Next Article in Journal
Analysis of the Effects of Different Nitrogen Application Levels on the Growth of Castanopsis hystrix from the Perspective of Three-Dimensional Reconstruction
Previous Article in Journal
Bursaphelenchus xylophilus in Pinus sylvestris—The First Report in Europe
Previous Article in Special Issue
Deciphering the Regulatory Mechanism of PmMYB21 in Early Flowering of Prunus mume through Dap-Seq and WGCNA Analysis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 15
Issue 9
10.3390/f15091557
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Cloning of QwMYB108 Gene and Its Response to Drought Stress in Quercus wutaishanica Mayr

by
Xuefei Zhao
1,
Ying Sun
1,2,
Yong Wang
1,
Di Shao
1,
Gang Chen
3,
Yiren Jiang
1,* and
Li Qin
1
1
College of Bioscience and Biotechnology, Shenyang Agricultural University, Shenyang 110866, China
2
College of Life Engineering, Shenyang Institute of Technology, Fushun 113122, China
3
Liaoning Academy of Forestry Sciences, Shenyang 110032, China
*
Author to whom correspondence should be addressed.
Forests 2024, 15(9), 1557; https://doi.org/10.3390/f15091557
Submission received: 24 July 2024 / Revised: 18 August 2024 / Accepted: 28 August 2024 / Published: 4 September 2024
(This article belongs to the Special Issue Abiotic and Biotic Stress Responses in Trees Species)
Browse Figures
Review Reports Versions Notes

Abstract

:
Drought is a significant environmental limiting factor that restricts the growth of Quercus wutaishanica Mayr. The MYB transcription factor plays a wide role in controlling the growth of plants. In this study, the QwMYB108 gene was cloned and the bioinformatics was analyzed, and we examined how QwMYB108 responded to various gradient drought stresses. The results demonstrated that QwMYB108 encoded 275 amino acids using an 828 bp open reading frame. Subcellular localization indicated that the gene was located in the nucleus. Phylogenetic analysis showed that QwMYB108 was close to Q. robur, and that the highest level of expression was found in leaves, which was significantly different from other tissues. The expression of QwMYB108 increased as the stress degree rose when drought stress was present, and there was a significant difference between severe drought stress and other gradient stress. In this study, the function of QwMYB108 in drought stress response was investigated, and the drought response function gene of Q. wutaishanica was further explored to provide a theoretical basis.

1. Introduction

In recent years, abnormal global climate changes have led to rising temperatures and drought episodes. Future agricultural, ecological, and hydrological droughts will be more severe due to insufficient rainfall, which will increase plant stress and mortality [1,2].
Now, it is widely acknowledged that transcription factors such as regulatory genes are major players in plant stress responses, particularly in water stress signaling [3,4,5]. In most eukaryotic plants, cellular-level strategies, which control the related downstream gene expression, could be activated by transcription factor families to cope with abiotic and biotic stress, and the role of different transcription factor families regulating the cis-regulatory element type and distribution patterns involved in the abiotic and biotic stress is maintained in different species [4,6]. Six transcription factor families in total regulate the stress response; the transcription factor families most associated with plant stress resistance are WRKY, bZIP, AP2/EREBP, and MYB [7,8].
The MYB family is the most widespread transcription factor family in higher plants, with numerous and functionally diverse characteristics [9,10]. MYB can be linked to MYB cis-regulatory elements through a DNA-binding domain with one to four incomplete repeats. These components are critical for controlling plant metabolism, growth and development, secondary metabolite production, and responses to various biotic and abiotic stressors [10,11,12]. The first MYB transcription factor in plants, MYBc1, was cloned from Zea mays (abbreviated to Z. mays) [13,14]. MYB transcription factors have since been discovered and examined for many plant species. Using model plants like Arabidopsis thaliana (abbreviated to A. thaliana) and Oryza sativa (abbreviated to O. sativa), the majority of MYB transcription factors have been examined [15]. It was determined that A. thaliana contains fifty-nine MYB-related genes; most of these genes have components linked to low temperature, drought, protection, and stress responses. These genes probably contribute to the growth, development, and environmental adaption of A. thaliana [16]. MYB is involved in many aspects of plant growth and development. Its ability to negatively regulate ABA-induced cell death is one of its roles; this helps to regulate the wound sealing program and avoid excessive cell death [17,18]. Moreover, by encouraging programmed cell death, MYB also functions as a positive regulator in protecting against plant illnesses [19]. In addition to this, MYB has been found to be involved in dark-stressed senescence, where it regulates the process of aging in plants under low-light conditions [20]. Moreover, in conditions of prolonged magnesium deprivation, MYB can control the growth and development of leaves and roots [21]. Under flooding stress, MYB expression levels were up-regulated, indicating that it may play a crucial part in helping plants acclimate to this environment [22].
In a variety of plant species, MYB108 performs a number of roles, such as in immunological defense, stress responses, and plant growth and development. Reduced plant damage and increased plant growth are two important effects of RmMYB108 on A. thaliana’s response to abiotic stress [23], while AgMYB108 regulates Arundina graminifolia hormonal balance during flowering [24]. MYB108 also controls flower sex differentiation and anther dehiscence, and is required for JA-mediated stamen and pollen maturation [19,25,26,27]. In A. thaliana, AtMYB108 and AtMYB24 share overlapping roles in mediating stamen and pollen maturation in response to jasmonate acid [28]. AcMYB108 significantly enhances anthocyanin biosynthesis, playing important roles in cyanidin production in kiwifruit [29,30]. Furthermore, OhMYB108 controls the synthesis of isoflavonoids in Ormosia henryi Prain [31]. PmMYB108 also correlates with Prunus mume stigma color, calyx color, petal color, and bud color [32]. OsMYB108 is required for O. sativa to synthesize lignin and cellulose [33].
Quercus is one of the most diverse species groups in the Fagaceae and is an important component of forests in the Northern Hemisphere [34]. Quercus species have important functions in soil and water conservation, climate regulation, and tussah feeding, all of which have high social, ecological, and economic value [35,36]. Q. wutaishanica Mayr is a type of tree with strong resistance to stress, being light-loving, cold-resistant, cool climate-tolerant, and drought-resistant (Figure 1) [31]. However, the current studies on Q. wutaishanica only investigated its response to abiotic stress by measuring its growth parameters and physiological indicators. There are few reports on the molecular biology of Q. wutaishanica, and only 2585 protein sequences were submitted to the NCBI. So, it is necessary to further explore the response mechanism of Q. wutaishanica to abiotic stress at the molecular biological level. Furthermore, studying the response mechanism of Q. wutaishanica to drought stress is conducive to improving its drought resistance and adaptability to the environment, which is of great significance to improve its application in actual production.
Based on the transcriptome data of Q. wutaishanica in our research group, the MYB108 sequence as a drought-related transcription factor of Q. wutaishanica was obtained. The full-length sequence of the QwMYB108 gene was obtained by gene cloning, and bioinformatics analysis was performed. The expression of QwMYB108 in various tissues and its response to drought stress were examined using real-time fluorescence quantification PCR (qRT-PCR). Q. wutaishanica is drought-tolerant, but its response mechanism to drought stress remains unclear. This study serves as a basis for future investigations into Q. wutaishanica’s mechanism of drought stress response.

