A Novel Recombinant FAdV-4 Virus with Fiber of FAdV-8b Provides Efficient Protection against Both FAdV-4 and FAdV-8b
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells, Viruses, Antibodies and Plasmids
2.2. Construction of sgRNA and Donor Plasmids
2.3. Generation of the Recombinant FA4-F8b
2.4. Identification the Stability and Growth Properties of the FA4-F8b in LMH Cells
2.5. Western Blot Assay
2.6. IFA
2.7. Pathogenicity of the Recombinant FA4-F8b in SPF Chickens
2.8. Preparation of Inactivated FA4-F8b Vaccine
2.9. Immunization and Challenge
2.10. Virus Neutralization Test (VNT)
2.11. Titration of Viral Titer in Organs and Cloacal Swabs
2.12. Statistical Analysis
3. Results
3.1. Generation of a Recombinant Virus FA4-F8b Expressing the Fiber of FAdV-8b
3.2. FA4-F8b Replicated Efficiently In Vitro and Was Highly Pathogenic In Vivo
3.3. Inactivated FA4-F8b Induced Efficiently Neutralizing Antibodies
3.4. Inactivated FA4-F8b Provides Efficient Protection against Both FAdV-8b and FAdV-4
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Harrach, B.; Benko, M. Phylogenetic analysis of adenovirus sequences. Methods Mol. Med. 2007, 131, 299–334. [Google Scholar] [PubMed]
- Asthana, M.; Chandra, R.; Kumar, R. Hydropericardium syndrome: Current state and future developments. Arch. Virol. 2013, 158, 921–931. [Google Scholar] [CrossRef] [PubMed]
- Balamurugan, V.; Kataria, J.M. The hydropericardium syndrome in poultry—A current scenario. Vet. Res. Commun. 2004, 28, 127–148. [Google Scholar] [CrossRef] [PubMed]
- Hess, M. Detection and differentiation of avian adenoviruses: A review. Avian Pathol. 2000, 29, 195–206. [Google Scholar] [CrossRef] [PubMed]
- Mase, M.; Hiramatsu, K.; Nishijima, N.; Iguchi, H.; Honda, S.; Hanyu, S.; Iseki, H.; Watanabe, S. Fowl Adenoviruses Type 8b Isolated from Chickens with Inclusion Body Hepatitis in Japan. Avian Dis. 2020, 64, 330–334. [Google Scholar] [CrossRef]
- Wells, R.J.; Harrigan, K. A fatal adenovirus infection of broiler chickens: Inclusion body hepatitis. Vet. Rec. 1974, 94, 481–482. [Google Scholar] [CrossRef]
- Ye, J.; Liang, G.; Zhang, J.; Wang, W.; Song, N.; Wang, P.; Zheng, W.; Xie, Q.; Shao, H.; Wan, Z.; et al. Outbreaks of serotype 4 fowl adenovirus with novel genotype, China. Emerg. Microbes Infect. 2016, 5, e50. [Google Scholar] [CrossRef]
- Pan, Q.; Liu, L.; Gao, Y.; Liu, C.; Qi, X.; Zhang, Y.; Wang, Y.; Li, K.; Gao, L.; Wang, X.; et al. Characterization of a hypervirulent fowl adenovirus 4 with the novel genotype newly prevalent in China and establishment of reproduction infection model of hydropericardium syndrome in chickens. Poult. Sci. 2017, 96, 1581–1588. [Google Scholar] [CrossRef]
- Mase, M.; Nakamura, K.; Minami, F. Fowl adenoviruses isolated from chickens with inclusion body hepatitis in Japan, 2009-2010. J. Vet. Med. Sci. 2012, 74, 1087–1089. [Google Scholar] [CrossRef] [Green Version]
- Lu, H.; Shao, H.; Chen, H.; Zhang, J.; Wang, W.; Li, T.; Xie, Q.; Qin, A.; Ye, J. Identification of novel B cell epitopes in the fiber protein of serotype 8 Fowl adenovirus. AMB Express 2019, 9, 172. [Google Scholar] [CrossRef]
- Pan, Q.; Yang, Y.; Gao, Y.; Qi, X.; Liu, C.; Zhang, Y.; Cui, H.; Wang, X. An Inactivated Novel Genotype Fowl Adenovirus 4 Protects Chickens against the Hydropericardium Syndrome That Recently Emerged in China. Viruses 2017, 9, 216. [Google Scholar] [CrossRef] [PubMed]
- Gupta, A.; Ahmed, K.A.; Ayalew, L.E.; Popowich, S.; Kurukulasuriya, S.; Goonewardene, K.; Gunawardana, T.; Karunarathna, R.; Ojkic, D.; Tikoo, S.K.; et al. Immunogenicity and protective efficacy of virus-like particles and recombinant fiber proteins in broiler-breeder vaccination against fowl adenovirus (FAdV)-8b. Vaccine 2017, 35, 2716–2722. [Google Scholar] [CrossRef] [PubMed]
- Meng, K.; Yuan, X.; Yu, J.; Zhang, Y.; Ai, W.; Wang, Y. Identification, Pathogenicity of Novel Fowl Adenovirus Serotype 4 SDJN0105 in Shandong, China and Immunoprotective Evaluation of the Newly Developed Inactivated Oil-emulsion FAdV-4 Vaccine. Viruses 2019, 11, 627. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, P.H.; Zheng, P.P.; Zhang, T.F.; Wen, G.Y.; Shao, H.B.; Luo, Q.P. Fowl adenovirus serotype 4: Epidemiology, pathogenesis, diagnostic detection, and vaccine strategies. Poult. Sci. 2017, 96, 2630–2640. [Google Scholar] [CrossRef] [PubMed]
- Shah, M.S.; Ashraf, A.; Khan, M.I.; Rahman, M.; Habib, M.; Chughtai, M.I.; Qureshi, J.A. Fowl adenovirus: History, emergence, biology and development of a vaccine against hydropericardium syndrome. Arch. Virol. 2017, 162, 1833–1843. [Google Scholar] [CrossRef] [PubMed]
- Schachner, A.; Matos, M.; Grafl, B.; Hess, M. Fowl adenovirus-induced diseases and strategies for their control—A review on the current global situation. Avian Pathol. 2018, 47, 111–126. [Google Scholar] [CrossRef]
- De Luca, C.; Schachner, A.; Mitra, T.; Heidl, S.; Liebhart, D.; Hess, M. Fowl adenovirus (FAdV) fiber-based vaccine against inclusion body hepatitis (IBH) provides type-specific protection guided by humoral immunity and regulation of B and T cell response. Vet. Res. 2020, 51, 143. [Google Scholar] [CrossRef]
- Fingerut, E.; Gutter, B.; Gallili, G.; Michael, A.; Pitcovski, J. A subunit vaccine against the adenovirus egg-drop syndrome using part of its fiber protein. Vaccine 2003, 21, 2761–2766. [Google Scholar] [CrossRef]
- Pitcovski, J.; Fingerut, E.; Gallili, G.; Eliahu, D.; Finger, A.; Gutter, B. A subunit vaccine against hemorrhagic enteritis adenovirus. Vaccine 2005, 23, 4697–4702. [Google Scholar] [CrossRef]
- Xie, Q.; Cao, S.; Zhang, W.; Wang, W.; Li, L.; Kan, Q.; Fu, H.; Geng, T.; Li, T.; Wan, Z.; et al. A novel fiber-2-edited live attenuated vaccine candidate against the highly pathogenic serotype 4 fowl adenovirus. Vet. Res. 2021, 52, 35. [Google Scholar] [CrossRef]
- Doudna, J.A.; Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 2014, 346, 1258096. [Google Scholar] [CrossRef] [PubMed]
- Ran, F.A.; Hsu, P.D.; Wright, J.; Agarwala, V.; Scott, D.A.; Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 2013, 8, 2281–2308. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schachner, A.; Marek, A.; Jaskulska, B.; Bilic, I.; Hess, M. Recombinant FAdV-4 fiber-2 protein protects chickens against hepatitis-hydropericardium syndrome (HHS). Vaccine 2014, 32, 1086–1092. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Wang, J.; Qiu, L.; Han, Z.; Liu, S. Fowl adenovirus species C serotype 4 is attributed to the emergence of hepatitis-hydropericardium syndrome in chickens in China. Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 2016, 45, 230–241. [Google Scholar] [CrossRef] [PubMed]
- Deng, L.; Sharif, S.; Nagy, E. Oral inoculation of chickens with a candidate fowl adenovirus 9 vector. Clin. Vaccine Immunol. CVI 2013, 20, 1189–1196. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Valdivia-Olarte, H.; Requena, D.; Ramirez, M.; Saravia, L.E.; Izquierdo, R.; Falconi-Agapito, F.; Zavaleta, M.; Best, I.; Fernández-Díaz, M.; Zimic, M. Design of a predicted MHC restricted short peptide immunodiagnostic and vaccine candidate for Fowl adenovirus C in chicken infection. Bioinformation 2015, 11, 460–465. [Google Scholar] [CrossRef] [Green Version]
- Shah, M.S.; Ashraf, A.; Khan, M.I.; Rahman, M.; Habib, M.; Qureshi, J.A. Molecular cloning, expression and characterization of 100K gene of fowl adenovirus-4 for prevention and control of hydropericardium syndrome. Biol. J. Int. Assoc. Biol. Stand. 2016, 44, 19–23. [Google Scholar] [CrossRef]
- Sarfraz, M.; Suleman, M.; Tikoo, S.K.; Wheler, C.; Potter, A.A.; Gerdts, V.; Dar, A. Immune responses to in ovo vaccine formulations containing inactivated fowl adenovirus 8b with poly[di(sodium carboxylatoethylphenoxy)]phosphazene (PCEP) and avian beta defensin as adjuvants in chickens. Vaccine 2017, 35, 981–986. [Google Scholar] [CrossRef]
Sequences of Primers (5′–3′) | |
---|---|
sgRNA-L | F: CACCGGGTTACGTCTACTCCCCCAA |
R: AAACTTGGGGGAGTAGACGTAACCC | |
sgRNA-R | F: CACCGTCTTTATTTGACACGCGGTG |
R: AAACCACCGCGTGTCAAATAAAGAC |
PCR Products | Sequences of Primers (5′–3′) |
---|---|
Linear pMD19- HAL-EGFP-F2-HAR | F: CACCGGGTTACGTCTACTCCCCCAA |
R: AAACTTGGGGGAGTAGACGTAACCC | |
Fiber gene of FAdV-8b | F: CACCGTCTTTATTTGACACGCGGTG |
R: AAACCACCGCGTGTCAAATAAAGAC |
Group | Designation | Vaccination | Challenge |
---|---|---|---|
1 | Negative control | Adjuvant only | - * |
2 | Vaccine/challenge FAdV-8b | Inactivated FA4-F8b | FAdV-8b |
3 | Challenge control FAdV-8b | Adjuvant only | |
4 | Vaccine/challenge FAdV-8a | Inactivated FA4-F8b | FAdV-8a |
5 | Challenge control FAdV-8a | Adjuvant only | |
6 | Vaccine/challenge FAdV-4 | Inactivated FA4-F8b | FAdV-4 |
7 | Challenge control FAdV-4 | Adjuvant only |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, H.; Xie, Q.; Zhang, W.; Zhang, J.; Wang, W.; Lian, M.; Zhao, Z.; Ren, D.; Xie, S.; Lin, Y.; et al. A Novel Recombinant FAdV-4 Virus with Fiber of FAdV-8b Provides Efficient Protection against Both FAdV-4 and FAdV-8b. Viruses 2022, 14, 376. https://doi.org/10.3390/v14020376
Lu H, Xie Q, Zhang W, Zhang J, Wang W, Lian M, Zhao Z, Ren D, Xie S, Lin Y, et al. A Novel Recombinant FAdV-4 Virus with Fiber of FAdV-8b Provides Efficient Protection against Both FAdV-4 and FAdV-8b. Viruses. 2022; 14(2):376. https://doi.org/10.3390/v14020376
Chicago/Turabian StyleLu, Hao, Quan Xie, Wei Zhang, Jianjun Zhang, Weikang Wang, Mingjun Lian, Zhehong Zhao, Dan Ren, Songhua Xie, Yun Lin, and et al. 2022. "A Novel Recombinant FAdV-4 Virus with Fiber of FAdV-8b Provides Efficient Protection against Both FAdV-4 and FAdV-8b" Viruses 14, no. 2: 376. https://doi.org/10.3390/v14020376