high-fidelity enzyme PCR using the subcloned vector of the target gene as a template. Homologous recombination was performed using ClonExpress/Mut Express enzymes (Vazyme, Nanjing, China), and the resulting construct was transformed into Escherichia coli DH5a cells (Figure 11A).

The Thermo Scientific^TM XbaI and KpnI double enzyme-cut vector pROKII-GUS plasmid was incubated at 37°C for 15 minutes and then heat-inactivated at 80°C for 5 minutes. The linearized vector obtained from double enzyme digestion was designed for homologous recombination of the target gene according to the ClonExpress principle. Primers for the target gene were designed as follows: pRNAC1-GUS-F (5’- gagaacacgggggactctagaATGAGTAGTTTGAGCATGATAGAGGC-3’) and pRNAC1-GUS-R (5’- catggtcaagagtccggtaccTCAATAATGGTTCCACTGCAATCC-3’) . The insert fragment was obtained via high-fidelity enzyme PCR using the subcloned vector of the target gene as a template. Homologous recombination was performed using ClonExpress/Mut Express enzymes (Vazyme, Nanjing, China), and the resulting construct was transformed into Escherichia coli DH5a cells (Figure 11B).A transient expression vector for pROKII-FmNAC1-GUS was constructed and transformed into Agrobacterium GV3103 cells.

Figure 11. The vector map of the FmNAC1 gene overexpression construct. A: Vector map of the PBI121-FmNAC1-GFP overexpression construct. B: Vector map of the pROKII-FmNAC1-GUS overexpression construct.

Lines 442-447. Specify the method reference, please.

Response: We have enriched the literature by citing the following references:

Tang M, Xue W, Li X, et al. Mitotically heritable epigenetic modifications of CmMYB6 control anthocyanin biosynthesis in Chrysanthemum.[J]. New Phytologist, 2022: 1075-1088.

Lines 494-499. DNA extraction method and PCR conditions not described.

Response: We have provided explanations for tobacco DNA extraction and PCR validation, with the following modifications:

DNA was extracted from tobacco leaves using the cetyltrimethylammonium bromide (CTAB) method^[65].Extract DNA from positive tobacco plants selected on resistance culture medium, amplify and identify using primers for cloning the FmNAC1 gene and PCR conditions, with recombinant plasmid as positive control.

The reference is: [65] Clarke J D. Cetyltrimethyl Ammonium Bromide (CTAB) DNA Miniprep for Plant DNA Isolation[J]. Cold Spring Harbor Protocols, 2009(3): pdb.prot5177.

Please check carefully for the correctness of the citation of all references. For example:

Lines 501-505. The references do not describe the methods.

Response: We have enriched the literature by adding the following references: Gao S, Li C, Chen X, et al. Basic helix-loop-helix transcription factor PxbHLH02 enhances drought tolerance in Populus (Populus simonii× P. nigra)[J]. Tree Physiology, 2023, 43(1): 185-202.

Lines 372-374. The reference [46] describes a method for the quantification of microgram quantities of protein, not MDA accumulation and relative conductivity during cold stress.

Response: We have modified it to: Huang X, Shi H, Hu Z, et al. ABA is involved in regulation of cold stress response in bermudagrass[J]. Frontiers in plant science, 2017, 8: 1613.

Lines 377-379. The reference [51] describes microRNA profiling, not the sugar content in plants under cold stress.

Response: We have modified it to: Yue C, Cao H L, Wang L, et al. Effects of cold acclimation on sugar metabolism and sugar-related gene expression in tea plant during the winter season[J]. Plant molecular biology, 2015, 88: 591-608.

We tried our best to improve the manuscript and made some changes in the manuscript.  These changes will not influence the content and framework of the paper. And here we did not list the changes but marked in red in revised paper.
    We appreciate for Editors/Reviewers’ warm work earnestly, and hope that the correction will meet with approval.
    Once again, thank you very much for your comments and suggestions.

Author Response File: Author Response.pdf

Round 3

Reviewer 3 Report

Comments and Suggestions for Authors

The article has been improved, but it still has flaws.

Lines 16, 32. "over-expression", "over expression".

Line 38. "for its robust growth and exceptional cold resistance [20] ." Please change the reference to [1].

Lines 54-55. The reference [9] does not contain data on the levels of soluble sugar and soluble protein during cold stress.

Lines 81-83. In the reference [32], there is no information about MaNAC 1.

Lines 99-100. The reference [41] discusses drought tolerance in tomatoes.

Lines 129-130. "The gene sequence was screened from the F. mandshurica transcriptome database and designated FmNAC1." Please add a reference to the database.

Lines 221-241. Please add information about which generation of transgenic tobacco plants were used in the transgene relative expression analysis and experiments (T0, T1, T2, T3 or T4).

Line 388. "Error! Reference source not found"

Line 393. "Error! Reference source not found"

Line 466. "Bioinformatic prediction of protein subcellular localization." Please delete.

Figure 11A. It looks like this is not the right vector for transient expression in tobacco. The size is too small and there is no T-DNA region. Google search for "PBI121" returns a vector with a different size.

Line 480. Please add a reference for MS medium.

Lines 486-487. "1 h, 3 h, 1 h, 6 h, 12 h, 24 h, and 48 h". "1 h" repeated twice.

Line 512. "1 cm2 pieces"

Lines 534-538. Please provide correct references for the described methods.

Lines 541-542. "12 h" repeated twice.

Lines 581-582. Please delete Plantcare reference.

Table 2. Please add GenBank accession numbers for NbTU and FmTU.

Author Response

Dear Editors and Reviewers:

Thank you for your letter and for the reviewers’ comments concerning our manuscript entitled “Function of the NAC1 Gene from Fraxinus mandshurica in Cold Resistance and Growth Promotion in Tobacco” (ID: forests-2956767). Those comments are all valuable and very helpful for revising and improving our paper, as well as the important guiding significance to our researches. We have studied comments carefully and have made correction which we hope meet with approval. Revised portion are marked in red in the paper. The main corrections in the paper and the responds to the reviewer’s comments are as flowing:

Lines 16, 32. "over-expression", "over expression".

Response:It has already been modified in the article to "overexpression".

Line 38. "for its robust growth and exceptional cold resistance [20] ." Please change the reference to [1].

Response:The modifications have been made.

Lines 54-55. The reference [9] does not contain data on the levels of soluble sugar and soluble protein during cold stress.

Response:The reference is as follows:

[9]Liu C T, Wang W, Mao B, et al. Cold stress tolerance in rice: physiological changes, molecular mechanism, and future prospects.[J]. 2018.Mar 20;40(3):171-185.

Lines 81-83. In the reference [32], there is no information about MaNAC 1.

Response:The reference is as follows:

[32] Yin Q, Qin W, Zhou Z, et al. Banana MaNAC1 activates secondary cell wall cellulose biosynthesis to enhance chilling resistance in fruit[J].Plant Biotechnology Journal, 2024(22),.413–426

Lines 99-100. The reference [41] discusses drought tolerance in tomatoes.

Response:The reference is as follows:

Tao W, Xue M M, Ying C, Cui C W, Zhen X X, Zixi L, Li H G, Wen N Z. SlNAC3 suppresses cold tolerance in tomatoes by enhancing ethylene biosynthesis[J]. Plant, Cell & Environment,2024.May (1).

Lines 129-130. "The gene sequence was screened from the F. mandshurica transcriptome database and designated FmNAC1." Please add a reference to the database.

Response:The reference is as follows:

Nan S L,Ya G Z, YU, et al. Characteristics and Expression Analysis of FmTCP15 under Abiotic Stresses and Hormones and Interact with DELLA Protein in Fraxinus mandshurica Rupr.[J]. Forests, 2019, 10(4): 343.

Lines 221-241. Please add information about which generation of transgenic tobacco plants were used in the transgene relative expression analysis and experiments (T0, T1, T2, T3 or T4).

Response:In the article, it has been modified to: "Transgenic tobacco validation was conducted using T0, with subsequent experiments performed using the T2 generation."

Line 388. "Error! Reference source not found"

Response:The error has been corrected.

Line 393. "Error! Reference source not found"

Response:The error has been corrected.

Line 466. "Bioinformatic prediction of protein subcellular localization." Please delete.

Response:It has been deleted.

Response:he PBI121-FmNAC1-GFP was redrawn as follows:

Line 480. Please add a reference for MS medium.

Response:The additional reference is as follows:

Kahrizi D, Ghaheri M, Yari Z, et al. Investigation of different concentrations of MS media effects on gene expression and steviol glycosides accumulation in Stevia rebaudiana Bertoni[J]. Cellular and Molecular Biology, 2018, 64(2): 23-27.

Lines 486-487. "1 h, 3 h, 1 h, 6 h, 12 h, 24 h, and 48 h". "1 h" repeated twice.

Response:It has been deleted.

Line 512. "1 cm2 pieces"

Response:It has been modified to "1 cm² pieces".

Lines 534-538. Please provide correct references for the described methods.

Response:The correct reference has been provided as follows:

[44] Hao, Y.Q.; Lu, G.Q.; Wang, L.H.; Wang, C.L.; Guo, H.M.; Li, Y.F.; Cheng, H.-M. Overexpression of AmDUF1517 enhanced tolerance to salinity, drought, and cold stress in transgenic cotton. [J]. Integr. Agric. 2018, 17, 2204–2214.

[43] Bradrord, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding[J]. Anal. Biochem. 1976, 72, 248–254.

Lines 541-542. "12 h" repeated twice.

Response:It has been deleted.

Lines 581-582. Please delete Plantcare reference.

Response:It has been deleted.

Table 2. Please add GenBank accession numbers for NbTU and FmTU.

Response:The GenBank accession number for NbTU is XM_016640346.1.

The primer design for FmTU utilizes the following sequence, which has not been uploaded to the NCBI database.

Author Response File: Author Response.docx

Article Menu

Function of the NAC1 Gene from Fraxinus mandshurica in Cold Resistance and Growth Promotion in Tobacco

Further Information

Guidelines

MDPI Initiatives

Follow MDPI