2. Materials and Methods

2.1. Materials

In this study, Q. wutaishanica was used as the material provided by the oak germplasm resources nursery of Shenyang Agricultural University (Shenyang, Liaoning, China). The stems, leaves, flowers, and acorn, with consistent growth and no pests or diseases, were frozen in liquid nitrogen and reserved at −80 °C.
The drought stress material was 1-year-old potted Q. wutaishanica seedlings. Soil moisture content was determined by using the drying and weighing method, watering the potted seedlings thoroughly before natural drought, and monitoring soil samples every evening (10~15 cm deep). A soil detector produced by Pressen (Jinan, Shandong, China) was used to determine the water content of the soil. After the soil water content reached the requirements of stress treatment, 2 to 3 leaves with the same position were selected at 8:00 in the morning on the next day, and were frozen in liquid nitrogen and stored in the refrigerator at −80 °C until use. The drought stress treatment experiment was set up with four treatments, namely, control treatment (CK, soil moisture content 80%), low-grade drought stress (LD, soil moisture content 60%), moderate drought stress (MD, soil moisture content 40%), and severe drought stress (SD, soil moisture content 20%), with four pots in each treatment and one seedling planted in each pot. IBM SPSS Statistics was used for analysis of variance.

2.2. Main Reagents

A SteadyPure Plant RNA Extraction Kit and an Evo M-MLV Plus cDNA common reverse transcription kit were purchased from Accurate Biotechnology (Changsha, Hunan, China). A PrimeScriptTM RT reagent Kit with gDNA Eraser quantitative reversal kit and a pMDTM-18T vector cloning kit were purchased from TaKaRa (Dalian, China). Using 2 × Accurate Taq Master Mix and TB Green Premix Ex TaqTMII PCR Enzyme, primer synthesis and sequencing were completed by Sangon Biotech (Shanghai, China).

2.3. RNA Extraction and cDNA Synthesis

Tissue sample material (≤100 mg) was taken and ground with liquid nitrogen. The total RNA was extracted according to the SteadyPure Plant RNA Extraction Kit, the quality and integrity of the extracted RNA were detected using an ultramicrospectrophotometer produced by Thermo Fisher scientific (Guangzhou, China), and reverse transcription of RNA into cDNA using the Evo M-MLV Plus cDNA kit was carried out.

2.4. Cloning and Sequencing of QwMYB108

Obtaining the MYB108 sequence fragment of Q. wutaishanica was based on laboratory transcriptome data, using NCBI online software to search the open reading frame of MYB108. We used Primer5 software to design specific primers, MYB108-F (5′-CAGGTTTGAAGCGAACTGGC-3′) and MYB108-R (5′-ACCACCAAACCCATGCTCAA-3′), and followed the instructions of the reverse transcription kit to synthesize the cDNA. We conducted PCR amplification using the 25 μL reaction system: template cDNA 1 μL, primer MYB108-F and MYB108-R 1 μL, MIX 12.5 μL, and ddH2O 9.5 μL. The PCR reaction procedure used was as follows: 94 °C pre-denaturation for 30 s, 98 °C denaturation for 10 s, 62 °C annealing for 30 s, 72 °C extension for 18 s, amplification for 34 cycles, and 72 °C final extension for 2 min. PCR products were detected by 1% agarose gel electrophoresis. Products with correct strips were recovered using a gel recovery kit produced by Sangon Biotech (Shanghai). The recovered DNA was connected with a pMDTM-18T vector cloning kit, and the white single colony that was successfully connected was selected for extended culture. The bacterial liquid was sent to Sangon Biotech (Shanghai) for sequencing.

2.5. Bioinformatics Analysis of QwMYB108

The NCBI ORF Finder tool was used for the gene open reading frame search and protein amino acid translation. The physical and chemical properties, hydrophobicity, transmembrane region, structural domain, signal peptide, and protein structure were analyzed and predicted using bioinformatics software (Table 1). The molecular evolution analysis was performed using blastp, MEGA 11, and DNAMAN. Firstly, a blastp online comparison was performed to obtain the amino acid sequence information of the QwMYB108 protein from other species with high consistency, multiple sequence alignment was performed on the obtained sequences, and finally, a molecular phylogenetic tree was generated to analyze the phylogenetic relationships.

