First Detection and Molecular Characterization of Novel Variant Infectious Bursal Disease Virus (Genotype A2dB1b) in Egypt
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sampling Activities
2.2. Samples Processing and Nucleic Acid Extraction
2.3. Molecular Investigation
2.4. Phylogenetic Analyses
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Eterradossi, N.; Saif, Y.M. Infectious bursal disease. In Diseases of Poultry, 14th ed.; Swayne, D.E., Boulianne, M., Logue, C.M., McDougald, L.R., Nair, V., Suarez, D.L., Eds.; Wiley-Blackwell: Hoboken, NJ, USA, 2020; Volume 1, pp. 257–283. [Google Scholar]
- Alkie, T.N.; Rautenschlein, S. Infectious bursal disease virus in poultry: Current status and future prospects. Vet. Med. 2016, 19, 9–18. [Google Scholar]
- Maraver, A.; Ona, A.; Abaitua, F.; Gonzalez, D.; Clemente, R.; Ruiz-Diaz, J.A.; Caston, J.R.; Pazos, F.; Rodriguez, J.F. The oligomerization domain of VP3, the scaffolding protein of infectious bursal disease virus, plays a critical role in capsid assembly. J. Virol. 2003, 77, 6438–6449. [Google Scholar] [CrossRef] [PubMed]
- Pikuła, A.; Lisowska, A.; Jasik, A.; Perez, L.J. The Novel Genetic Background of Infectious Bursal Disease Virus Strains Emerging from the Action of Positive Selection. Viruses 2021, 13, 396. [Google Scholar] [CrossRef] [PubMed]
- Cosgrove, A.S. An apparently new disease of chickens: Avian nephrosis. Avian Dis. 1962, 6, 385–389. [Google Scholar] [CrossRef]
- Lasher, H.; Davis, V. History of infectious bursal disease in the U.S.A.: The first two decades. Avian Dis. 1997, 41, 11–19. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Wang, X.; Gao, Y.; Qi, X. The Over-40-years-epidemic of infectious bursal disease virus in China. Viruses 2022, 14, 2253. [Google Scholar] [CrossRef] [PubMed]
- Sapats, S.I.; Ignjatovic, J. Antigenic and sequence heterogeneity of infectious bursal disease virus strains isolated in Australia. Arch. Virol. 2000, 145, 773–785. [Google Scholar] [CrossRef] [PubMed]
- Jackwood, D.J. Molecular epidemiologic evidence of homologous recombination in infectious bursal disease viruses. Avian Dis. 2012, 56, 574–577. [Google Scholar] [CrossRef]
- Hernández, M.; Tomás, G.; Marandino, A.; Iraola, G.; Maya, L.; Mattion, N.; Hernández, D.; Villegas, P.; Banda, A.; Panzera, Y.; et al. Genetic characterization of South American infectious bursal disease virus reveals the existence of a distinct worldwide-spread genetic lineage. Avian Pathol. 2015, 44, 212–221. [Google Scholar] [CrossRef]
- Lupini, C.; Giovanardi, D.; Pesente, P.; Bonci, M.; Felice, V.; Rossi, G.; Morandini, E.; Cecchinato, M.; Catelli, E. A molecular epidemiology study based on VP2 gene sequences reveals that a new genotype of infectious bursal disease virus is dominantly prevalent in Italy. Avian Pathol. 2016, 45, 458–464. [Google Scholar] [CrossRef]
- Legnardi, M.; Franzo, G.; Tucciarone, C.M.; Koutoulis, K.; Duarte, I.; Silva, M.; Le Tallec, B.; Cecchinato, M. Detection and molecular characterization of a new genotype of infectious bursal disease virus in Portugal. Avian Pathol. 2022, 51, 97–105. [Google Scholar] [CrossRef] [PubMed]
- Abed, M.; Soubies, S.; Courtillon, C.; Briand, F.X.; Allée, C.; Amelot, M.; De Boisseson, C.; Lucas, P.; Blanchard, Y.; Belahouel, A.; et al. Infectious bursal disease virus in Algeria: Detection of highly pathogenic reassortant viruses. Infect. Genet. Evol. 2018, 60, 48–57. [Google Scholar] [CrossRef] [PubMed]
- Pikuła, A.; Lisowska, A.; Jasik, A.; Śmietanka, K. Identification and assessment of virulence of a natural reassortant of infectious bursal disease virus. Vet. Res. 2018, 49, 89. [Google Scholar] [CrossRef] [PubMed]
- Mató, T.; Tatár-Kis, T.; Felföldi, B.; Jansson, D.S.; Homonnay, Z.; Bányai, K.; Palya, V. Occurrence and spread of a reassortant very virulent genotype of infectious bursal disease virus with altered VP2 amino acid profile and pathogenicity in some European countries. Vet. Microbiol. 2020, 245, 108663. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Jiang, N.; Fan, L.; Niu, X.; Zhang, W.; Huang, M.; Gao, L.; Li, K.; Gao, Y.; Liu, C.; et al. Identification and Pathogenicity Evaluation of a Novel Reassortant Infectious Bursal Disease Virus (Genotype A2dB3). Viruses 2021, 13, 1682. [Google Scholar] [CrossRef]
- Michel, L.O.; Jackwood, D.J. Classification of infectious bursal disease virus into genogroups. Arch. Virol. 2017, 162, 3661–3670. [Google Scholar] [CrossRef] [PubMed]
- Islam, M.R.; Nooruzzaman, M.; Rahman, T.; Mumu, T.T.; Rahman, M.M.; Chowdhury, E.H.; Eterradossi, N.; Müller, H. A unified genotypic classification of infectious bursal disease virus based on both genome segments. Avian Pathol. 2021, 50, 190–206. [Google Scholar] [CrossRef]
- Wang, Y.L.; Fan, L.J.; Jiang, N.; Li, G.A.O.; Kai, L.I.; Gao, Y.L.; Liu, C.J.; Cui, H.Y.; Pan, Q.; Zhang, Y.P.; et al. An improved scheme for infectious bursal disease virus genotype classification based on both genome-segments A and B. J. Integr. Agric. 2021, 20, 1372–1381. [Google Scholar] [CrossRef]
- Letzel, T.; Coulibaly, F.; Rey, F.A.; Delmas, B.; Jagt, E.; Van Loon, A.A.; Mundt, E. Molecular and structural bases for the antigenicity of VP2 of infectious bursal disease virus. J. Virol. 2007, 81, 12827–12835. [Google Scholar] [CrossRef]
- Escaffre, O.; Le Nouën, C.; Amelot, M.; Ambroggio, X.; Ogden, K.M.; Guionie, O.; Toquin, D.; Müller, H.; Islam, M.R.; Eterradossi, N. Both genome segments contribute to the pathogenicity of very virulent infectious bursal disease virus. J. Virol. 2013, 87, 2767–2780. [Google Scholar] [CrossRef]
- He, X.; Chen, G.; Yang, L.; Xuan, J.; Long, H.; Wei, P. Role of naturally occurring genome segment reassortment in the pathogenicity of IBDV field isolates in Three-Yellow chickens. Avian Pathol. 2016, 45, 178–186. [Google Scholar] [CrossRef] [PubMed]
- El-Batrawy, A. Studies on Severe Outbreaks of Infectious Bursal Disease. In Proceedings of the 2nd Scientific Conference of the Egyptian Veterinary Poultry Association, Cairo, Egypt, 12–14 March 1990. [Google Scholar]
- Mawgod, S.A.; Arafa, A.S.; Hussein, H.A. Molecular genotyping of the infectious bursal disease virus (IBDV) isolated from broiler flocks in Egypt. Int. J. Vet. Sci. Med. 2014, 2, 46–52. [Google Scholar] [CrossRef]
- Shehata, A.A.; Sultan, H.; Halami, M.Y.; Talaat, S.; Vahlenkamp, T.W. Molecular characterization of very virulent infectious bursal disease virus strains circulating in Egypt from 2003 to 2014. Arch. Virol. 2017, 162, 3803–3815. [Google Scholar] [CrossRef] [PubMed]
- Samy, A.; Courtillon, C.; Briand, F.X.; Khalifa, M.; Selim, A.; Hegazy, A.; Eterradossi, N.; Soubies, S.M. Continuous circulation of an antigenically modified very virulent infectious bursal disease virus for fifteen years in Egypt. Infect. Genet. Evol. 2020, 78, 104099. [Google Scholar] [CrossRef]
- Jackwood, D.J.; Sommer-Wagner, S.E. Molecular Epidemiology of Infectious Bursal Disease Viruses: Distribution and Genetic Analysis of Newly Emerging Viruses in the United States. Avian Dis. 2005, 49, 220–226. [Google Scholar] [CrossRef] [PubMed]
- Lachheb, J.; Jbenyeni, A.; Nsiri, J.; Larbi, I.; Ammouna, F.; Ghram, A. Full-length genome sequencing of a very virulent infectious bursal disease virus isolated in Tunisia. Poult. Sci. 2021, 100, 496–506. [Google Scholar] [CrossRef]
- Hernández, M.; Villegas, P.; Hernández, D.; Banda, A.; Maya, L.; Romero, V.; Tomás, G.; Pérez, R. Sequence variability and evolution of the terminal overlapping VP5 gene of the infectious bursal disease virus. Virus Genes 2010, 41, 59–66. [Google Scholar] [CrossRef]
- Rudd, M.F.; Heine, H.G.; Sapats, S.I.; Parede, L.; Ignjatovic, J. Characterisation of an Indonesian very virulent strain of infectious bursal disease virus. Arch. Virol. 2002, 147, 1303–1322. [Google Scholar] [CrossRef]
- Islam, M.R.; Rahman, S.; Noor, M.; Chowdhury, E.H.; Müller, H. Differentiation of infectious bursal disease virus (IBDV) genome segment B of very virulent and classical lineage by RT-PCR amplification and restriction enzyme analysis. Arch. Virol. 2011, 157, 333–336. [Google Scholar] [CrossRef]
- He, X.; Xiong, Z.; Yang, L.; Guan, D.; Yang, X.; Wei, P. Molecular epidemiology studies on partial sequences of both genome segments reveal that reassortant infectious bursal disease viruses were dominantly prevalent in southern China during 2000–2012. Arch. Virol. 2014, 159, 3279–3292. [Google Scholar] [CrossRef]
- Tiwari, A.K.; Kataria, R.S.; Prasad, N.; Gupta, R. Differentiation of infectious bursal disease viruses by restriction enzyme analysis of RT-PCR amplified VP1 gene sequence. Comp. Immunol. Microbiol. Infect. Dis. 2003, 26, 47–53. [Google Scholar] [CrossRef] [PubMed]
- Mundt, E.; Vakharia, V.N. Synthetic transcripts of double-stranded Birnavirus genome are infectious. Proc. Natl. Acad. Sci. USA 1996, 93, 11131–11136. [Google Scholar] [CrossRef] [PubMed]
- Alfonso-Morales, A.; Rios, L.; Martínez-Pérez, O.; Dolz, R.; Valle, R.; Perera, C.L.; Bertran, K.; Frias, M.T.; Ganges, L.; Diaz de Arce, H.; et al. Evaluation of a phylogenetic marker based on genomic segment B of infectious bursal disease virus: Facilitating a feasible incorporation of this segment to the molecular epidemiology studies for this viral agent. PLoS ONE 2015, 10, e0125853. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; He, X.; Zhang, Y.; Qiao, Y.; Shi, J.; Chen, R.; Chen, J.; Xiang, Y.; Wang, Z.; Chen, G.; et al. Analysis of the global origin, evolution and transmission dynamics of the emerging novel variant IBDV (A2dB1b): The accumulation of critical aa-residue mutations and commercial trade contributes to the emergence and transmission of novel variants. Transbound. Emerg. Dis. 2022, 69, e2832–e2851. [Google Scholar] [CrossRef] [PubMed]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef] [PubMed]
- Kimura, M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef]
- QGIS. Available online: https://www.qgis.org/ (accessed on 11 November 2023).
- Database of Global Administrative Areas (GADM). Available online: https://gadm.org/ (accessed on 11 November 2023).
- Mosad, S.M.; Eladl, A.H.; El-Tholoth, M.; Ali, H.S.; Hamed, M.F. Molecular characterization and pathogenicity of very virulent infectious bursal disease virus isolated from naturally infected Turkey poults in Egypt. Trop. Anim. Health Prod. 2020, 52, 3819–3831. [Google Scholar] [CrossRef]
- El Naggar, R.F.; Rohaim, M.A.; Munir, M. Potential reverse spillover of infectious bursal disease virus at the interface of commercial poultry and wild birds. Virus Genes 2020, 56, 705–711. [Google Scholar] [CrossRef]
- Fan, L.; Wu, T.; Hussain, A.; Gao, Y.; Zeng, X.; Wang, Y.; Gao, L.; Li, K.; Wang, Y.; Liu, C.; et al. Novel variant strains of infectious bursal disease virus isolated in China. Vet. Microbiol. 2019, 230, 212–220. [Google Scholar] [CrossRef]
- Wang, W.; Huang, Y.; Zhang, Y.; Qiao, Y.; Deng, Q.; Chen, R.; Chen, J.; Huang, T.; Wei, T.; Mo, M.; et al. The emerging naturally reassortant strain of IBDV (genotype A2dB3) having segment A from Chinese novel variant strain and segment B from HLJ 0504-like very virulent strain showed enhanced pathogenicity to three-yellow chickens. Transbound. Emerg. Dis. 2022, 69, e566–e579. [Google Scholar] [CrossRef] [PubMed]
- Aliyu, H.B.; Hair-Bejo, M.; Omar, A.R.; Ideris, A. Genetic diversity of recent infectious bursal disease viruses isolated from vaccinated poultry flocks in Malaysia. Front. Vet. Sci. 2021, 8, 643976. [Google Scholar] [CrossRef]
- Thai, T.N.; Jang, I.; Kim, H.A.; Kim, H.S.; Kwon, Y.K.; Kim, H.R. Characterization of antigenic variant infectious bursal disease virus strains identified in South Korea. Avian Pathol. 2021, 50, 174–181. [Google Scholar] [CrossRef] [PubMed]
- Thai, T.N.; Yoo, D.S.; Jang, I.; Kwon, Y.K.; Kim, H.R. Dynamics of the Emerging Genogroup of Infectious Bursal Disease Virus Infection in Broiler Farms in South Korea: A Nationwide Study. Viruses 2022, 14, 1604. [Google Scholar] [CrossRef]
- Myint, O.; Suwanruengsri, M.; Araki, K.; Izzati, U.Z.; Pornthummawat, A.; Nueangphuet, P.; Fuke, N.; Hirai, T.; Jackwood, D.J.; Yamaguchi, R. Bursa atrophy at 28 days old caused by variant infectious bursal disease virus has a negative economic impact on broiler farms in Japan. Avian Pathol. 2021, 50, 6–17. [Google Scholar] [CrossRef] [PubMed]
- Ren, X.; Xue, C.; Zhang, Y.; Chen, F.; Cao, Y. Genomic analysis of one Chinese strain YS07 of infectious bursal disease virus reveals unique genetic diversity. Virus Genes 2009, 39, 246–248. [Google Scholar] [CrossRef] [PubMed]
- Legnardi, M.; Poletto, F.; Alam, S.; Cherfane, A.; Le-Tallec, B.; Franzo, G.; Tucciarone, C.M.; Lupini, C.; Pasotto, D.; Cecchinato, M. Molecular epidemiology of infectious bursal disease virus in the Near East and Persian Gulf regions. Avian Pathol. 2023. just-accepted. [Google Scholar] [CrossRef]
- Shegu, D.; Sori, T.; Tesfaye, A.; Belay, A.; Mohammed, H.; Degefa, T.; Getachew, B.; Abayneh, T.; Gelaye, E. Sequence-based comparison of field and vaccine strains of infectious bursal disease virus in Ethiopia reveals an amino acid mismatch in the immunodominant VP2 protein. Arch. Virol. 2020, 165, 1367–1375. [Google Scholar] [CrossRef]
- Omer, M.G.; Khalafalla, A.I. Epidemiology and laboratory diagnosis of very virulent infectious bursal disease virus in vaccinated chickens in Khartoum, Sudan. Open Vet. J. 2022, 12, 33–43. [Google Scholar] [CrossRef]
- Ramzy, N.; Abdel-fattah, S. Prevalence and molecular characterization of Gumboro virus in chicken farms in Ismailia. Assiut Vet. Med. J. 2015, 61, 152–159. [Google Scholar]
- Omar, S.E.; El Sayed, W.A.E.M.; Abdelhalim, A.; Yehia, N. Genetic evolution of infectious bursal disease virus isolated from chicken poultry flocks in Egypt. J. World Poult. Res. 2021, 11, 215–222. [Google Scholar] [CrossRef]
- Awad, N.; Morsi, H.; Eid, A.A.; Al-baqir, A. Epidemiological Occurrence of the Infectious Bursal Disease Virus in Chickens’ Flocks that Had Received Various Vaccination Regimens. Zagazig Vet. J. 2023, 51, 239–262. [Google Scholar] [CrossRef]
- Shahat, D.H. Detection and isolation of a recent infectious bursal disease virus from chicken farms in Egypt during 2021. Benha Vet. Med. J. 2023, 44, 74–78. [Google Scholar] [CrossRef]
- Suliman, R.A.; Ahmed, B.M.; El-Safty, M.M.; Hussien, H.A. Very virulent IBDV strain Egypt/iBDV/Behera/2011: Macroscopic and microscopic lesions accompanied with induced mortalities in SPF chicks. J. Virol. Sci. 2017, 2, 79–91. [Google Scholar]
- Gaber, H.A.H.; El-Dougdoug, K.A.; El-Masry, S.S. Isolation and Pathotyping of Infectious Bursal Disease Virus (IBDV) from Field Outbreaks among Chickens in Egypt. J. Anim. Poult. Prod. 2021, 12, 95–99. [Google Scholar] [CrossRef]
- Hassan, M.K.; Afify, M.; Aly, M.M. Susceptibility of vaccinated and unvaccinated Egyptian chickens to very virulent infectious bursal disease virus. Avian Pathol. 2022, 31, 149–156. [Google Scholar] [CrossRef]
- Sultan, H.; Hussein, H.A.; Abd El-Razik, A.G.; El-Balall, S.; Talaat, S.M.; Shehata, A.A. Efficacy of HVT-IBDV vector vaccine against recent Egyptian vvIBDV in commercial broiler chickens. Int. J. Poult. Sci. 2012, 11, 710. [Google Scholar] [CrossRef]
- Rade, N.; Sultan, H.; El-Razik, A. Efficacy of The Turkey Herpes virus-IBDV Vector Vaccine Against Recent Egyptian Very Virulent IBDV in Commercial Layers. J. Curr. Vet. Res. 2020, 2, 47–56. [Google Scholar] [CrossRef]
- Eliwa, M.G.E.D.; Talaat, S.; Tantawy, L.; El-Razik, A.; Sultan, H. Protective efficacy of IBDV winterfield H-2512 and SYZA-26 immune-complex vaccines against recent Egyptian very virulent IBDV in commercial broiler chickens. J. Curr. Vet. Res. 2022, 4, 191–200. [Google Scholar] [CrossRef]
- Xu, A.; Pei, Y.; Zhang, K.; Xue, J.; Ruan, S.; Zhang, G. Phylogenetic analyses and pathogenicity of a variant infectious bursal disease virus strain isolated in China. Virus Res. 2020, 276, 197833. [Google Scholar] [CrossRef] [PubMed]
- Lian, J.; Wang, Z.; Xu, Z.; Pang, Y.; Leng, M.; Tang, S.; Zhang, X.; Qin, J.; Chen, F.; Lin, W. Pathogenicity and molecular characterization of infectious bursal disease virus in China. Poult. Sci. 2022, 101, 101502. [Google Scholar] [CrossRef] [PubMed]
- Hou, B.; Wang, C.Y.; Luo, Z.B.; Shao, G.Q. Commercial vaccines used in China do not protect against a novel infectious bursal disease virus variant isolated in Fujian. Vet. Rec. 2022, 191, e1840. [Google Scholar] [CrossRef] [PubMed]
- Fan, L.; Wu, T.; Wang, Y.; Hussain, A.; Jiang, N.; Gao, L.; Li, K.; Gao, Y.; Liu, C.; Cui, H.; et al. Novel variants of infectious bursal disease virus can severely damage the bursa of fabricius of immunized chickens. Vet. Microbiol. 2020, 240, 108507. [Google Scholar] [CrossRef] [PubMed]
- Fan, L.; Wang, Y.; Jiang, N.; Gao, L.; Li, K.; Gao, Y.; Cui, H.; Pan, Q.; Liu, C.; Zhang, Y.; et al. A reassortment vaccine candidate of the novel variant infectious bursal disease virus. Vet. Microbiol. 2020, 251, 108905. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Kuang, H.; Guo, H.; Cai, L.; Chu, D.; Wang, X.; Hu, J.; Rong, J. Development of a recombinant VP2 vaccine for the prevention of novel variant strains of infectious bursal disease virus. Avian Pathol. 2020, 49, 557–571. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Jiang, N.; Fan, L.; Gao, L.; Li, K.; Gao, Y.; Niu, X.; Zhang, W.; Cui, H.; Liu, A.; et al. Development of a Viral-Like Particle Candidate Vaccine Against Novel Variant Infectious Bursal Disease Virus. Vaccines 2021, 9, 142. [Google Scholar] [CrossRef]
- El-Aried, T.A.; Mansour, S.M.; El Bakrey, R.M.; Ismail, A.E.N.; Eid, A.A. Infectious bursal disease virus: Molecular epidemiologic perspectives and impact on vaccine efficacy against avian influenza and Newcastle disease viruses. Avian Dis. 2019, 63, 606–618. [Google Scholar] [CrossRef]
- Ramon, G.; Legnardi, M.; Cecchinato, M.; Cazaban, C.; Tucciarone, C.M.; Fiorentini, L.; Gambi, L.; Mato, T.; Berto, G.; Koutoulis, K.; et al. Efficacy of live attenuated, vector and immune complex infectious bursal disease virus (IBDV) vaccines in preventing field strain bursa colonization: A European multicentric study. Front. Vet. Sci. 2022, 12, 978901. [Google Scholar] [CrossRef]
Genome Segment | Primer | Sequence (5′-3′) | Amplicon Length | Designed by |
---|---|---|---|---|
VP5 and VP2 (1–1263) | VP5/1+ | GGATACGATCGGTCTGAC | 1263 bp | Hernández et al. [29] |
VP2/1263- | TCAGGATTTGGGATCAGC | |||
VP2 (736–1478) | 743-1 | GCCCAGAGTCTACACCAT | 743 bp | Jackwood and Sommer-Wagner [27] |
743-2 | CCCGGATTATGTCTTTGA | |||
VP1 (1–695) | 66 | GGATACGATGGGTCTGAC | 695 bp | Ruud et al. [30] |
67 | ATCCTTGACGGCACCCTT | |||
VP1 (319–1369) | B-Univ-F | AATGAGGAGTATGAGACCGA | 1051 bp | Islam et al. [31] |
B-Univ-R | CCTTCTCTAGGTCAATTGAGTACC | |||
VP1 (756–1997) | X3 | CGGTGAGGATGACAAGCCC | 1241 bp | He et al. [32] |
VP1/1997- | GAACCCCTTTGCCTCCAAG | Tiwari et al. [33] | ||
VP1 (1839–2827) | B3-IPP2 | ATACAGCAAAGATCTCGGG | 988 bp | Mundt and Vakharia [34] |
B3′-P2 | CGATCTGCTGCAGGGGGCCCCCGCAGGCGAAGG |
Sample ID | Collection Date | Farm Location | Age at Sampling | Vaccination Protocol | Mortality * | IBDV Result |
---|---|---|---|---|---|---|
H792 | February 2023 | Cairo | 19 d | 1 d: vector vaccine | 11.2 | A2dB1b |
H793 | March 2023 | Giza | 21 d | 1 d: vector vaccine; 14 d: live vaccine | 9.7 | A2dB1b |
H794 | April 2023 | Alexandria | 23 d | 1 d: vector vaccine | 13 | Negative |
H795 | August 2022 | Damietta | 21 d | 1d: vector vaccine; 12 d: live vaccine | 13 | Negative |
H796 | June 2022 | Beheira | 25 d | 1 d: vector vaccine; 14 d: live vaccine | 10.5 | Negative |
H797 | January 2023 | Cairo | 28 d | 14 d: live vaccine; 18 d: live vaccine | 12.7 | Negative |
H798 | July 2023 | Sharqia | 22 d | 1 d: vector vaccine; 14 d: live vaccine | 9.6 | A2dB1b |
H799 | December 2022 | Giza | 30 d | 12 d: live vaccine; 18 d: live vaccine | 22.7 | Negative |
H800 | April 2022 | Beheira | 24 d | 1 d: vector vaccine; 12 d: live vaccine | 17 | A3B2 |
H801 | August 2023 | Asyut | 18 d | 12 d: live vaccine | 9.8 | A2dB1b |
H802 | February 2023 | Dakahlia | 22 d | 1 d: vector vaccine | 11.6 | Negative |
H803 | March 2023 | Sharqia | 25 d | 1 d: immune complex vaccine | 8 | Negative |
H804 | March 2023 | Sharqia | 22 d | 1 d: immune complex vaccine | 12.4 | Negative |
H805 | February 2022 | Monufia | 26 d | 12 d: live vaccine; 18 d: live vaccine | 13.8 | A3B2 |
H806 | February 2022 | Dakahlia | 26 d | 1 d: vector vaccine | 13.9 | Negative |
H807 | September 2023 | Minya | 21 d | 1 d: vector vaccine; 14 d: live vaccine | 9 | Negative |
H809 | July 2022 | Alexandria | 20 d | 12 d: live vaccine; 20 d: live vaccine | 8 | Negative |
H810 | June 2023 | Giza | 27 d | 1 d: immune complex vaccine | 16 | Negative |
H811 | April 2022 | Giza | 24 d | 1 d: immune complex vaccine | 11.5 | Negative |
H812 | August 2023 | Beheira | 19 d | 1 d: vector vaccine; 12 d: live vaccine | 8.7 | A2dB1b |
H813 | February 2022 | Ismailia | 24 d | 1 d: vector vaccine; 12 d: live vaccine | 14 | Negative |
H814 | April 2023 | Ismailia | 20 d | 1 d: vector vaccine; 12 d: live vaccine | 10.7 | Negative |
H815 | June 2022 | Port Said | 23 d | 1 d: vector vaccine | 11 | Negative |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Legnardi, M.; Poletto, F.; Talaat, S.; Selim, K.; Moawad, M.K.; Franzo, G.; Tucciarone, C.M.; Cecchinato, M.; Sultan, H. First Detection and Molecular Characterization of Novel Variant Infectious Bursal Disease Virus (Genotype A2dB1b) in Egypt. Viruses 2023, 15, 2388. https://doi.org/10.3390/v15122388
Legnardi M, Poletto F, Talaat S, Selim K, Moawad MK, Franzo G, Tucciarone CM, Cecchinato M, Sultan H. First Detection and Molecular Characterization of Novel Variant Infectious Bursal Disease Virus (Genotype A2dB1b) in Egypt. Viruses. 2023; 15(12):2388. https://doi.org/10.3390/v15122388
Chicago/Turabian StyleLegnardi, Matteo, Francesca Poletto, Shaimaa Talaat, Karim Selim, Mahmoud K. Moawad, Giovanni Franzo, Claudia Maria Tucciarone, Mattia Cecchinato, and Hesham Sultan. 2023. "First Detection and Molecular Characterization of Novel Variant Infectious Bursal Disease Virus (Genotype A2dB1b) in Egypt" Viruses 15, no. 12: 2388. https://doi.org/10.3390/v15122388