Next Article in Journal
Natural Bioactive Compounds from Orchard Biomass Waste and Cosmetic Applications
Previous Article in Journal
Fitting and Evaluating Taper Functions to Predict Upper Stem Diameter of Planted Teak (Tectona grandis L.f.) in Eastern and Central Regions of Nepal
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Patterns and Diversity of Postintroduction of Metasequoia glyptostroboides (Hu and W. C. Cheng) in Ningbo Forest Farm, China

1
Ningbo Forest Farm, Ningbo 315440, China
2
Zhejiang Academy of Forestry, Hangzhou 310023, China
*
Author to whom correspondence should be addressed.
Forests 2025, 16(1), 78; https://doi.org/10.3390/f16010078
Submission received: 9 December 2024 / Revised: 25 December 2024 / Accepted: 3 January 2025 / Published: 5 January 2025
(This article belongs to the Special Issue Tree Breeding: Genetic Diversity, Differentiation and Conservation)

Abstract

The genetic characteristics of postintroduced Metasequoia glyptostroboides from three forest areas in Ningbo Forest Farm, China, were analyzed by using polymorphic SSR markers. High genetic diversity at the species level (Na = 5.306, Ne = 3.411, I = 1.269, Ho = 0.604 and He = 0.640) was detected. No significant difference in diversity was observed between mother trees and seedlings, indicating random mating or the absence of a founder effect. The group with the highest diversity was Shangliang seedlings (SLGS). Inbreeding was detected in two groups (SLGM and LXS), possibly due to biased sampling and selective pressures on these groups. AMOVA disclosed most genetic variation within groups (88%), with moderate differentiation (Fst = 0.117) and some gene flow (Nm = 1.887) between groups. Population structure analysis classified the six groups into distinct units, highlighting the need for tailored conservation strategies. These findings inform conservation and management practices for the introduced M. glyptostroboides.

1. Introduction

Metasequoia glyptostroboides (Hu and W. C. Cheng), commonly known as dawn redwood, is a rare and relict conifer plant that is classified as a first-class protected species in China. It is listed as endangered (EN) by the International Union for Conservation of Nature (IUCN) (https://www.iucnredlist.org/species/32317/2814244 accessed on 1 December 2024). M. glyptostroboides is often referred to as a ’living fossil’ because its leaves, wood, and pollen fossils contain valuable information about ancient ecological and climate information and the evolutionary history of gymnosperms. This information is significant for the study of ancient plants, climates, geography, and geology. Scholars have extensively researched M. glyptostroboides and focused on paleoclimate [1], geographical distribution [2], reproductive characteristics [3], and genomic evolution [4,5]. Scholars have revealed the biological characteristics of M. glyptostroboides, including genetic diversity and adaptability, using molecular biology and ecological techniques [6,7]. Since its rediscovery in the 1940s, M. glyptostroboides has been successfully introduced to various provinces and cities in the middle and lower reaches of the Yangtze River in China. Its rapid growth via artificial cultivation has made it a popular tree for afforestation, protective forests, and landscape planting in many temperate regions globally [8]. For example, more than 2535 of these trees from over 50 countries across all continents have been documented, with the tallest tree reaching a height of 38 m and the widest measuring 6.2 m in diameter at breast height (DBH) [9]. Therefore, in terms of population size and spatial distribution, M. glyptostroboides is one of the most successfully conserved endangered tree species. Since the expansion of planted M. glyptostroboides beyond its historical distribution range, the comprehensive elucidation of its genetic structure has not been performed. Specifically, there is a deficiency in comparative studies between the seedlings and parent trees after introduction. Therefore, it is crucial to assess the genetic resources of postintroduction M. glyptostroboides.
Founded in the 1950s, the Ningbo Forest Farm in eastern China played a crucial role in reforesting barren mountains by introducing a substantial number of Cunninghamia lanceolata ((Lamb.) Hook.) and Pseudolarix amabilis ((J. Nelson) Rehder) seedlings from across the country. Similarly, M. glyptostroboides underwent extensive and repeated cultivation during this period. Despite the flourishing presence of M. glyptostroboides in this region, the assessment and documentation of its resources remain unexplored. Previous studies have shown very few regenerated M. glyptostroboides seedlings in natural and restored populations, and the obstacles and mechanisms responsible for the difficulties in population regeneration have not been fully resolved [3]. Notably, during routine patrolling at the forest farm, we observed the phenomenon of natural trees sprouting around the introduced M. glyptostroboides mother trees in different forest areas.
Assessing genetic diversity within species is essential for revealing their survival potential and facilitates the development of appropriate conservation and management strategies. Therefore, it is fundamental to understand the differences in the extent of genetic diversity variation among young seedlings in different forest areas and whether they have diverged from their mother trees. Simple sequence repeat (SSR) technology, also known as the use of microsatellites, is a commonly used molecular marker technique that offers several advantages such as widespread genomic distribution, abundant quantity, high polymorphism, and high repeatability. Research reports related to this technology have been published for various species, including Prunus fruticosa (Pall.) [10], Ginkgo biloba (L.) [11], Acacia mearnsii (De Wild.) [12], and Triadica sebifera ((L.) Small) [13], and it is one of the most effective molecular markers for studying population diversity and population structure.
Hence, the present study used SSR molecular marker methods to analyze the genetic diversity of M. glyptostroboides germplasms from three forest areas in Yuyao city, Zhejiang. A comparison was made between germplasms at the Ningbo Forest Farm across various introduction sites and life history stages to gauge their viability. Our objectives were to (1) elucidate genetic diversity and population structure at the species and group levels and (2) provide insights to develop effective conservation strategies.