2.6. The Expression Profile of QwMYB108 of Different Tissues and the Leaves with Different Levels of Drought Stress in Q. wutaishanica

Using EF1α as the reference gene, the expression of QwMYB108 in the stem, leaf, flower, and acorn, and different levels of drought stress were detected by qRT-PCR. IBM SPSS Statistics was used for variance analysis of the obtained data, and GraphPad Prism 8.0.2 was used for plotting. The qRT-PCR primers used in this paper are shown in Table 2.

2.7. Subcellular Localization

According to the target gene sequence, SpeI and BstBI were selected as the restriction sites on the pCAMBIA1302 vector, and the corresponding primers, M-QwMYB108-F and M-QwMYB108-R, were designed (Table 3). According to the target gene sequence, SpeI and BstBI were selected as the restriction sites on the pCAMBIA1302 vector, and the corresponding primers, M-QwMYB108-F and M-QwMYB108-R, were designed (Table 3). The transient expression vector of QwMYB108 was constructed after digestion by a double-enzyme restriction enzyme. An agrobacterium containing the carrier was shaken and cultured to an OD600 of about 0.8. After centrifugation, the OD600 of the bacterial solution was adjusted by suspension to about 0.2. The infective liquid was injected into the outer cell of the tobacco leaf by injection. The position of the QwMYB108-GFP fusion protein in the cells was observed under a confocal laser microscope from Nikon Instruments (Shanghai, China) limited company.

3. Results

3.1. Gene Cloning of QwMYB108

The total RNA from the stem, leaf, flower, and acorn of Q. wutaishanica was extracted. The OD260/OD280 ratio was between 1.8 and 2.0, indicating that the total RNA extracted was of good quality and contamination-free, so the next test could be performed. Sequence alignment was conducted on the local database constructed in the laboratory to find the candidate gene sequence, which was found to be similar to that of the MYB family. By predicting the open reading frame (ORF) of the candidate gene sequence, primers were designed for PCR. The cDNA clone contained an open reading frame (ORF) of 828 bp. The cloned band length was between 750 and 1000 bp, which was the same as the predicted band length of the target gene. The band was bright and clear, and the primer had no dimer tail, which was named QwMYB108 (Figure 2). QwMYB108 encoded a total of 275 amino acids (Figure 3), and the gene sequence was uploaded to NCBI with the GenBank accession number PP236877.

3.2. QwMYB108 Protein Sequence Analysis

Expasy analysis showed that the molecular formula of the QwMYB108 protein was C1354H2094N396O429S15, the relative molecular mass was 31.26 kDa, the theoretical isoelectric point was 5.42, the instability coefficient was 52.03, which belonged to an unstable protein, and the average hydrophobicity was −0.704. Further analysis of the hydrophilic/hydrophobic protein of QwMYB108 using the Prot Scale online tool showed that it was more hydrophilic (negative) than hydrophobic (positive), indicating that QwMYB108 was a hydrophilic protein (Figure 4a). The TMHMM transmembrane structure prediction showed that no transmembrane region of the QwMYB108 protein exists (Figure 4b); ProtComp 9.0 predicted that the QwMYB108 protein was localized in the nucleus. Analysis of the secondary structure of the QwMYB108 protein by SOMPA (Figure 5) showed the highest coil content, 53.09%, followed by α-helix (37.82%), β-turn (4.73%), and extended chain (4.36%). As the three-dimensional structure prediction results show in Figure 6, the QwMYB108 protein had the structural characteristics of helix–angle–helix, which was consistent with the secondary structure prediction results (which was rich in the irregular coil and α-helix). The QwMYB108 protein domain was predicted using CD-Search, the online tool on the NCBI website (Figure 7), and the results showed that the QwMYB108 protein belongs to the PLN03091 superfamily.

3.3. Phylogenetic Analysis of QwMYB108

To analyze the homology of the translated amino acid sequence of Q. wutaishanica QwMYB108 and other species, the results show that QwMYB108 and Q. robur MYB108 (XP_050266125.1), Q. lobata MYB108 (XP_030948070.1), and Q. suber MYB108 (XP_023917139.1) can be clustered into one group, showing a close relationship. Among them, the closest relative is Q. robur MYB108 (XP_050266125.1) (Figure 8 and Figure 9).

3.4. The Tissue Expression Profile of QwMYB108

RNA was extracted from the stems, leaves, flowers, and acorns of Q. wutaishanica and reverse-transcribed into cDNA. The tissue expression profile of the oak is shown in Figure 10. It can be seen that the expression of this gene was the highest in leaves, which was observably different from other tissues (p < 0.05). Therefore, the leaves with higher expression were selected for subsequent experiments.

3.5. QwMYB108 Expression under Drought Stress

The expression of Q. wutaishanica leaves with different gradient stress treatments was quantified using qRT-PCR, and we found that QwMYB108 expression increased with the stress degree and was the highest during severe dry stress, which was significantly different from the other three gradients (Figure 11).

3.6. Subcellular Localization of QwMYB108

The localization of the QwMYB108 protein to the nucleus was predicted using ProtComp software-Version 6 software. In order to verify that the protein was negatively located in the plant nucleus, we further determined the subcellular localization of QwMYB108 via the transient expression of a translation fusion with GFP in tobacco leaves. The results showed that the expression of QwMYB108 was localized only in the nucleus (Figure 12).

4. Discussion

In nature, the growth and development of plants are inevitably affected by drought stress. Studying the response of plants to drought stress can improve the drought resistance of plants and can be applied to practical production to improve crop yield [37]. At present, the MYB transcription factors involved in drought stress have been thoroughly studied in A. thaliana, O. sativa, and other plants [15]. However, research on the mechanism of MYB transcription factor involvement in drought stress in Q. wutaishanica is limited. In order to further study the drought resistance mechanism of Q. wutaishanica, we cloned and identified QwMYB108 involved in drought stress based on transcriptome data under drought stress. This study lays the foundation for the study of the drought stress response mechanism of Q. wutaishanica.
The MYB transcription factor plays a wide role in plant growth and development, secondary metabolism, and stress response. Fifty-nine MYB-related genes have been identified in A. thaliana, most of which are involved in growth, development, and environmental adaptation, and MYB can effectively activate downstream stress response genes [16,38,39]. The expression levels of AtMYB2, AtMYB44, AtMYB41, and AtMYB15 were changed under drought and salt stress [11]. PtsrMYB was cloned from Poncirus trifoliata L., and its expression was found to be up-regulated after drought treatment [40]. The results of this study are consistent with those of the above studies. Under drought stress, the expression of QwMYB108 increases with the increase in the drought stress degree. The overexpression of MYB transcription factors from other plants in A. thaliana has also been shown to be involved in plant response to drought stress. O. sativa OsMYBR57 can interact with HB22 under drought stress to activate the transcription factor bZIP and improve drought tolerance [41]; QsMYB-R1 can activate downstream stress-related genes SOD, CAT, GPX, LEA, and ABRE to improve tolerance to drought stress [42]. The overexpression of MdSIMYB1 in apples can improve the tolerance of plants to drought stress by stimulating stress response genes [43]. Under drought stress, the overexpression of GhMYB4 can up-regulate the expression of stress response genes AtRD29A, AtCOR414, AtLTP4, and AtPUB22 [44]. Drought-induced LpMYB1 in Lablab purpureus was overexpressed in A. thaliana, and the tolerance of A. thaliana to drought stress was significantly enhanced [45]. The overexpression of IbMYB330 enhanced the tolerance of transgenic tobacco to drought stress in Ipomoea batatas [46]. In addition, MYB can improve tolerance to drought by enhancing antioxidant defense system activity. After overexpression of VyMYB24 in Vitis yanshanesis and ZmMYB3R in Z. mays in tobacco and Arabidopsis, the expression levels of SOD, POD, and CAT in the transgenic plants were significantly up-regulated, and the plants’ tolerance to drought was enhanced [47,48]. Cajanus cajan CcMYB107 was significantly up-regulated under drought stress, and the antioxidant enzyme activity of the overexpressed CcMYB107 strain was significantly higher than that of the wild type; the accumulation of peroxide decreased, and the drought resistance was significantly enhanced [49]. These results further indicate that the MYB transcription factor is involved in drought stress response.
In summary, the MYB transcription factor, as a transcriptional activator, can respond to drought stress in many ways. However, the drought response mechanism of MYB in Q. wutaishanica is still unclear, so further investigation of the function of QwMYB108 will help us to understand the response mechanism of this gene under stress.

5. Conclusions

The QwMYB108 open reading frame is 828 bp, encodes 275 amino acids, and is localized in the nucleus, with the highest expression in leaves, which was significantly different from other tissues; with the increase in drought stress, the expression of this gene increased significantly, and there was a significant difference between severe drought stress and other gradient stress. This study confirmed the drought resistance function of QwMYB108, which provides potential genetic resources for Q. wutaishanica drought resistance. The specific molecular mechanism of drought resistance still needs further study.

Author Contributions

Conceived and designed the experiments: X.Z., Y.J. and L.Q. Performed the experiments: X.Z., Y.S. and Y.W. Analyzed the data: Y.S., Y.J. and D.S. Contributed reagents/materials/analysis tools: X.Z., G.C. and L.Q. Wrote the paper: X.Z. and Y.J. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grants from the National Modern Agriculture Industry Technology System Construction Project (Silkworm and Mulberry) (No. CARS-18-ZJ0202) and Discipline Construction Plan Project of Liaoning Academy of Agricultural Sciences (No. 2022DD217036). The funder had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Data Availability Statement

The datasets generated and/or analyzed during the current study are not publicly available due to involving follow-up experiments, but are available from the corresponding author on reasonable request.

Conflicts of Interest

The authors have declared that no competing interests exist.

References

  1. Jump, A.S.; Ruiz-Benito, P.; Greenwood, S.; Allen, C.D.; Kitzberger, T.; Fensham, R.; Martínez-Vilalta, J.; Lloret, F. Structural overshoot of tree growth with climate variability and the global spectrum of drought-induced forest dieback. Glob. Chang. Biol. 2017, 23, 3742–3757. [Google Scholar] [CrossRef] [PubMed]
  2. Vicente-Serrano, S.M.; Peña-Angulo, D.; Beguería, S.; Domínguez-Castro, F.; Tomás-Burguera, M.; Noguera, I.; Gimeno-Sotelo, L.; El Kenawy, A. Global drought trends and future projections. Philos. Trans. A Math. Phys. Eng. Sci. 2022, 380, 20210285. [Google Scholar] [CrossRef]
  3. Baldoni, E.; Genga, A.; Cominelli, E. Plant MYB Transcription Factors: Their Role in Drought Response Mechanisms. Int. J. Mol. Sci. 2015, 16, 15811–15851. [Google Scholar] [CrossRef] [PubMed]
  4. Abdullah-Zawawi, M.R.; Ahmad-Nizammuddin, N.F.; Govender, N.; Harun, S.; Mohd-Assaad, N.; Mohamed-Hussein, Z.A. Comparative genome-wide analysis of WRKY, MADS-box and MYB transcription factor families in Arabidopsis and rice. Sci. Rep. 2021, 11, 19678. [Google Scholar] [CrossRef] [PubMed]
  5. Du, H.; Zhang, L.; Liu, L.; Tang, X.F.; Yang, W.J.; Wu, Y.M.; Huang, Y.B.; Tang, Y.X. Biochemical and molecular characterization of plant MYB transcription factor family. Biochemistry 2009, 74, 1–11. [Google Scholar] [CrossRef]
  6. Bemer, M.; van Dijk, A.D.J.; Immink, R.G.H.; Angenent, G.C. Cross-Family Transcription Factor Interactions: An Additional Layer of Gene Regulation. Trends Plant Sci. 2017, 22, 66–80. [Google Scholar] [CrossRef] [PubMed]
  7. Mao, K.; Dong, Q.; Li, C.; Liu, C.; Ma, F. Genome Wide Identification and Characterization of Apple bHLH Transcription Factors and Expression Analysis in Response to Drought and Salt Stress. Front. Plant Sci. 2017, 8, 480. [Google Scholar] [CrossRef] [PubMed]
  8. Jolma, A.; Yin, Y.; Nitta, K.R.; Dave, K.; Popov, A.; Taipale, M.; Enge, M.; Kivioja, T.; Morgunova, E.; Taipale, J. DNA-dependent formation of transcription factor pairs alters their binding specificity. Nature 2015, 527, 384–388. [Google Scholar] [CrossRef]
  9. Uimari, A.; Strommer, J. Myb26: A MYB-like protein of pea flowers with affinity for promoters of phenylpropanoid genes. Plant J. 1997, 12, 1273–1284. [Google Scholar] [CrossRef]
  10. Li, C.; Ng, C.; Fan, L.M. MYB transcription factors, active players in abiotic stress signaling. Environ. Exp. Bot. 2015, 114, 80–91. [Google Scholar] [CrossRef]
  11. Dubos, C.; Stracke, R.; Grotewold, E.; Weisshaar, B.; Martin, C.; Lepiniec, L. MYB transcription factors in Arabidopsis. Trends Plant Sci. 2010, 15, 573–581. [Google Scholar] [CrossRef] [PubMed]
  12. Wang, X.; Niu, Y.; Zheng, Y. Multiple Functions of MYB Transcription Factors in Abiotic Stress Responses. Int. J. Mol. Sci. 2021, 22, 6125. [Google Scholar] [CrossRef]
  13. Paz-Ares, J.; Ghosal, D.; Wienand, U.; Peterson, P.A.; Saedler, H. The regulatory c1 locus of Zea mays encodes a protein with homology to myb proto-oncogene products and with structural similarities to transcriptional activators. EMBO J. 1987, 6, 3553–3558. [Google Scholar] [CrossRef] [PubMed]
  14. Frampton, J. Myb transcription factors: Their role in growth, differentiation and disease. J. Proteins Cell Regul. 2004, 2, 1–2. [Google Scholar]
  15. Thakur, S.; Vasudev, P.G. MYB transcription factors and their role in Medicinal plants. Mol. Biol. Rep. 2022, 49, 10995–11008. [Google Scholar] [CrossRef] [PubMed]
  16. Wu, G.; Cao, A.; Wen, Y.; Bao, W.; She, F.; Wu, W.; Zheng, S.; Yang, N. Characteristics and Functions of MYB (v-Myb avivan myoblastsis virus oncogene homolog)-Related Genes in Arabidopsis thaliana. Genes 2023, 14, 2026. [Google Scholar] [CrossRef]
  17. Cui, F.; Brosché, M.; Sipari, N.; Tang, S.; Overmyer, K. Regulation of ABA dependent wound induced spreading cell death by MYB108. New Phytol. 2013, 200, 634–640. [Google Scholar] [CrossRef]
  18. Cui, F.; Li, X.; Wu, W.; Luo, W.; Wu, Y.; Brosché, M.; Overmyer, K. Ectopic expression of BOTRYTIS SUSCEPTIBLE1 reveals its function as a positive regulator of wound-induced cell death and plant susceptibility to Botrytis. Plant Cell 2022, 34, 4105–4116. [Google Scholar] [CrossRef]
  19. Cheng, H.Q.; Han, L.B.; Yang, C.L.; Wu, X.M.; Zhong, N.Q.; Wu, J.H.; Wang, F.X.; Wang, H.Y.; Xia, G.X. The cotton MYB108 forms a positive feedback regulation loop with CML11 and participates in the defense response against Verticillium dahliae infection. J. Exp. Bot. 2016, 67, 1935–1950. [Google Scholar] [CrossRef]
  20. Chou, M.L.; Liao, W.Y.; Wei, W.C.; Li, A.Y.; Chu, C.Y.; Wu, C.L.; Liu, C.L.; Fu, T.H.; Lin, L.F. The Direct Involvement of Dark-Induced Tic55 Protein in Chlorophyll Catabolism and Its Indirect Role in the MYB108-NAC Signaling Pathway during Leaf Senescence in Arabidopsis thaliana. Int. J. Mol. Sci. 2018, 19, 1854. [Google Scholar] [CrossRef]
  21. Yang, Y.; Li, X.; Kan, B.; He, H.; Li, T.; Ding, Y.; Du, P.; Lai, W.; Hu, H.; Huang, J. Transcriptome analysis reveals MYB and WRKY transcription factors involved in banana (Musa paradisiaca AA) magnesium deficiency. Planta 2021, 254, 115. [Google Scholar] [CrossRef] [PubMed]
  22. Liu, S.; Yang, S.; Liu, H.; Hu, Q.; Liu, X.; Wang, J.; Wang, J.; Xin, W.; Chen, Q. Physiological and transcriptomic analysis of the mangrove species Kandelia obovata in response to flooding stress. Mar. Pollut. Bull. 2023, 196, 115598. [Google Scholar] [CrossRef] [PubMed]
  23. Dong, J.; Cao, L.; Zhang, X.; Zhang, W.; Yang, T.; Zhang, J.; Che, D. An R2R3-MYB Transcription Factor RmMYB108 Responds to Chilling Stress of Rosa multiflora and Conferred Cold Tolerance of Arabidopsis. Front. Plant Sci. 2021, 12, 696919. [Google Scholar] [CrossRef]
  24. Ahmad, S.; Lu, C.; Wu, J.; Wei, Y.; Gao, J.; Jin, J.; Zheng, C.; Zhu, G.; Yang, F. Transcriptional Cascade in the Regulation of Flowering in the Bamboo Orchid Arundina graminifolia. Biomolecules 2021, 11, 771. [Google Scholar] [CrossRef] [PubMed]
  25. Hu, X.; Liao, Z.; Zhang, B.; Yue, J.; Wang, Z.; Jie, X.; Liu, J. Transcriptome sequencing and screening of genes related to sex determination of Trichosanthes kirilowii Maxim. PLoS ONE 2020, 15, e0239230. [Google Scholar] [CrossRef]
  26. Ni, J.; Shah, F.A.; Liu, W.; Wang, Q.; Wang, D.; Zhao, W.; Lu, W.; Huang, S.; Fu, S.; Wu, L. Comparative transcriptome analysis reveals the regulatory networks of cytokinin in promoting the floral feminization in the oil plant Sapium sebiferum. BMC Plant Biol. 2018, 18, 96. [Google Scholar] [CrossRef]
  27. Xu, X.F.; Wang, B.; Feng, Y.F.; Xue, J.S.; Qian, X.X.; Liu, S.Q.; Zhou, J.; Yu, Y.H.; Yang, N.Y.; Xu, P.; et al. AUXIN RESPONSE FACTOR17 Directly Regulates MYB108 for Anther Dehiscence. Plant Physiol. 2019, 181, 645–655. [Google Scholar] [CrossRef]
  28. Mandaokar, A.; Browse, J. MYB108 acts together with MYB24 to regulate jasmonate-mediated stamen maturation in Arabidopsis. Plant Physiol. 2009, 149, 851–862. [Google Scholar] [CrossRef]
  29. Khan, I.A.; Cao, K.; Guo, J.; Li, Y.; Wang, Q.; Yang, X.; Wu, J.; Fang, W.; Wang, L. Identification of key gene networks controlling anthocyanin biosynthesis in peach flower. Plant Sci. 2022, 316, 111151. [Google Scholar] [CrossRef]
  30. Ye, L.; Bai, F.; Zhang, L.; Luo, M.; Gao, L.; Wang, Z.; Peng, J.; Chen, Q.; Luo, X. Transcriptome and metabolome analyses of anthocyanin biosynthesis in post-harvest fruits of a full red-type kiwifruit (Actinidia arguta) ‘Jinhongguan’. Front. Plant Sci. 2023, 14, 1280970. [Google Scholar] [CrossRef]
  31. Wang, J.; Li, L.; Wang, Z.; Feng, A.; Li, H.; Qaseem, M.F.; Liu, L.; Deng, X.; Wu, A.M. Integrative analysis of the metabolome and transcriptome reveals the molecular regulatory mechanism of isoflavonoid biosynthesis in Ormosia henryi Prain. Int. J. Biol. Macromol. 2023, 246, 125601. [Google Scholar] [CrossRef]
  32. Zhang, Q.; Zhang, H.; Sun, L.; Fan, G.; Ye, M.; Jiang, L.; Liu, X.; Ma, K.; Shi, C.; Bao, F.; et al. The genetic architecture of floral traits in the woody plant Prunus mume. Nat. Commun. 2018, 9, 1702. [Google Scholar] [CrossRef] [PubMed]
  33. Lv, S.; Lin, Z.; Shen, J.; Luo, L.; Xu, Q.; Li, L.; Gui, J. OsTCP19 coordinates inhibition of lignin biosynthesis and promotion of cellulose biosynthesis to modify lodging resistance in rice. J. Exp. Bot. 2024, 75, 123–136. [Google Scholar] [CrossRef] [PubMed]
  34. Torre, S.; Tattini, M.; Brunetti, C.; Fineschi, S.; Fini, A.; Ferrini, F.; Sebastiani, F. RNA-seq analysis of Quercus pubescens Leaves: De novo transcriptome assembly, annotation and functional markers development. PLoS ONE 2014, 9, e112487. [Google Scholar] [CrossRef]
  35. Wang, Y.; Xu, C.; Wang, Q.; Jiang, Y.; Qin, L. Germplasm Resources of Oaks (Quercus L.) in China: Utilization and Prospects. Biology 2022, 12, 76. [Google Scholar] [CrossRef] [PubMed]
  36. Wang, G.B.; Wang, Y.; Qin, L. Transcriptome sequencing and gene function annotation of Quercus mongolica leaves. Sci. Seric. 2020, 46, 560–565. [Google Scholar]
  37. Lu, H.D.; Xue, J.Q.; Guo, D.W. Efficacy of planting date adjustment as a cultivation strategy to cope with drought stress and increase rainfed maize yield and water-use efficiency. J. Agric. Water Manag. 2016, 179, 227–235. [Google Scholar] [CrossRef]
  38. Abe, H.; Urao, T.; Ito, T.; Seki, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell 2003, 15, 63–78. [Google Scholar] [CrossRef]
  39. Krizek, B.A.; Meyerowitz, E.M. The Arabidopsis homeotic genes APETALA3 and PISTILLATA are sufficient to provide the B class organ identity function. Development 1996, 122, 11–22. [Google Scholar] [CrossRef]
  40. Sun, P.; Zhu, X.; Huang, X.; Liu, J.H. Overexpression of a stress-responsive MYB transcription factor of Poncirus trifoliata confers enhanced dehydration tolerance and increases polyamine biosynthesis. Plant Physiol. Biochem. 2014, 78, 71–79. [Google Scholar] [CrossRef]
  41. Yang, L.; Chen, Y.; Xu, L.; Wang, J.; Qi, H.; Guo, J.; Zhang, L.; Shen, J.; Wang, H.; Zhang, F.; et al. The OsFTIP6-OsHB22-OsMYBR57 module regulates drought response in rice. Mol. Plant 2022, 15, 1227–1242. [Google Scholar] [CrossRef] [PubMed]
  42. Tiwari, P.; Indoliya, Y.; Chauhan, A.S.; Pande, V.; Chakrabarty, D. Overexpression of rice R1-type MYB transcription factor confers different abiotic stress tolerance in transgenic Arabidopsis. Ecotoxicol. Environ. Saf. 2020, 206, 111361. [Google Scholar] [CrossRef] [PubMed]
  43. Wang, R.K.; Cao, Z.H.; Hao, Y.J. Overexpression of a R2R3 MYB gene MdSIMYB1 increases tolerance to multiple stresses in transgenic tobacco and apples. Physiol. Plant. 2014, 150, 76–87. [Google Scholar] [CrossRef]
  44. Yu, Y.T.; Wu, Z.; Lu, K.; Bi, C.; Liang, S.; Wang, X.F.; Zhang, D.P. Overexpression of the MYB37 transcription factor enhances abscisic acid sensitivity, and improves both drought tolerance and seed productivity in Arabidopsis thaliana. Plant Mol. Biol. 2016, 90, 267–279. [Google Scholar] [CrossRef]
  45. Yao, L.; Jiang, Y.; Lu, X.; Wang, B.; Zhou, P.; Wu, T. A R2R3-MYB transcription factor from Lablab purpureus induced by drought increases tolerance to abiotic stress in Arabidopsis. Mol. Biol. Rep. 2016, 43, 1089–1100. [Google Scholar] [CrossRef] [PubMed]
  46. Wang, C.; Lei, J.; Jin, X.J.; Chai, S.S.; Jiao, C.H.; Yang, X.S.; Wang, L.J. A Sweet Potato MYB Transcription Factor IbMYB330 Enhances Tolerance to Drought and Salt Stress in Transgenic Tobacco. Genes 2024, 15, 693. [Google Scholar] [CrossRef]
  47. Zhu, Z.; Quan, R.; Chen, G.; Yu, G.; Li, X.; Han, Z.; Xu, W.; Li, G.; Shi, J.; Li, B. An R2R3-MYB transcription factor VyMYB24, isolated from wild grape Vitis yanshanesis J. X. Chen., regulates the plant development and confers the tolerance to drought. Front. Plant Sci. 2022, 13, 966641. [Google Scholar] [CrossRef]
  48. Wu, J.; Jiang, Y.; Liang, Y.; Chen, L.; Chen, W.; Cheng, B. Expression of the maize MYB transcription factor ZmMYB3R enhances drought and salt stress tolerance in transgenic plants. Plant Physiol. Biochem. 2019, 137, 179–188. [Google Scholar] [CrossRef]
  49. Li, H.; Yang, J.; Ma, R.; An, X.; Pan, F.; Zhang, S.; Fu, Y. Genome-wide identification and expression analysis of MYB gene family in Cajanus cajan and CcMYB107 improves plant drought tolerance. Physiol. Plant. 2023, 175, e13954. [Google Scholar] [CrossRef]
Forests 15 01557 g001
Figure 1. Morphological characteristics of Q. wutaishanica Mayr.
Figure 1. Morphological characteristics of Q. wutaishanica Mayr.
Forests 15 01557 g001
Forests 15 01557 g002
Figure 2. The amplification products of QwMYB108 cDNA. M, DNA marker 2000 (DL 2000).
Figure 2. The amplification products of QwMYB108 cDNA. M, DNA marker 2000 (DL 2000).
Forests 15 01557 g002
Forests 15 01557 g003
Figure 3. Nucleotide sequences and deduced amino acid sequences for QwMYB108 from Q. wutaishanica. “*” stands for termination codon.
Figure 3. Nucleotide sequences and deduced amino acid sequences for QwMYB108 from Q. wutaishanica. “*” stands for termination codon.
Forests 15 01557 g003
Forests 15 01557 g004
Figure 4. Analysis of hydrophilicity/hydrophobicity and transmembrane structure of QwMYB108 protein. (a) Hydrophilic/hydrophobic analysis. (b) Transmembrane structure analysis.
Figure 4. Analysis of hydrophilicity/hydrophobicity and transmembrane structure of QwMYB108 protein. (a) Hydrophilic/hydrophobic analysis. (b) Transmembrane structure analysis.
Forests 15 01557 g004
Forests 15 01557 g005
Figure 5. Prediction of QwMYB108 protein secondary structure.
Figure 5. Prediction of QwMYB108 protein secondary structure.
Forests 15 01557 g005
Forests 15 01557 g006
Figure 6. The prediction of the tertiary structure of the QwMYB108 protein.
Figure 6. The prediction of the tertiary structure of the QwMYB108 protein.
Forests 15 01557 g006
Forests 15 01557 g007
Figure 7. Domain analysis of QwMYB108 protein.
Figure 7. Domain analysis of QwMYB108 protein.
Forests 15 01557 g007
Forests 15 01557 g008
Figure 8. Multi-sequence alignment of MYB amino acids of different species. Conserved domains are shown in red lines. Note: As: Arabidopsis thaliana; Cc: Citrus × clementina; Cs: Citrus sinensis; Eg: Eucalyptus grandis; Hb: Hevea brasiliensis; Jr: Juglans regia; Md: Malus domestica; Pb: Pyrus × bretschneideri; Pd: Prunus dulcis; Pt: Populus trichocarpa; Qs: Quercus suber; Qr: Quercus robur; Ql: Quercus lobata.
Figure 8. Multi-sequence alignment of MYB amino acids of different species. Conserved domains are shown in red lines. Note: As: Arabidopsis thaliana; Cc: Citrus × clementina; Cs: Citrus sinensis; Eg: Eucalyptus grandis; Hb: Hevea brasiliensis; Jr: Juglans regia; Md: Malus domestica; Pb: Pyrus × bretschneideri; Pd: Prunus dulcis; Pt: Populus trichocarpa; Qs: Quercus suber; Qr: Quercus robur; Ql: Quercus lobata.
Forests 15 01557 g008
Forests 15 01557 g009
Figure 9. Phylogenetic analysis of MYB in different species based on NJ algorithm. The red marker is the QwMYB108 protein. Note: As: Arabidopsis thaliana; Cc: Citrus × clementina; Cs: Citrus sinensis; Eg: Eucalyptus grandis; Hb: Hevea brasiliensis; Jr: Juglans regia; Md: Malus domestica; Pb: Pyrus × bretschneideri; Pd: Prunus dulcis; Pt: Populus trichocarpa; Qs: Quercus suber; Qr: Quercus robur; Ql: Quercus lobata.
Figure 9. Phylogenetic analysis of MYB in different species based on NJ algorithm. The red marker is the QwMYB108 protein. Note: As: Arabidopsis thaliana; Cc: Citrus × clementina; Cs: Citrus sinensis; Eg: Eucalyptus grandis; Hb: Hevea brasiliensis; Jr: Juglans regia; Md: Malus domestica; Pb: Pyrus × bretschneideri; Pd: Prunus dulcis; Pt: Populus trichocarpa; Qs: Quercus suber; Qr: Quercus robur; Ql: Quercus lobata.
Forests 15 01557 g009
Forests 15 01557 g010
Figure 10. Expression analysis of QwMYB108 in different tissues of Q. wutaishanica. Note: the same letters are not significantly different at p < 0.05 according to Duncan’s multiple range test.
Figure 10. Expression analysis of QwMYB108 in different tissues of Q. wutaishanica. Note: the same letters are not significantly different at p < 0.05 according to Duncan’s multiple range test.
Forests 15 01557 g010
Forests 15 01557 g011
Figure 11. Expression analysis of QwMYB108 under different gradient drought stress. Note: CK, control treatment; LD, mild drought stress; MD, moderate drought stress; SD, severe drought stress. Note: the same letters are not significantly different at p < 0.05 according to Duncan’s multiple range test.
Figure 11. Expression analysis of QwMYB108 under different gradient drought stress. Note: CK, control treatment; LD, mild drought stress; MD, moderate drought stress; SD, severe drought stress. Note: the same letters are not significantly different at p < 0.05 according to Duncan’s multiple range test.
Forests 15 01557 g011
Forests 15 01557 g012
Figure 12. Subcellular localization of QwMYB108. Bar = 100 µM.
Figure 12. Subcellular localization of QwMYB108. Bar = 100 µM.
Forests 15 01557 g012
Table 1. Bioinformatics analysis tools.
Table 1. Bioinformatics analysis tools.
Bioinformatics AnalysisToolsWebsite
Open reading frame (ORF) and amino acid sequenceNCBIhttps://www.ncbi.nlm.nih.gov/orffinder/ (accessed on 23 October 2023)
Genes encode the physicochemical properties of proteinsExpasyhttps://web.expasy.org/protparam/ (accessed on 23 October 2023)
The hydrophobic and hydrophilicProtScalehttps://web.expasy.org/protscale/ (accessed on 23 October 2023)
DomainNCBIhttps://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi (accessed on 23 October 2023)
Transmembrane predictionTMHMMhttp://www.cbs.dtu.dk/services/TMHMM/ (accessed on 23 October 2023)
Subcellular locationProtComphttp://www.softberry.com/berry.phtml?topic=index&group=programs&subgroup=proloc (accessed on 23 October 2023)
Protein structureSOPMAhttps://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html (accessed on 23 October 2023)
3D structure of proteinSWISS-MODELhttps://swissmodel.expasy.org/interactive (accessed on 23 October 2023)
Table 2. qRT-PCR primers’ sequence.
Table 2. qRT-PCR primers’ sequence.
PrimersSequence (5′→3′)
EF1α -FCAGGTTTGAAGCGAACTGGC
EF1α -RACCACCAAACCCATGCTCAA
RT-QwMYB108-FCCGACCCAATTGACCCGTAT
RT-QwMYB108-RACCACCAAACCCATGCTCAA
Table 3. Primers’ sequence.
Table 3. Primers’ sequence.
PrimersSequence (5′→3′)
M-QwMYB108-FGGACTAGTATGGATTTTCACGTGAGAGC
M-QwMYB108-RCGTTCGAATCAGATCTCATCGCAAAGCT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhao, X.; Sun, Y.; Wang, Y.; Shao, D.; Chen, G.; Jiang, Y.; Qin, L. Molecular Cloning of QwMYB108 Gene and Its Response to Drought Stress in Quercus wutaishanica Mayr. Forests 2024, 15, 1557. https://doi.org/10.3390/f15091557

AMA Style

Zhao X, Sun Y, Wang Y, Shao D, Chen G, Jiang Y, Qin L. Molecular Cloning of QwMYB108 Gene and Its Response to Drought Stress in Quercus wutaishanica Mayr. Forests. 2024; 15(9):1557. https://doi.org/10.3390/f15091557

Chicago/Turabian Style

Zhao, Xuefei, Ying Sun, Yong Wang, Di Shao, Gang Chen, Yiren Jiang, and Li Qin. 2024. "Molecular Cloning of QwMYB108 Gene and Its Response to Drought Stress in Quercus wutaishanica Mayr" Forests 15, no. 9: 1557. https://doi.org/10.3390/f15091557

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop