Cholesterol Biosynthesis Modulates CSFV Replication
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells and Virus
2.2. Quantitative Real-Time PCR (qPCR)
2.3. Virus One-Step Growth Curve
2.4. Quantification of Cholesterol Contents
2.5. Immunofluorescence Assay (IFA)
2.6. Transcriptome Analysis
2.7. Western Blotting (WB)
2.8. LDL Uptake Assay
2.9. Nile Red Staining
2.10. Construction of Plasmid
2.11. Transfection and Genotyping of Cell Clones
2.12. Statistical Analysis
3. Results
3.1. CSFV Upregulates Intracellular Cholesterol Levels in PK-15 Cells
3.2. CSFV Enhances Cholesterol Biosynthesis in PK-15 Cells
3.3. The Uptake of Exogenous Cholesterol Was Blocked by PCSK9 in CSFV Infected PK15 Cells
3.4. Inhibitions of Cholesterol Biosynthesis Impaired CSFV Replication
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Wei, Q.; Liu, Y.; Zhang, G. Research Progress and Challenges in Vaccine Development against Classical Swine Fever Virus. Viruses 2021, 13, 445. [Google Scholar] [CrossRef]
- Malik, Y.S.; Bhat, S.; Kumar, O.R.V.; Yadav, A.K.; Sircar, S.; Ansari, M.I.; Sarma, D.K.; Rajkhowa, T.K.; Ghosh, S.; Dhama, K. Classical Swine Fever Virus Biology, Clinicopathology, Diagnosis, Vaccines and a Meta-Analysis of Prevalence: A Review from the Indian Perspective. Pathogens 2020, 9, 500. [Google Scholar] [CrossRef]
- Dewulf, J.; Laevens, H.; Koenen, F.; Mintiens, K.; De Kruif, A. An experimental infection with classical swine fever virus in pregnant sows: Transmission of the virus, course of the disease, antibody response and effect on gestation. J. Vet. Med. B Infect. Dis. Vet. Public Health 2001, 48, 583–591. [Google Scholar] [CrossRef]
- Fan, J.; Liao, Y.; Zhang, M.; Liu, C.; Li, Z.; Li, Y.; Li, X.; Wu, K.; Yi, L.; Ding, H.; et al. Anti-Classical Swine Fever Virus Strategies. Microorganisms 2021, 9, 761. [Google Scholar] [CrossRef]
- Li, S.; Wang, J.; Yang, Q.; Naveed Anwar, M.; Yu, S.; Qiu, H.J. Complex Virus-Host Interactions Involved in the Regulation of Classical Swine Fever Virus Replication: A Minireview. Viruses 2017, 9, 171. [Google Scholar] [CrossRef] [Green Version]
- Sheng, C.; Yao, Y.; Chen, B.; Wang, Y.; Chen, J.; Xiao, M. RNA helicase is involved in the expression and replication of classical swine fever virus and interacts with untranslated region. Virus Res. 2013, 171, 257–261. [Google Scholar] [CrossRef]
- Bauhofer, O.; Summerfield, A.; Sakoda, Y.; Tratschin, J.D.; Hofmann, M.A.; Ruggli, N. Classical swine fever virus Npro interacts with interferon regulatory factor 3 and induces its proteasomal degradation. J. Virol. 2007, 81, 3087–3096. [Google Scholar] [CrossRef] [Green Version]
- Fiebach, A.R.; Guzylack-Piriou, L.; Python, S.; Summerfield, A.; Ruggli, N. Classical swine fever virus N(pro) limits type I interferon induction in plasmacytoid dendritic cells by interacting with interferon regulatory factor 7. J. Virol. 2011, 85, 8002–8011. [Google Scholar] [CrossRef] [Green Version]
- Li, D.; Li, S.; Sun, Y.; Dong, H.; Li, Y.; Zhao, B.; Guo, D.; Weng, C.; Qiu, H.J. Poly(C)-binding protein 1, a novel N(pro)-interacting protein involved in classical swine fever virus growth. J. Virol. 2013, 87, 2072–2080. [Google Scholar] [CrossRef] [Green Version]
- Johns, H.L.; Doceul, V.; Everett, H.; Crooke, H.; Charleston, B.; Seago, J. The classical swine fever virus N-terminal protease N(pro) binds to cellular HAX-1. J. Gen. Virol. 2010, 91, 2677–2686. [Google Scholar] [CrossRef]
- Gladue, D.P.; Holinka, L.G.; Fernandez-Sainz, I.J.; Prarat, M.V.; O’Donell, V.; Vepkhvadze, N.; Lu, Z.; Rogers, K.; Risatti, G.R.; Borca, M.V. Effects of the interactions of classical swine fever virus Core protein with proteins of the SUMOylation pathway on virulence in swine. Virology 2010, 407, 129–136. [Google Scholar] [CrossRef] [Green Version]
- Gladue, D.P.; Holinka, L.G.; Fernandez-Sainz, I.J.; Prarat, M.V.; O’Donnell, V.; Vepkhvadze, N.G.; Lu, Z.; Risatti, G.R.; Borca, M.V. Interaction between Core protein of classical swine fever virus with cellular IQGAP1 protein appears essential for virulence in swine. Virology 2011, 412, 68–74. [Google Scholar] [CrossRef]
- Gladue, D.P.; O’Donnell, V.; Fernandez-Sainz, I.J.; Fletcher, P.; Baker-Branstetter, R.; Holinka, L.G.; Sanford, B.; Carlson, J.; Lu, Z.; Borca, M.V. Interaction of structural core protein of classical swine fever virus with endoplasmic reticulum-associated degradation pathway protein OS9. Virology 2014, 460–461, 173–179. [Google Scholar] [CrossRef] [Green Version]
- Wright, J.F.; Kurosky, A.; Pryzdial, E.L.; Wasi, S. Host cellular annexin II is associated with cytomegalovirus particles isolated from cultured human fibroblasts. J. Virol. 1995, 69, 4784–4791. [Google Scholar] [CrossRef] [Green Version]
- Yang, Z.; Shi, Z.; Guo, H.; Qu, H.; Zhang, Y.; Tu, C. Annexin 2 is a host protein binding to classical swine fever virus E2 glycoprotein and promoting viral growth in PK-15 cells. Virus Res. 2015, 201, 16–23. [Google Scholar] [CrossRef]
- Sheng, C.; Liu, X.; Jiang, Q.; Xu, B.; Zhou, C.; Wang, Y.; Chen, J.; Xiao, M. Annexin A2 is involved in the production of classical swine fever virus infectious particles. J. Gen. Virol. 2015, 96, 1027–1032. [Google Scholar] [CrossRef]
- Zhang, C.; Kang, K.; Ning, P.; Peng, Y.; Lin, Z.; Cui, H.; Cao, Z.; Wang, J.; Zhang, Y. Heat shock protein 70 is associated with CSFV NS5A protein and enhances viral RNA replication. Virology 2015, 482, 9–18. [Google Scholar] [CrossRef] [Green Version]
- Proto, M.C.; Fiore, D.; Piscopo, C.; Pagano, C.; Galgani, M.; Bruzzaniti, S.; Laezza, C.; Gazzerro, P.; Bifulco, M. Lipid homeostasis and mevalonate pathway in COVID-19: Basic concepts and potential therapeutic targets. Prog. Lipid Res. 2021, 82, 101099. [Google Scholar] [CrossRef]
- Xi, Y.; Lindenmayer, L.; Kline, I.; von Einem, J.; Purdy, J.G. Human Cytomegalovirus Uses a Host Stress Response to Balance the Elongation of Saturated/Monounsaturated and Polyunsaturated Very-Long-Chain Fatty Acids. Mbio 2021, 12, e00167-21. [Google Scholar] [CrossRef]
- Spencer, C.M.; Schafer, X.L.; Moorman, N.J.; Munger, J. Human cytomegalovirus induces the activity and expression of acetyl-coenzyme A carboxylase, a fatty acid biosynthetic enzyme whose inhibition attenuates viral replication. J. Virol. 2011, 85, 5814–5824. [Google Scholar] [CrossRef] [Green Version]
- Yuan, S.; Chu, H.; Chan, J.F.; Ye, Z.W.; Wen, L.; Yan, B.; Lai, P.M.; Tee, K.M.; Huang, J.; Chen, D.; et al. SREBP-dependent lipidomic reprogramming as a broad-spectrum antiviral target. Nat. Commun. 2019, 10, 120. [Google Scholar] [CrossRef]
- Hulse, M.; Johnson, S.M.; Boyle, S.; Caruso, L.B.; Tempera, I. Epstein-Barr Virus-Encoded Latent Membrane Protein 1 and B-Cell Growth Transformation Induce Lipogenesis through Fatty Acid Synthase. J. Virol. 2021, 95, e01857-20. [Google Scholar] [CrossRef]
- Wilsky, S.; Sobotta, K.; Wiesener, N.; Pilas, J.; Althof, N.; Munder, T.; Wutzler, P.; Henke, A. Inhibition of fatty acid synthase by amentoflavone reduces coxsackievirus B3 replication. Arch. Virol. 2012, 157, 259–269. [Google Scholar] [CrossRef]
- Ohol, Y.M.; Wang, Z.; Kemble, G.; Duke, G. Direct Inhibition of Cellular Fatty Acid Synthase Impairs Replication of Respiratory Syncytial Virus and Other Respiratory Viruses. PLoS ONE 2015, 10, e0144648. [Google Scholar]
- Kapadia, S.B.; Chisari, F.V. Hepatitis C virus RNA replication is regulated by host geranylgeranylation and fatty acids. Proc. Natl. Acad. Sci. USA 2005, 102, 2561–2566. [Google Scholar] [CrossRef] [Green Version]
- Dias, S.S.G.; Soares, V.C.; Ferreira, A.C.; Sacramento, C.Q.; Fintelman-Rodrigues, N.; Temerozo, J.R.; Teixeira, L.; Nunes da Silva, M.A.; Barreto, E.; Mattos, M.; et al. Lipid droplets fuel SARS-CoV-2 replication and production of inflammatory mediators. PLoS Path. 2020, 16, e1009127. [Google Scholar] [CrossRef]
- Vogt, D.A.; Camus, G.; Herker, E.; Webster, B.R.; Tsou, C.L.; Greene, W.C.; Yen, T.S.; Ott, M. Lipid droplet-binding protein TIP47 regulates hepatitis C Virus RNA replication through interaction with the viral NS5A protein. PLoS Path. 2013, 9, e1003302. [Google Scholar] [CrossRef]
- Hou, W.; Cruz-Cosme, R.; Armstrong, N.; Obwolo, L.A.; Wen, F.; Hu, W.; Luo, M.H.; Tang, Q. Molecular cloning and characterization of the genes encoding the proteins of Zika virus. Gene 2017, 628, 117–128. [Google Scholar] [CrossRef] [Green Version]
- Samsa, M.M.; Mondotte, J.A.; Iglesias, N.G.; Assunção-Miranda, I.; Barbosa-Lima, G.; Da Poian, A.T.; Bozza, P.T.; Gamarnik, A.V. Dengue virus capsid protein usurps lipid droplets for viral particle formation. PLoS Path. 2009, 5, e1000632. [Google Scholar] [CrossRef]
- Martins, A.S.; Carvalho, F.A.; Faustino, A.F.; Martins, I.C.; Santos, N.C. West Nile Virus Capsid Protein Interacts with Biologically Relevant Host Lipid Systems. Front. Cell Infect. Microbiol. 2019, 9, 8. [Google Scholar] [CrossRef] [Green Version]
- Cheung, W.; Gill, M.; Esposito, A.; Kaminski, C.F.; Courousse, N.; Chwetzoff, S.; Trugnan, G.; Keshavan, N.; Lever, A.; Desselberger, U. Rotaviruses associate with cellular lipid droplet components to replicate in viroplasms, and compounds disrupting or blocking lipid droplets inhibit viroplasm formation and viral replication. J. Virol. 2010, 84, 6782–6798. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Episcopio, D.; Aminov, S.; Benjamin, S.; Germain, G.; Datan, E.; Landazuri, J.; Lockshin, R.A.; Zakeri, Z. Atorvastatin restricts the ability of influenza virus to generate lipid droplets and severely suppresses the replication of the virus. FASEB J. 2019, 33, 9516–9525. [Google Scholar] [CrossRef] [PubMed]
- Jia, M.; Qin, D.; Zhao, C.; Chai, L.; Yu, Z.; Wang, W.; Tong, L.; Lv, L.; Wang, Y.; Rehwinkel, J.; et al. Redox homeostasis maintained by GPX4 facilitates STING activation. Nat. Immunol. 2020, 21, 727–735. [Google Scholar] [CrossRef] [PubMed]
- Mesquita, F.S.; Abrami, L.; Sergeeva, O.; Turelli, P.; Qing, E.; Kunz, B.; Raclot, C.; Paz Montoya, J.; Abriata, L.A.; Gallagher, T.; et al. S-acylation controls SARS-CoV-2 membrane lipid organization and enhances infectivity. Dev. Cell 2021, 56, 2790–2807.e8. [Google Scholar] [CrossRef]
- Ma, S.; Mao, Q.; Chen, W.; Zhao, M.; Wu, K.; Song, D.; Li, X.; Zhu, E.; Fan, S.; Yi, L.; et al. Serum Lipidomics Analysis of Classical Swine Fever Virus Infection in Piglets and Emerging Role of Free Fatty Acids in Virus Replication in vitro. Front. Cell Infect. Microbiol. 2019, 9, 410. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.Y.; Liang, X.D.; Liu, C.C.; Cheng, Y.; Chen, H.; Baloch, A.S.; Zhang, J.; Go, Y.Y.; Zhou, B. Fatty Acid Synthase Is Involved in Classical Swine Fever Virus Replication by Interaction with NS4B. J. Virol. 2021, 95, e0078121. [Google Scholar] [CrossRef]
- Gao, Y.; Hu, J.H.; Liang, X.D.; Chen, J.; Liu, C.C.; Liu, Y.Y.; Cheng, Y.; Go, Y.Y.; Zhou, B. Curcumin inhibits classical swine fever virus replication by interfering with lipid metabolism. Vet. Microbiol. 2021, 259, 109152. [Google Scholar] [CrossRef]
- Zhou, Y.; Zhou, B.; Pache, L.; Chang, M.; Khodabakhshi, A.H.; Tanaseichuk, O.; Benner, C.; Chanda, S.K. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat. Commun. 2019, 10, 1523. [Google Scholar] [CrossRef]
- Yu, S.; Yin, C.; Song, K.; Li, S.; Zheng, G.L.; Li, L.F.; Wang, J.; Li, Y.; Luo, Y.; Sun, Y.; et al. Engagement of cellular cholesterol in the life cycle of classical swine fever virus: Its potential as an antiviral target. J. Gen. Virol. 2019, 100, 156–165. [Google Scholar] [CrossRef]
- Zhang, L.; Wang, T.; Yi, Y.; Song, M.; Jin, M.; Guo, K.; Zhang, Y. ARF1 with Sec7 domain-dependent GBF1 activates coatomer protein I to support classical swine fever virus entry. J. Virol. 2022, 96, e02193-21. [Google Scholar] [CrossRef]
- Liang, X.D.; Zhang, Y.N.; Liu, C.C.; Chen, J.; Chen, X.N.; Sattar Baloch, A.; Zhou, B. U18666A inhibits classical swine fever virus replication through interference with intracellular cholesterol trafficking. Vet. Microbiol. 2019, 238, 108436. [Google Scholar] [CrossRef] [PubMed]
- Aurubin, C.A.; Knaack, D.A.; Sahoo, D.; Tarakanova, V.L. Low-density lipoprotein receptor (LDL-R) suppresses endogenous cholesterol synthesis pathway to oppose gammaherpesvirus replication in primary macrophages. J. Virol. 2021, 95, e0064921. [Google Scholar] [CrossRef] [PubMed]
- Albecka, A.; Belouzard, S.; Op de Beeck, A.; Descamps, V.; Goueslain, L.; Bertrand-Michel, J.; Tercé, F.; Duverlie, G.; Rouillé, Y.; Dubuisson, J. Role of low-density lipoprotein receptor in the hepatitis C virus life cycle. Hepatology 2012, 55, 998–1007. [Google Scholar] [CrossRef] [PubMed]
- Finkelshtein, D.; Werman, A.; Novick, D.; Barak, S.; Rubinstein, M. LDL receptor and its family members serve as the cellular receptors for vesicular stomatitis virus. Proc. Natl. Acad. Sci. USA 2013, 110, 7306–7311. [Google Scholar] [CrossRef] [Green Version]
- Syed, G.H.; Tang, H.; Khan, M.; Hassanein, T.; Liu, J.; Siddiqui, A. Hepatitis C virus stimulates low-density lipoprotein receptor expression to facilitate viral propagation. J. Virol. 2014, 88, 2519–2529. [Google Scholar] [CrossRef] [Green Version]
- Lange, P.T.; Darrah, E.J.; Vonderhaar, E.P.; Mboko, W.P.; Rekow, M.M.; Patel, S.B.; Sidjanin, D.J.; Tarakanova, V.L. Type I Interferon Counteracts Antiviral Effects of Statins in the Context of Gammaherpesvirus Infection. J. Virol. 2016, 90, 3342–3354. [Google Scholar] [CrossRef] [Green Version]
- Low, H.; Mukhamedova, N.; Cui, H.L.; McSharry, B.P.; Avdic, S.; Hoang, A.; Ditiatkovski, M.; Liu, Y.; Fu, Y.; Meikle, P.J.; et al. Cytomegalovirus Restructures Lipid Rafts via a US28/CDC42-Mediated Pathway, Enhancing Cholesterol Efflux from Host Cells. Cell Rep. 2016, 16, 186–200. [Google Scholar] [CrossRef] [Green Version]
- Amet, T.; Nonaka, M.; Dewan, M.Z.; Saitoh, Y.; Qi, X.; Ichinose, S.; Yamamoto, N.; Yamaoka, S. Statin-induced inhibition of HIV-1 release from latently infected U1 cells reveals a critical role for protein prenylation in HIV-1 replication. Microbes Infect. 2008, 10, 471–480. [Google Scholar] [CrossRef]
- Kim, S.S.; Peng, L.F.; Lin, W.; Choe, W.H.; Sakamoto, N.; Kato, N.; Ikeda, M.; Schreiber, S.L.; Chung, R.T. A cell-based, high-throughput screen for small molecule regulators of hepatitis C virus replication. Gastroenterology 2007, 132, 311–320. [Google Scholar] [CrossRef] [Green Version]
- Martínez-Gutierrez, M.; Castellanos, J.E.; Gallego-Gómez, J.C. Statins reduce dengue virus production via decreased virion assembly. Intervirology 2011, 54, 202–216. [Google Scholar] [CrossRef]
- Hui, K.P.; Kuok, D.I.; Kang, S.S.; Li, H.S.; Ng, M.M.; Bui, C.H.; Peiris, J.S.; Chan, R.W.; Chan, M.C. Modulation of sterol biosynthesis regulates viral replication and cytokine production in influenza A virus infected human alveolar epithelial cells. Antivir. Res. 2015, 119, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Werner, B.; Dittmann, S.; Funke, C.; Überla, K.; Piper, C.; Niehaus, K.; Horstkotte, D.; Farr, M. Effect of lovastatin on coxsackievirus B3 infection in human endothelial cells. Inflamm. Res. 2014, 63, 267–276. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Qin, Y.; Chen, M. Viral strategies for triggering and manipulating mitophagy. Autophagy 2018, 14, 1665–1673. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bah, S.Y.; Dickinson, P.; Forster, T.; Kampmann, B.; Ghazal, P. Immune oxysterols: Role in mycobacterial infection and inflammation. J. Steroid Biochem. Mol. Biol. 2017, 169, 152–163. [Google Scholar] [CrossRef] [Green Version]
- Wudiri, G.A.; Pritchard, S.M.; Li, H.; Liu, J.; Aguilar, H.C.; Gilk, S.D.; Nicola, A.V. Molecular requirement for sterols in herpes simplex virus entry and infectivity. J. Virol. 2014, 88, 13918–13922. [Google Scholar] [CrossRef] [Green Version]
- McCrae, C.; Dzgoev, A.; Ståhlman, M.; Horndahl, J.; Svärd, R.; Große, A.; Großkopf, T.; Skujat, M.A.; Williams, N.; Schubert, S.; et al. Lanosterol Synthase Regulates Human Rhinovirus Replication in Human Bronchial Epithelial Cells. Am. J. Respir. Cell Mol. Biol. 2018, 59, 713–722. [Google Scholar] [CrossRef]
- York, A.G.; Williams, K.J.; Argus, J.P.; Zhou, Q.D.; Brar, G.; Vergnes, L.; Gray, E.E.; Zhen, A.; Wu, N.C.; Yamada, D.H.; et al. Limiting Cholesterol Biosynthetic Flux Spontaneously Engages Type I IFN Signaling. Cell 2015, 163, 1716–1729. [Google Scholar] [CrossRef] [Green Version]
Primers | Sequences (5′ to 3′) | Amplicon (bp) |
---|---|---|
LDLR-JD | TGCATAGCCAGACTCTCTTGG | 904 |
TGTGATCTCCCATTGCAATCTA | ||
SQLE-JD | GGTGTCACCGAAGAAGCCTT | 819 |
GAACCTCCATATGCCGCTGG | ||
HSD17B7-JD | GGAAGGCTATTGCAAGTGCC | 933 |
TGGGTCTCACTGACGTCTCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zou, X.; Lin, F.; Yang, Y.; Chen, J.; Zhang, H.; Li, L.; Ouyang, H.; Pang, D.; Tang, X. Cholesterol Biosynthesis Modulates CSFV Replication. Viruses 2022, 14, 1450. https://doi.org/10.3390/v14071450
Zou X, Lin F, Yang Y, Chen J, Zhang H, Li L, Ouyang H, Pang D, Tang X. Cholesterol Biosynthesis Modulates CSFV Replication. Viruses. 2022; 14(7):1450. https://doi.org/10.3390/v14071450
Chicago/Turabian StyleZou, Xiaodong, Feng Lin, Yang Yang, Jiahuan Chen, Huanyu Zhang, Linquan Li, Hongsheng Ouyang, Daxin Pang, and Xiaochun Tang. 2022. "Cholesterol Biosynthesis Modulates CSFV Replication" Viruses 14, no. 7: 1450. https://doi.org/10.3390/v14071450