2. Materials and Methods

2.1. Plant Materials

In June 2023, the experimental samples were collected from three forest areas managed by Ningbo Forest Farm in Zhejiang Province. The maximum linear distance separating the forest areas is approximately 12 km, and the climate conditions are basically the same. The collection comprised 39 samples from Ganzhuling (A), 17 from Lingxi (LX), and 50 from Shanglianggang (SLG), for a total of 106 germplasms of M. glyptostroboides. Among them, LX has a relatively small overall number due to its proximity to the mountain road. These samples included 39 introduced mother trees and 67 naturally regenerated plants (Table 1).

2.2. The Source of SSR Polymorphism Primers

According to Wang’s report [14] on the SSR markers of M. glyptostroboides, a pre-experiment was performed with 28 pairs of successfully amplified primers, of which eight primer pairs with high polymorphism information content (PIC) and 20 tree plants were randomly selected for amplification reactions. Finally, six pairs of SSR primers were selected for this study (Table 2). The selection criteria for SSR primers were as follows: first, high success rate and repeatability in the PCR amplification pre-experiment; and second, high polymorphism, i.e., a high PIC value.

2.3. DNA Extraction, PCR Amplification, and Sequencing

Tender leaves from the test materials were collected and frozen in liquid nitrogen. The total DNA of 106 M. glyptostroboides leaf samples was extracted using a Plant Genomic DNA Kit DP305 (Tiangen, Beijing, China) following the manufacturer’s instructions. The concentration and quality of the genomic DNA were assessed using a UV spectrophotometer (Shimadzu, Kyoto, Japan) and 1% agarose gel electrophoresis. The DNA was diluted to 30 ng/μL and stored in a −20 °C freezer for later use.
The SSR PCR amplification reaction (15 μL) consisted of 1 µL of genomic DNA, 10 µL 2 × Taq PCR Master Mix KT201 (Tiangen, Beijing, China), 0.5 µL of each of the forward and reverse primers (10 μmol/L), 0.5 µL of the Taq enzyme (5 μmol/L), and 3.5 µL of ddH2O. PCR was performed on an EDC-810 PCR machine (Eastwin Life Sciences Co., Ltd., Beijing, China). The PCR amplification program was as follows: initial denaturation at 94 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 15 s, the appropriate annealing temperature (Table 2) for 15 s, and extension at 72 °C for 30 s, and a final extension at 72 °C for 3 min. The PCR products were stored at 4 °C for subsequent electrophoresis analysis.
After completion of the fluorescent PCR amplification, the concentration of the PCR products was estimated based on the agarose gel electrophoresis results. The products were diluted tenfold, mixed with the internal size standard LIZ500 (Applied Biosystems, Carlsbad, CA, USA), and placed on the sample rack of the ABI 3730 sequencer (Piscataway, NJ, USA) for capillary electrophoresis. The experimental detection used a four-color channel detection system, FAM, HEX, TAMRA, and ORANGE, enabling simultaneous detection of three types of STR in each channel. The process involved the addition of 12.5 μL of ultrapure deionized formamide (Yeason Biotechnology, Shanghai, China), 0.25 μL of ROX-labeled molecular weight marker MW-0195-80ROX (Eurogentic, Seraling, Belgium), and 1.5 μL of the tenfold-diluted PCR product, followed by denaturation at 95 °C for 5 min and rapid chilling on ice for 3 min before capillary electrophoresis on the sample rack of the ABI3730 sequencer.

2.4. Data Analysis

The genotype data were imported into GeneMarker analysis ver. 3.0.0 software and the raw genotype data in Excel and the genotyping peak chart in the PDF were exported separately according to the locus names. The results of the SSR molecular markers were subsequently transformed into a .txt format using the GenAlEx ver. 6.51b2 software [15], and the individual SSR loci were calculated for the observed number of alleles (Na), effective number of alleles (Ne), Shannon’s diversity index (I), observed heterozygosity (Ho), expected heterozygosity (He), unbiased expected heterozygosity (uHe), and inbreeding coefficient at an individual population level (Fis). Hardy–Weinberg equilibrium (HWE) and null allele frequency (Fna) of each locus across populations were tested using GenePOP ver. 4.7.5 software [16]. To compare the differences in genetic parameters between the mother trees and seedlings, independent sample t tests were performed using the online statistical platform SPSSAU ver. 23.0 (https://spssau.com/en/indexs.html accessed on 15 August 2023). The Summary Statistics function in PowerMarker ver. 3.25 software [17] was used to calculate the PIC and gene diversity for each locus as well as Nei’s, genetic distance and genetic identity [18], and an unweighted pair-group method with arithmetic means (UPGMA) based cluster analysis as performed in Past ver. 5.0.1 software [19]. Analysis of molecular variance (AMOVA) was performed using GenAlEx ver. 6.51b2 software, with calculations for the total interpopulation and intrapopulation molecular genetic variance sums (SS), mean squares (MS), variant variance (EST. Var.), and 999 permutations. The SSR genotyping data were imported into Structure ver. 2.3.1 software [20] for analysis, with a range of K values from 1 to 20 and Markov chain Monte Carlo (MCMC) and burn-in iterations set to 100,000 and 500,000, respectively, with each K value run 10 times. The results file from Structure was uploaded to the Structure Harvester online tool (http://taylor0.biology.ucla.edu/structureHarvester/ accessed on 20 August 2023) for analysis, and a curve of ΔK values with respect to K values was drawn to determine the optimal K value, which corresponds to the peak value. GenAlEx ver. 6.51b2 software was used to construct the genetic distance matrix, perform a two-dimensional principal coordinate analysis (PCoA) based on the GD matrix, plot the PCoA scatter plot of principal coordinates 1 and 2, and assign different colors to the predefined populations in the plot.

3. Results

3.1. Genetic Diversity at the Locus Level

Capillary electrophoresis was performed to analyze 106 samples using six selected pairs of SSR polymorphic primers. The fragment sizes of alleles at each locus and their corresponding electropherograms for different germplasms of M. glyptostroboides were accurately obtained. For example, the primer MG84 revealed the presence of seven peaks (265, 284, 276, 279, 260, 265, and 281 bp) in four mother trees from the Ganzhuling forest area (AM) in the M. glyptostroboides grouping, which indicated polymorphisms at this locus (Figure S1). In total, 65 alleles (Na) were amplified, with allele numbers at each locus ranging from seven to 17, averaging 10.83 alleles. The primer MG111 exhibited the largest number of alleles (17) among the primers studied, in contrast to the MG80 primer, which amplified the lowest number of alleles (7). The observed heterozygosity (Ho) ranged from 0.311 to 0.981, with an average of 0.616. The expected heterozygosity (He) ranged from 0.650 to 0.872, with an average of 0.768. Shannon’s diversity index (I) ranged from 1.437 to 2.271, with an average of 1.789. The gene diversity ranged from 0.650 to 0.872, with an average of 0.768. The polymorphic information content (PIC) ranged from 0.619 to 0.860, with an average of 0.753. All of the loci, except for MG95, significantly deviated from HWE (Table 3).

3.2. The Genetic Diversity in Different Groups

M. glyptostroboides from three different forest regions and two different life histories were amplified using six pairs of SSR polymorphic primers. The Na range was 3.176 (LXS) to 9.500 (SLGS), with an average of 5.306, while the Ne range was 2.375 (LXS) to 5.434 (SLGS), with an average of 3.441. The index of I ranged from 0.951 (AS) to 1.811 (SLGS), with an average of 1.269. The Ho ranged from 0.417 (AS) to 0.772 (SLGM), with an average of 0.604, and the He ranged from 0.508 (AS) to 0.777 (SLGS), with an average of 0.640. All the He and uHe values exceeded 0.5, which indicated relatively high genetic diversity of M. glyptostroboides. Furthermore, in terms of Fis, the average Fis values for SLGM and LXS were −0.022 and −0.031, respectively, which indicated an excess of heterozygotes (Fis < 0). Conversely, the average Fis values for the remaining groups were all > 0, which indicated varying degrees of inbreeding across the groups (Table 4).
A further comparison of the introduced M. glyptostroboides according to the grouping of mother trees and seedlings was performed using independent sample t tests. There were no significant differences between the samples in the different groups in terms of Na, Ne, I, Ho, He, uHe, or Fis (p > 0.05) (Table 5).

3.3. Analysis of Molecular Variance (AMOVA)

AMOVA of the six M. glyptostroboides groups revealed that 88% of the variation originated from within groups (p < 0.001), with only 12% of the total variation occurring among groups (p < 0.001) (Table 6). The genetic difference (Fst) between the groups was 0.117, which indicated a moderate level of genetic differentiation between the M. glyptostroboides groups. The number of effective migrants (Nm) was 1.887, which was greater than one, which indicated a low probability of genetic drift occurring.

3.4. Genetic Distance and Genetic Identity Among Groups

The statistical analysis of Nei’s genetic distance (GD) and genetic identity (GI) for M. glyptostroboides revealed the genetic relationships among the six groups. The results indicated that the smallest genetic distance occurred between the LXS and LXM groups (0.058), and the greatest genetic distance existed between the SLGS and AS groups (0.633). Conversely, the genetic consistency was highest for the LXS and LXM groups (0.944) and lowest for the SLGS and AS groups (0.531) (Table 7).

3.5. Structure Analysis

The maximum measured ΔK determined by Structure Harvester was K = 6, which indicated that the optimal clustering was in six groups (Figure 1 and Figure 2).

3.6. UPGMA Cluster Analysis

Based on Nei’s genetic distance between groups, the UPGMA method was used for clustering the tested materials and obtaining a diagram. The results showed that the six groups formed two major branches, namely, one branch consisting of AM and AS formed a sister relationship with the remaining four groups. The SLGM and SLGS groups exhibited a sister relationship that constituted one solid subbranch with 100 bootstrap values, with LXM and LXS composing another subbranch. Moreover, the mother trees and the seedlings within the same forest area formed subbranches (Figure 3).

3.7. Principal Coordinate Analysis

PCoA is a non-constrained dimensionality reduction analysis method that can provide insights into the structural differences and similarities among groups. The results of PCoA conducted on 106 trees showed that the explanatory rates were 23.08% for principal component 1 and 20.33% for principal component 2, respectively. Most trees in the AS group and one from the AM group formed a distinct cluster, and overall, the trees within it were relatively dispersed. In contrast, SLGS are more evenly distributed among trees. The remaining groups could not be effectively categorized, and there was at least one overlap among the other groups. Additionally, with the exception of samples from the Ganzhuling forest area (AM and AS), the mother trees and seedlings from the same forest area exhibited a high degree of overlap (Figure 4).

4. Discussion

4.1. Genetic Diversity and Heterozygote Excess

Many scholars investigated the genetic diversity of wild and cultivated M. glyptostroboides. For example, Li et al. [6] used random amplified polymorphic (RAPD) markers to detect six wild populations and two cultivated populations of M. glyptostroboides. The results showed that the average genetic diversity of the wild populations was lower than the gymnosperms, and the genetic diversity of the cultivated populations was also much lower than the relic populations. Similarly, Li et al. [7] obtained similar trends using RAPD markers to detect eight wild populations and four cultivated populations and suggested that the genetic variation in wild populations was relatively low, which is related to habitat loss and fragmentation, while the cultivated populations were influenced by nonrandom selection, vegetative reproduction, and a single source of germplasm. In this study, the average values of the genetic parameters were calculated (Na = 5.306 ± 0.474; Ne = 3.441 ± 1.731; I = 1.269 ± 0.080; Ho = 0.604 ± 0.053; He = 0.640 ± 0.166). A comparison of the genetic diversity of wild M. glyptostroboides and SSR research results for other plants revealed that the introduced M. glyptostroboides germplasm exhibited remarkable genetic diversity at the species level. M. glyptostroboides is a diecious and anemophilous plant that is cross-pollinated and was initially introduced into the Ningbo Forest Farm in the 1950s. Therefore, this process may be connected to the results of genetic admixture from different wild populations or diverse sources of germplasm in early phase introductions. Based on multiple genetic diversity indicators, the genetic diversity ranking of the six M. glyptostroboide groups at the Ningbo Forestry Farm was as follows: SLGS > AM > SLGM > LXM > LXS > AS (Table 4). The genetic diversity of the AS group was the lowest among the six groups, and field observations suggested that it may have originated from the same maternal tree. This is also supported by the result of the PCoA analysis (Figure 4). When comparing genetic diversity in different forest areas, the ranking was Shanglianggang Forest Area > Lingxi Forest Area > Ganzhuling Forest Area. Moreover, when comparing the genetic diversity of M. glyptostroboides at different life stages, except for the seedlings in the Shanglianggang Forest Area (SLGS), the genetic diversity level of the M. glyptostroboide in the mother trees exceeded the diversity of the seedlings. However, the results of the independent samples t tests indicated that the difference in genetic diversity between the mother trees and the seedlings was not significant. This result indicates that the genetic diversity remained stable over generations, i.e., the founder effect of the M. glyptostroboide population did not occur. Among the six groups of M. glyptostroboides, the seedling group in the Shanglianggang Forest Area demonstrated the highest genetic diversity, which was partly influenced by having the largest number of tested seedlings (41 samples). This finding is also consistent with the actual survey situation: this group had the lowest altitude distribution, sufficient water sources, good understory vegetation coverage, and an optimal habitat with the lowest degree of human disturbance. The seedlings may have originated from multiple mother trees and possessed the best regeneration ability.
The inbreeding coefficient (Fis) reflects the balance between Ho and He within a population. Generally, F < 0 indicates an excess of heterozygotes, while F > 0 suggests a deficit of heterozygotes [21]. In isolated small subpopulations, mating frequently occurs between closely related trees, which results in an elevated coefficient of inbreeding [22]. The confined geographic range of the introduced M. glyptostroboides, combined with the short dispersal distances of its seeds and apparent clustering, led us to anticipate a notable loss of heterozygosity within the introduced population of M. glyptostroboides in the Siming Mountains. The Fis values in the four distribution areas (AM, AS, LXM, and SLGS) were all greater than 0, which is consistent with our expectations. In contrast, for LXS and SLGM, both values were negative (−0.022 and −0.033), which indicated that the observed heterozygote frequency was lower than the expected heterozygote frequency. This discrepancy suggests a certain degree of inbreeding in the population. Generally, the reasons for inbreeding within a population include a small population size, and sampling strategies. For example, Balloux [23] indicated that inbreeding usually occurred in small populations with a low number of breeding trees. The relatively small number of trees obtained from the specified groups increases the probability of shared parental origins, which resulted in an increase in heterozygotes in the offspring. Furthermore, the annual elimination and replenishment procedures in the plantation, compounded by the limited participation of trees from the LXS and SLGM in the breeding population and historical artificial selective pressures, have contributed to variations in the allele frequencies of the parental and maternal genotypes due to random factors. These procedures can also be considered a significant contributing factor. These results further suggested that these two groups experienced some degree of genetic drift or a bottleneck effect due to the inbreeding.

4.2. The Applicability of SSR Polymorphism Primers for M. glyptostroboide

Microsatellite loci are known to be highly polymorphic and codominant compared to traditional molecular markers (e.g., isozymes, RFLP, AFLP, et al.), which makes them more effective for assessing genetic variation in organisms [14,24]. In this study, the selected six primer pairs were highly informative (PIC > 0.600), which demonstrated that these SSR marker loci may be used to elucidate genetic variations and validate the repeatability and feasibility of capillary electrophoresis SSR marker technology for analyzing the genetic diversity of M. glyptostroboides. We identified valuable candidate markers for genetic diversity analysis and constructing DNA fingerprint patterns of M. glyptostroboides. This approach offers molecular technology for the subsequent molecular identification of M. glyptostroboides germplasm and molecular-assisted breeding of superior germplasm.

4.3. Genetic Differentiation and Structure

The evolutionary potential of a species or population significantly relies on its population genetic structure, especially for endangered or relict species showing notable genetic variation and differentiation across populations [25,26]. The AMOVA data for M. glyptostroboides in the present study revealed that genetic variation existed primarily within the groups (88%), and the moderate genetic differentiation coefficient (Fst = 0.117) reflecting consistent outcomes. Additionally, gene flow (Nm = 1.887) among groups was detected, which may be due to the long-distance wind dispersal of M. glyptostroboides pollen. The tall and conical shape of M. glyptostroboides cones facilitates seeds dispersal, aided by birds and mammals.
We used GD and GI analysis along with structure analysis, UPGMA cluster analysis, and PCoA principal coordinate analysis to investigate the genetic structure and relationships among groups of M. glyptostroboides. However, the results of different methods were not entirely consistent. Specifically, structure analysis supported the subdivision of the six groups into six distinct units, UPGMA cluster analysis tended to categorize them into two main branches, whereas the PCoA can hardly categorize all the groups into separate groups. Moreover, combining the results of the GD and GI analyses, it can be seen that the LXS group and LXM group were most closely related, while the SLGS group was farthest from the AS group genetically. The observed inconsistency in this grouping suggests a close genetic relationship among the groups, which is consistent with the results obtained in this study that there is a moderate degree of genetic differentiation and partial gene flow in M. glyptostroboides. In future studies, utilizing population genomic analyses based on single nucleotide polymorphisms (SNPs) derived from next-generation sequencing technologies (e.g., reduced representation genome sequencing and whole genome re-sequencing), may provide deeper insights and a more comprehensive understanding of genetic diversity and population structures for M. glyptostroboides.

4.4. Conservation Implications

Researchers have demonstrated that the distribution range of the wild population of M. glyptostroboides is narrow and affected by natural disasters (lightning strikes, diseases, and pests) and human interference (forest management and logging), which lead to habitat fragmentation and obstacles to sexual reproduction, and these factors present difficulties for the restoration of M. glyptostroboides. Given the notable genetic differentiation of M. glyptostroboides populations in various forest areas, it is recommended to protect the current population across a broad area to maintain its genetic integrity and prevent the potential loss of various resources as a result of human exploitation. During on-site protection activities, it is recommended to establish distinct protection zones to safeguard the existing introduced population and its surrounding habitat and enabled regeneration for the expansion of the population size and the effective population size (Ne). Moreover, intensive research into the reproduction techniques of M. glyptostroboides is necessary to address crucial issues related to seed germination and seedling growth. Measures should also be taken to establish germplasm nurseries and elite gene banks, with priority given to germplasm selection from the Shangliang forest area due to its rich genetic diversity. By transplanting trees and seedlings from different forest areas, artificial genetic exchange may be enhanced to maximize the protection of the genetic diversity of this species. These strategies hold significant implications for the conservation and sustainable utilization of M. glyptostroboides, which is a unique species of exceptionally high ecological value.

5. Conclusions

Genetic diversity within introduced M. glyptostroboides populations at the Ningbo Forest Farm was evaluated using SSR markers analyzed via capillary electrophoresis. The results revealed a relatively high genetic diversity and notable genetic differentiation among the introduced M. glyptostroboides. There was no significant variance in genetic diversity between the maternal trees and seedlings, which may be due to Mendelian inheritance resulting from random mating or indicative of the absence of a founder effect in the M. glyptostroboides population. However, further validation using bottleneck testing is needed. Inbreeding was detected in specific subgroups, which may be due to random factors within small groups. Given the genetic structure, it is recommended that distinct conservation zones be established in existing forest regions to facilitate the regeneration of plants and perform continuous monitoring and evaluation of the regenerating seedling populations. This research provides essential insights into the genetic diversity and structure of introduced M. glyptostroboides and provides a theoretical basis for the conservation and management of M. glyptostroboides germplasm, the selection of excellent germplasm, and the implementation of molecular-assisted breeding techniques.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/f16010078/s1, Figure S1: Amplification map of the SSR marker MG84.

Author Contributions

Conceptualization, D.L. and H.Z.; Methodology, H.Z.; Software, H.Z. Validation, H.L.; Formal Analysis, H.Z.; Investigation, D.L. and H.Z.; Resources, D.L.; Data Curation, H.Z.; Writing—Original Draft Preparation, D.L.; Writing—Review and Editing, H.Z. and H.L.; Visualization, H.Z.; Supervision, H.L.; Project Administration, H.L.; Funding Acquisition, H.Z. and H.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the “Pioneer” and “Leading Goose” R&D Program of Zhejiang (2024C02002) and the Zhejiang Provincial Natural Science Foundation of China (LQ24C030002).

Data Availability Statement

Data is contained within the article or Supplementary Material.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Liu, Y.J.; Arens, N.C.; Li, C.S. Range change in Metasequoia: Relationship to paleoclimate. Bot. J. Linn. Soc. 2007, 154, 115–127. [Google Scholar] [CrossRef]
  2. Zhang, X.; Wei, H.; Zhang, X.; Liu, J.; Zhang, Q.; Gu, W. Non-pessimistic predictions of the distributions and suitability of Metasequoia glyptostroboides under climate change using a random forest model. Forests 2020, 11, 62. [Google Scholar] [CrossRef]
  3. Wu, M.L.; Yao, L.; Ai, X.R.; Zhu, J.; Zhu, Q.; Wang, J.; Huang, X.; Hong, J.F. The reproductive characteristics of core germplasm in a native Metasequoia glyptostroboides population. Biodivers. Sci. 2020, 28, 303–313. [Google Scholar]
  4. Chen, J.; Hao, Z.; Xu, H.; Yang, L.; Liu, G.; Sheng, Y.; Zheng, C.; Zheng, W.; Cheng, T.; Shi, J. The complete chloroplast genome sequence of the relict woody plant Metasequoia glyptostroboides Hu et Cheng. Front. Plant Sci. 2015, 6, 447. [Google Scholar] [CrossRef] [PubMed]
  5. Fu, F.; Song, C.; Wen, C.; Yang, L.; Guo, Y.; Yang, X.; Shu, Z.; Li, X.; Feng, Y.; Liu, B.; et al. The Metasequoia genome and evolutionary relationships among redwoods. Plant Commun. 2023, 4, 100643. [Google Scholar] [CrossRef] [PubMed]
  6. Li, X.D.; Huang, H.W.; Li, J.Q. Genetic diversity of the relict plant Metasequoia glyptostroboides. Biodivers. Sci. 2003, 11, 100–108. [Google Scholar]
  7. Li, Y.Y.; Chen, X.Y.; Zhang, X.N.; Wu, T.Y.; Lu, H.P.; Cai, Y.W. Genetic differences between wild and artificial populations of Metasequoia glyptostroboides: Implications for species recovery. Conserv. Biol. 2005, 19, 224–231. [Google Scholar] [CrossRef]
  8. Kato-Noguchi, H.; Matsumoto, K.; Sakamoto, C.; Tojo, S.; Teruya, T. Allelopathy and allelopathic substances in the leaves of Metasequoia glyptostroboides from pruned branches for weed management. Agronomy 2023, 13, 1017. [Google Scholar] [CrossRef]
  9. Ma, J. A worldwide survey of cultivated Metasequoia glyptostroboides Hu & Cheng (Taxodiaceae: Cupressaceae) from 1947 to 2007. Bull. Peabody Mus. Nat. His. 2007, 48, 235–253. [Google Scholar]
  10. Barać, G.; Ognjanov, V.; Vidaković, D.O.; Dorić, D.; Ljubojević, M.; Dulić, J.; Miodragović, M.; Gašić, K. Genetic diversity and population structure of European ground cherry (Prunus fruticosa Pall.) using SSR markers. Sci. Hortic. 2017, 224, 374–383. [Google Scholar] [CrossRef]
  11. Zhou, Q.; Mu, K.; Ni, Z.; Liu, X.; Li, Y.; Xu, L.A. Analysis of genetic diversity of ancient Ginkgo populations using SSR markers. Ind. Crop. Prod. 2020, 145, 11942. [Google Scholar] [CrossRef]
  12. Bairu, M.W.; Amelework, A.B.; Coetzer, W.G. Genetic diversity and population structure of six South African Acacia mearnsii breeding populations based on SSR markers. J. Plant. Res. 2021, 134, 1243–1252. [Google Scholar] [CrossRef]
  13. Zhou, P.; Zhou, Q.; Dong, F.; Shen, X.; Li, Y. Study on the genetic variation of Triadica sebifera (Linnaeus) small populations based on SSR Markers. Forests 2022, 13, 1330. [Google Scholar] [CrossRef]
  14. Wang, J.W.; Xu, T.L.; Sereke, G.W.; Wang, R.; Li, Y.Y. Novel 28 microsatellite loci using high-throughput sequencing for an endangered species on Metasequoia glyptostroboides (Cupressaceae). Mol. Biol. Rep. 2020, 47, 2991–2996. [Google Scholar] [CrossRef] [PubMed]
  15. Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [PubMed]
  16. Rousset, F. GENEPOP′007: A complete re-implementation of the GENEPOP software for Windows and Linux. Mol. Ecol. Resour. 2008, 8, 103–106. [Google Scholar] [CrossRef] [PubMed]
  17. Liu, K.; Muse, S.V. PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics 2005, 21, 2128–2129. [Google Scholar] [CrossRef] [PubMed]
  18. Nei, M.; Tajima, F.; Tateno, Y. Accuracy of estimated phylogenetic trees from molecular data. J. Mol. Evol. 1983, 19, 153–170. [Google Scholar] [CrossRef]
  19. Hammer, Ø.; Harper, D.A. Past: Paleontological statistics software package for educaton and data anlysis. Palaeontol. Electron. 2001, 4, 9. [Google Scholar]
  20. Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef]
  21. Weir, B.S.; Cockerham, C.C. Estimating F-statistics for the analysis of population structure. Evolution 1984, 38, 1358–1370. [Google Scholar] [CrossRef]
  22. Zhu, H.; Liu, J.; Gao, M.; Yue, C.; Li, H. Population genetic assessment of Viburnum japonicum in China using ddRAD-seq. Front. Genet. 2023, 14, 1150437. [Google Scholar] [CrossRef]
  23. Balloux, F. Heterozygote excess in small populations and the heterozygote-excess effective population size. Evolution 2004, 58, 1891–1900. [Google Scholar]
  24. Cui, M.Y.; Yu, S.; Liu, M.; Li, Y.Y. Isolation and characterization of polymorphic microsatellite markers in Metasequoia glyptostroboides (Taxodiaceae). Conserv. Genet. Resour. 2010, 2, 19–21. [Google Scholar] [CrossRef]
  25. Wu, Q.; Zang, F.; Ma, Y.; Zheng, Y.; Zang, D. Analysis of genetic diversity and population structure in endangered Populus wulianensis based on 18 newly developed EST-SSR markers. Glob. Ecol. Conserv. 2020, 24, e01329. [Google Scholar] [CrossRef]
  26. Zhang, X.; Yang, L.; Liu, Y.H.; Zhou, X.L.; Zhang, L.Q.; Wang, Y.H.; Shen, S.K. Genetic diversity, genetic structure, and demographic history of Cinnamomum chago, a plant species with extremely small populations in China. Ecol. Conserv. 2021, 31, e01808. [Google Scholar] [CrossRef]
Figure 1. Relationship between the number of K values and the corresponding ΔK statistic.
Figure 1. Relationship between the number of K values and the corresponding ΔK statistic.
Forests 16 00078 g001
Figure 2. Population structure analysis of six Metasequoia glyptostroboides groups.
Figure 2. Population structure analysis of six Metasequoia glyptostroboides groups.
Forests 16 00078 g002
Figure 3. UPGMA cluster tree of the six Metasequoia glyptostroboides groups based on Nei’s genetic distance. Numbers on branches indicated bootstrap values from 1000 replicates.
Figure 3. UPGMA cluster tree of the six Metasequoia glyptostroboides groups based on Nei’s genetic distance. Numbers on branches indicated bootstrap values from 1000 replicates.
Forests 16 00078 g003
Figure 4. Two-dimensional scatter diagram of principal coordinate analysis of SSR markers in 106 M. glyptostroboides accessions.
Figure 4. Two-dimensional scatter diagram of principal coordinate analysis of SSR markers in 106 M. glyptostroboides accessions.
Forests 16 00078 g004
Table 1. Sampling locations of Metasequoia glyptostroboides from Ningbo Forest Farm.
Table 1. Sampling locations of Metasequoia glyptostroboides from Ningbo Forest Farm.
GroupSampling LocationLongitude
(°E)
Latitude
(°N)
Altitude
(m)
n
AMGanzhuling forest area121.0829.7382321
AS18
LXMLingxi forest area121.1229.767279
LXS8
SLGMShangliang forest area121.2029.716709
SLGS41
Table 2. Sequence information of six polymorphic SSR primer pairs for Metasequoia glyptostroboides.
Table 2. Sequence information of six polymorphic SSR primer pairs for Metasequoia glyptostroboides.
LocusPrimer sequences (5′→3′)Repeat MotifAnnealing
Temperature (°C)
Allele Size
Range
Fluorescent Dye
MG80F: TCGAAATATACCTTGGGCGA(AT)962272~292FAM
R: CTTGCAGTGAAAGAAACACACA
MG84F: AATGCCCCTATGATTCTCCA(AAG)1359255~309HEX
R: CCATTCAAGCATCCATAGCC
MG95F: ATGCATGTCCTTGAAAAGGC(TTC)1056299~323TAMRA
R: TGAGGATGGAAGGAGAGCAG
MG110F: CCTCCGAAAAGAAAAAGAGGA(AAG)962235~250FAM
R: AACTAGATGGGGTGGAAGCA
MG111F: CCATAAACACAATCGGTACACA(TA)1063257~301HEX
R: TGGTGAGGAAGTAGATGGGG
MG117F: TTGGGAAAGTTTGACACAAGG(AGA)1061431~461TAMRA
R: TTCTTCCATTGCCTTCATCC
Table 3. Polymorphism information for six pairs of SSR loci in Metasequoia glyptostroboides.
Table 3. Polymorphism information for six pairs of SSR loci in Metasequoia glyptostroboides.
Genetic ParameterMG80MG84MG95MG110MG111MG117
n106106106106106106
Na7121081711
Ne3.8536.9022.8604.9077.8333.245
I1.5252.1201.4371.7252.2711.653
Ho0.3110.6700.6420.6600.9810.434
He0.7400.8550.6500.7960.8720.692
uHe0.7440.8590.6530.8000.8760.695
F0.5800.2170.0140.171−0.1250.373
Fis0.6400.124−0.0250.021−0.2020.229
Fit0.6660.2110.040.105−0.1440.318
Fst0.0720.0990.0640.0860.0490.116
Nm3.2422.2723.6792.6714.8891.909
Fna0.3560.1180.0570.2300.0000.153
GeneDiversity0.7400.8550.6500.7960.8720.692
PIC0.7010.8390.6190.7660.8600.672
HWE (p value)0.000 *0.000 *0.1310.000 *0.008 *0.000 *
n—number of samples; Na—observed number of alleles; Ne—effective number of alleles; I—Shannon’s information index; Ho—observed heterozygosity; He—expected heterozygosity; uHe—unbiased expected heterozygosity; F—fixation index; Fis—inbreeding coefficient at an individual population level; Fit—inbreeding coefficient at total population level; Fst; population differentiation; Nm—numbers of effective migrants; Fna—null allele frequency; GeneDiversity; PIC—polymorphism information content; HWE—Hardy–Weinberg equilibrium; * deviated from HWE with a level of p < 0.01.
Table 4. Genetic diversity analysis of six groups (consisting of mother trees and seedlings) in Metasequoia glyptostroboides.
Table 4. Genetic diversity analysis of six groups (consisting of mother trees and seedlings) in Metasequoia glyptostroboides.
Genetic ParameterAMLXMSLGMASLXSSLGSMean Value
n21991884118
Na
(±SE)
6.333 ± 0.5583.667 ± 0.6155.000 ± 0.5774.167 ± 1.2223.167 ± 0.3079.500 ± 1.1765.306 ± 0.474
Ne
(±SE)
3.791 ± 0.5342.621 ± 0.2683.690 ± 0.5492.733 ± 0.7972.375 ± 0.2115.434 ± 0.9243.441 ± 1.731
I
(±SE)
1.475 ± 0.1101.052 ± 0.1281.371 ± 0.1520.951 ± 0.2530.953 ± 0.0951.811 ± 0.1631.269 ± 0.080
Ho
(±SE)
0.683 ± 0.1040.574 ± 0.1610.722 ± 0.1510.417 ± 0.1520.563 ± 0.1280.667 ± 0.0790.604 ± 0.053
He
(±SE)
0.708 ± 0.0400.595 ± 0.0470.688 ± 0.0570.508 ± 0.1020.559 ± 0.0460.782 ± 0.0410.640 ± 0.166
uHe
(±SE)
0.726 ± 0.0410.630 ± 0.0500.729 ± 0.0610.523 ± 0.1050.596 ± 0.0490.792 ± 0.0420.666 ± 0.028
Fis
(±SE)
0.038 ± 0.1320.049 ± 0.228−0.022 ± 0.1810.346 ± 0.207−0.031 ± 0.2110.151 ± 0.0800.089 ± 0.072
n—number of samples; Na—observed number of alleles; Ne—effective number of alleles; I—Shannon’s information index; Ho—observed heterozygosity; He—expected heterozygosity; uHe—unbiased expected heterozygosity; Fis—inbreeding coefficient.
Table 5. Independent samples t tests based on genetic parameters for comparison between mother trees and seedlings of Metasequoia glyptostroboides.
Table 5. Independent samples t tests based on genetic parameters for comparison between mother trees and seedlings of Metasequoia glyptostroboides.
Group (Mean ± SE)tp Value
Mother Trees (n = 39)Seedlings (n = 67)
Na5.000 ± 0.4125.611 ± 0.864−0.6390.529
Ne3.367 ± 0.2863.514 ± 0.510−0.2500.804
I1.299 ± 0.0831.238 ± 0.1390.3750.710
Ho0.660 ± 0.0780.549 ± 0.0711.0500.301
He0.663 ± 0.0290.616 ± 0.0400.8550.399
uHe0.695 ± 0.0300.637 ± 0.0401.0300.310
Fis0.022 ± 0.1010.155 ± 0.103−0.9290.359
Table 6. Analysis of intragroup and intergroup molecular variance for groups of Metasequoia glyptostroboides.
Table 6. Analysis of intragroup and intergroup molecular variance for groups of Metasequoia glyptostroboides.
Source of VariationdfSum of Square, SSMean Square, MSVariance Component, EST. Var.Total
Variance (%)
p Value
Between Groups555.61711.1230.279120.001
Within Groups206432.6472.1002.100880.001
Total211488.264 2.379100
Table 7. Nei’s genetic distances (below diagonal) and genetic identities (above diagonal) among the six Metasequoia glyptostroboides groups.
Table 7. Nei’s genetic distances (below diagonal) and genetic identities (above diagonal) among the six Metasequoia glyptostroboides groups.
GroupAMASLXMLXSSLGMSLGS
AM0.6700.7350.7070.7200.721
AS0.4010.7050.6770.5840.531
LXM0.3080.3490.9440.6760.713
LXS0.3460.3900.0580.6240.642
SLGM0.3280.5380.3920.4720.840
SLGS0.3270.6330.3380.4440.174
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, D.; Li, H.; Zhu, H. Genetic Patterns and Diversity of Postintroduction of Metasequoia glyptostroboides (Hu and W. C. Cheng) in Ningbo Forest Farm, China. Forests 2025, 16, 78. https://doi.org/10.3390/f16010078

AMA Style

Li D, Li H, Zhu H. Genetic Patterns and Diversity of Postintroduction of Metasequoia glyptostroboides (Hu and W. C. Cheng) in Ningbo Forest Farm, China. Forests. 2025; 16(1):78. https://doi.org/10.3390/f16010078

Chicago/Turabian Style

Li, Dongbin, Hepeng Li, and Hong Zhu. 2025. "Genetic Patterns and Diversity of Postintroduction of Metasequoia glyptostroboides (Hu and W. C. Cheng) in Ningbo Forest Farm, China" Forests 16, no. 1: 78. https://doi.org/10.3390/f16010078

APA Style

Li, D., Li, H., & Zhu, H. (2025). Genetic Patterns and Diversity of Postintroduction of Metasequoia glyptostroboides (Hu and W. C. Cheng) in Ningbo Forest Farm, China. Forests, 16(1), 78. https://doi.org/10.3390/f16010078

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop