Feline Foamy Virus Transmission in Tsushima Leopard Cats (Prionailurus bengalensis euptilurus) on Tsushima Island, Japan
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Study Location
2.3. Sample Collection
2.4. PCR Amplification and Sequencing
2.5. Multiple Sequence Alignment and Phylogenetic Analysis
2.6. Statistical Analyses
3. Results
3.1. Prevalence and Demographics
3.2. FFV Co-Infection with FIV, FeLV, and FcaGHV1
3.3. Nucleotide Similarity with SU Region for FFV
3.4. Phylogenetic Analysis of FFV Based on SU Region
3.5. Nucleotide Sequence Accession Numbers
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Makundi, I.; Koshida, Y.; Endo, Y.; Nishigaki, K. Identification of Felis Catus Gammaherpesvirus 1 in Tsushima Leopard Cats (Prionailurus Bengalensis Euptilurus) on Tsushima Island, Japan. Viruses 2018, 10, 378. [Google Scholar] [CrossRef] [Green Version]
- Saitoh, T.; Kaji, K.; Izawa, M.; Yamada, F. Conservation and Management of Terrestrial Mammals in Japan: Its Organizational System and Practices. Therya 2015, 6, 139–153. [Google Scholar] [CrossRef] [Green Version]
- Makundi, I.; Koshida, Y.; Kuse, K.; Hiratsuka, T.; Ito, J.; Baba, T.; Watanabe, S.; Kawamura, M.; Odahara, Y.; Miyake, A. Epidemiologic Survey of Feline Leukemia Virus in Domestic Cats on Tsushima Island, Japan: Management Strategy for Tsushima Leopard Cats. J. Vet. Diagn. Investig. 2017, 29, 889–895. [Google Scholar] [CrossRef] [PubMed]
- Tateno, M.; Nishio, T.; Matsuo, T.; Sakuma, M.; Nakanishi, N.; Izawa, M.; Asari, Y.; Okamura, M.; Miyama, T.S.; Setoguchi, A. Epidemiological Survey of Tick-Borne Protozoal Infection in Iriomote Cats and Tsushima Leopard Cats in Japan. J. Vet. Med. Sci. 2013, 75, 13–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mitani, N.; Mihara, S.; Ishii, N.; Koike, H. Clues to the Cause of the Tsushima Leopard Cat (Prionailurus Bengalensis Euptilura) Decline from Isotopic Measurements in Three Species of Carnivora. Ecol. Res. 2009, 24, 897–908. [Google Scholar] [CrossRef]
- Hayama, S.; Yamamoto, H.; Nakanishi, S.; Hiyama, T.; Murayama, A.; Mori, H.; Sugitani, A.; Fujiwara, S. Risk Analysis of Feline Immunodeficiency Virus Infection in Tsushima Leopard Cats (Prionailurus Bengalensis Euptilurus) and Domestic Cats Using a Geographic Information System. J. Vet. Med. Sci. 2010, 72, 1003300203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tateno, M.; Nishio, T.; Sakuma, M.; Nakanishi, N.; Izawa, M.; Asari, Y.; Okamura, M.; Maruyama, S.; Miyama, T.S.; Setoguchi, A. Molecular Epidemiologic Survey of Bartonella, Ehrlichia, and Anaplasma Infections in Japanese Iriomote and Tsushima Leopard Cats. J. Wildl. Dis. 2013, 49, 646–652. [Google Scholar] [CrossRef] [Green Version]
- Nishimura, Y.; Goto, Y.; Yoneda, K.; Endo, Y.; Mizuno, T.; Hamachi, M.; Maruyama, H.; Kinoshita, H.; Koga, S.; Komori, M. Interspecies Transmission of Feline Immunodeficiency Virus from the Domestic Cat to the Tsushima Cat (Felis Bengalensis Euptilura) in the Wild. J. Virol. 1999, 73, 7916–7921. [Google Scholar] [CrossRef] [Green Version]
- Sumiyoshi, A.; Kitao, K.; Miyazawa, T. Genetic and Biological Characterization of Feline Foamy Virus Isolated from a Leopard Cat (Prionailurus Bengalensis) in Vietnam. J. Vet. Med. Sci. 2022, 84, 157–165. [Google Scholar] [CrossRef] [PubMed]
- Ledesma-Feliciano, C.; Troyer, R.M.; Zheng, X.; Miller, C.; Cianciolo, R.; Bordicchia, M.; Dannemiller, N.; Gagne, R.; Beatty, J.; Quimby, J. Feline Foamy Virus Infection: Characterization of Experimental Infection and Prevalence of Natural Infection in Domestic Cats with and without Chronic Kidney Disease. Viruses 2019, 11, 662. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alke, A.; Schwantes, A.; Zemba, M.; Flügel, R.M.; Löchelt, M. Characterization of the Humoral Immune Response and Virus Replication in Cats Experimentally Infected with Feline Foamy Virus. Virology 2000, 275, 170–176. [Google Scholar] [CrossRef]
- Court, E.A.; Watson, A.D.J.; Peaston, A.E. Retrospective Study of 60 Cases of Feline Lymphosarcoma. Aust. Vet. J. 1997, 75, 424–427. [Google Scholar] [CrossRef]
- Alais, S.; Pasquier, A.; Jegado, B.; Journo, C.; Rua, R.; Gessain, A.; Tobaly-Tapiero, J.; Lacoste, R.; Turpin, J.; Mahieux, R. STLV-1 Co-Infection Is Correlated with an Increased SFV Proviral Load in the Peripheral Blood of SFV/STLV-1 Naturally Infected Non-Human Primates. PLoS Negl. Trop. Dis. 2018, 12, e0006812. [Google Scholar] [CrossRef] [Green Version]
- Cavalcante, L.T.; Muniz, C.P.; Jia, H.; Augusto, A.M.; Troccoli, F.; Medeiros, S.D.O.; Dias, C.G.; Switzer, W.M.; Soares, M.A.; Santos, A.F. Clinical and Molecular Features of Feline Foamy Virus and Feline Leukemia Virus Co-Infection in Naturally-Infected Cats. Viruses 2018, 10, 702. [Google Scholar] [CrossRef] [Green Version]
- Switzer, W.M.; Garcia, A.D.; Yang, C.; Wright, A.; Kalish, M.L.; Folks, T.M.; Heneine, W. Coinfection with HIV-1 and Simian Foamy Virus in West Central Africans. J. Infect. Dis. 2008, 197, 1389–1393. [Google Scholar] [CrossRef] [Green Version]
- Dannemiller, N.G.; Kechejian, S.; Kraberger, S.; Logan, K.; Alldredge, M.; Crooks, K.R.; VandeWoude, S.; Carver, S. Diagnostic Uncertainty and the Epidemiology of Feline Foamy Virus in Pumas (Puma concolor). Sci. Rep. 2020, 10, 1587. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mekata, H.; Okagawa, T.; Konnai, S.; Miyazawa, T. Molecular Epidemiology and Whole-Genome Analysis of Bovine Foamy Virus in Japan. Viruses 2021, 13, 1017. [Google Scholar] [CrossRef] [PubMed]
- Hooks, J.J.; Gibbs, C.J., Jr. The Foamy Viruses. Bacteriol. Rev. 1975, 39, 169–185. [Google Scholar] [CrossRef]
- Khan, A.S.; Bodem, J.; Buseyne, F.; Gessain, A.; Johnson, W.; Kuhn, J.H.; Kuzmak, J.; Lindemann, D.; Linial, M.L.; Löchelt, M. Spumaretroviruses: Updated Taxonomy and Nomenclature. Virology 2018, 516, 158–164. [Google Scholar] [CrossRef]
- Tobaly-Tapiero, J.; Bittoun, P.; Neves, M.; Guillemin, M.-C.; Lecellier, C.-H.; Puvion-Dutilleul, F.; Gicquel, B.; Zientara, S.; Giron, M.-L.; de Thé, H. Isolation and Characterization of an Equine Foamy Virus. J. Virol. 2000, 74, 4064–4073. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pinto-Santini, D.M.; Stenbak, C.R.; Linial, M.L. Foamy Virus Zoonotic Infections. Retrovirology 2017, 14, 1–14. [Google Scholar] [CrossRef] [Green Version]
- Phung, H.T.T.; Ikeda, Y.; Miyazawa, T.; Nakamura, K.; Mochizuki, M.; Izumiya, Y.; Sato, E.; Nishimura, Y.; Tohya, Y.; Takahashi, E. Genetic Analyses of Feline Foamy Virus Isolates from Domestic and Wild Feline Species in Geographically Distinct Areas. Virus Res. 2001, 76, 171–181. [Google Scholar] [CrossRef]
- Winkler, I.G.; Flügel, R.M.; Löchelt, M.; Flower, R.L.P. Detection and Molecular Characterisation of Feline Foamy Virus Serotypes in Naturally Infected Cats. Virology 1998, 247, 144–151. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bleiholder, A.; Mühle, M.; Hechler, T.; Bevins, S.; Denner, J.; Löchelt, M. Pattern of Seroreactivity against Feline Foamy Virus Proteins in Domestic Cats from Germany. Vet. Immunol. Immunopathol. 2011, 143, 292–300. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koc, B.T.; Oğuzoğlu, T.Ç. First Report on the Prevalence and Genetic Relatedness of Feline Foamy Virus (FFV) from Turkish Domestic Cats. Virus Res. 2019, 274, 197768. [Google Scholar] [CrossRef] [PubMed]
- Kechejian, S.R.; Dannemiller, N.; Kraberger, S.; Ledesma-Feliciano, C.; Malmberg, J.; Roelke Parker, M.; Cunningham, M.; McBride, R.; Riley, S.P.D.; Vickers, W.T. Feline Foamy Virus Is Highly Prevalent in Free-Ranging Puma Concolor from Colorado, Florida and Southern California. Viruses 2019, 11, 359. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kehl, T.; Tan, J.; Materniak, M. Non-Simian Foamy Viruses: Molecular Virology, Tropism and Prevalence and Zoonotic/Interspecies Transmission. Viruses 2013, 5, 2169–2209. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Roy, J.; Rudolph, W.; Juretzek, T.; Gärtner, K.; Bock, M.; Herchenröder, O.; Lindemann, D.; Heinkelein, M.; Rethwilm, A. Feline Foamy Virus Genome and Replication Strategy. J. Virol. 2003, 77, 11324–11331. [Google Scholar] [CrossRef] [Green Version]
- Kraberger, S.; Fountain-Jones, N.M.; Gagne, R.B.; Malmberg, J.; Dannemiller, N.G.; Logan, K.; Alldredge, M.; Varsani, A.; Crooks, K.R.; Craft, M. Frequent Cross-Species Transmissions of Foamy Virus between Domestic and Wild Felids. Virus Evol. 2020, 6, vez058. [Google Scholar] [CrossRef]
- Romen, F.; Backes, P.; Materniak, M.; Sting, R.; Vahlenkamp, T.W.; Riebe, R.; Pawlita, M.; Kuzmak, J.; Löchelt, M. Serological Detection Systems for Identification of Cows Shedding Bovine Foamy Virus via Milk. Virology 2007, 364, 123–131. [Google Scholar] [CrossRef] [Green Version]
- Mouinga-Ondémé, A.; Caron, M.; Nkoghé, D.; Telfer, P.; Marx, P.; Saïb, A.; Leroy, E.; Gonzalez, J.-P.; Gessain, A.; Kazanji, M. Cross-Species Transmission of Simian Foamy Virus to Humans in Rural Gabon, Central Africa. J. Virol. 2012, 86, 1255–1260. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Buseyne, F.; Betsem, E.; Montange, T.; Njouom, R.; Bilounga Ndongo, C.; Hermine, O.; Gessain, A. Clinical Signs and Blood Test Results among Humans Infected with Zoonotic Simian Foamy Virus: A Case-Control Study. J. Infect. Dis. 2018, 218, 144–151. [Google Scholar] [CrossRef] [PubMed]
- Kechejian, S.; Dannemiller, N.; Kraberger, S.; Ledesma Feliciano, C.; Löchelt, M.; Carver, S.; VandeWoude, S. Feline Foamy Virus Seroprevalence and Demographic Risk Factors in Stray Domestic Cat Populations in Colorado, Southern California and Florida, USA. J. Feline Med. Surg. Open Rep. 2019, 5, 2055116919873736. [Google Scholar] [CrossRef] [PubMed]
- Beatty, J.A.; Troyer, R.M.; Carver, S.; Barrs, V.R.; Espinasse, F.; Conradi, O.; Stutzman-Rodriguez, K.; Chan, C.C.; Tasker, S.; Lappin, M.R. Felis Catus Gammaherpesvirus 1; a Widely Endemic Potential Pathogen of Domestic Cats. Virology 2014, 460, 100–107. [Google Scholar] [CrossRef] [Green Version]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. JModelTest 2: More Models, New Heuristics and Parallel Computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef] [Green Version]
- Winkler, I.G.; Lochelt, M.; Flower, R.L.P. Epidemiology of Feline Foamy Virus and Feline Immunodeficiency Virus Infections in Domestic and Feral Cats: A Seroepidemiological Study. J. Clin. Microbiol. 1999, 37, 2848–2851. [Google Scholar] [CrossRef] [Green Version]
- De Miranda, L.H.M.; Meli, M.; Conceição-Silva, F.; Novacco, M.; Menezes, R.C.; Pereira, S.A.; Sugiarto, S.; dos Reis, É.G.; Gremião, I.D.F.; Hofmann-Lehmann, R. Co-Infection with Feline Retrovirus Is Related to Changes in Immunological Parameters of Cats with Sporotrichosis. PLoS ONE 2018, 13, e0207644. [Google Scholar] [CrossRef] [Green Version]
- McLuckie, A.; Tasker, S.; Dhand, N.K.; Spencer, S.; Beatty, J.A. High Prevalence of Felis Catus Gammaherpesvirus 1 Infection in Haemoplasma-Infected Cats Supports Co-Transmission. Vet. J. 2016, 214, 117–121. [Google Scholar] [CrossRef] [Green Version]
- Ertl, R.; Korb, M.; Langbein-Detsch, I.; Klein, D. Prevalence and Risk Factors of Gammaherpesvirus Infection in Domestic Cats in Central Europe. Virol. J. 2015, 12, 146. [Google Scholar] [CrossRef] [Green Version]
- Stutzman-Rodriguez, K.; Rovnak, J.; VandeWoude, S.; Troyer, R.M. Domestic Cats Seropositive for Felis Catus Gammaherpesvirus 1 Are Often QPCR Negative. Virology 2016, 498, 23–30. [Google Scholar] [CrossRef] [PubMed]
- Moss, W.E.; Alldredge, M.W.; Logan, K.A.; Pauli, J.N. Human Expansion Precipitates Niche Expansion for an Opportunistic Apex Predator (Puma concolor). Sci. Rep. 2016, 6, 39639. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chiu, E.S.; Kraberger, S.; Cunningham, M.; Cusack, L.; Roelke, M.; VandeWoude, S. Multiple Introductions of Domestic Cat Feline Leukemia Virus in Endangered Florida Panthers. Emerg. Infect. Dis. 2019, 25, 92. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Richard, L.; Rua, R.; Betsem, E.; Mouinga-Ondémé, A.; Kazanji, M.; Leroy, E.; Njouom, R.; Buseyne, F.; Afonso, P.V.; Gessain, A. Cocirculation of Two Env Molecular Variants, of Possible Recombinant Origin, in Gorilla and Chimpanzee Simian Foamy Virus Strains from Central Africa. J. Virol. 2015, 89, 12480–12491. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lambert, C.; Couteaudier, M.; Gouzil, J.; Richard, L.; Montange, T.; Betsem, E.; Rua, R.; Tobaly-Tapiero, J.; Lindemann, D.; Njouom, R. Potent Neutralizing Antibodies in Humans Infected with Zoonotic Simian Foamy Viruses Target Conserved Epitopes Located in the Dimorphic Domain of the Surface Envelope Protein. PLoS Pathog. 2018, 14, e1007293. [Google Scholar] [CrossRef]
- Mochizuki, M.; Akuzawa, M.; Nagatomo, H. Serological Survey of the Iriomote Cat (Felis iriomotensis) in Japan. J. Wildl. Dis. 1990, 26, 236–245. [Google Scholar] [CrossRef] [PubMed]
Target Gene | Name | Sense | Primer Sequence (5′-3′) | Reference |
---|---|---|---|---|
Envelope | env-f2 | 1st forword | GCTACTTCTACTAGAATAATGTTTTGGATA | [14] |
env-r2 | 1st reverse | AGCCACAGTAGTAATTGCATGGCCAGGCC | [14] | |
env-f3 | 2nd forward | GCTTTCAAAAATATGGACATTGTTATGTTA | [14] | |
env-r3 | 2nd reverse | GTTTCTCCAAAATCTGCAAGCATATGGATG | [14] |
Host Species | No. of Samples | No. of FFV Positive | % Positive |
---|---|---|---|
Tsushima leopard cat | 89 | 7 | 7.86 |
Domestic cat | 199 | 28 | 14.07 |
FFV Status | |||||
---|---|---|---|---|---|
Variable | Categories | Positive | Negative | Total | % Positive |
Sex | Male | 15 | 73 | 88 | 17.04 |
Female | 13 | 98 | 111 | 11.71 | |
Location | Kamijima | 22 | 134 | 156 | 14.10 |
Shimojima | 6 | 37 | 43 | 13.95 | |
FIV 1 | Positive | 23 | 61 | 84 | 27.38 |
Negative | 12 | 103 | 115 | 10.43 | |
FeLV 2 | Positive | 2 | 22 | 24 | 8.33 |
Negative | 33 | 142 | 175 | 18.85 | |
FcaGHV1 1 | Positive | 14 | 11 | 25 | 56 |
Negative | 21 | 153 | 174 | 12.06 |
Variables | Categories | Z Statistic | Odds Ratio | 95% CI 1 | p Value |
---|---|---|---|---|---|
Location | Kamijima vs. Shimojima | 0.02 | 1.01 | 0.38–2.67 | 0.98 |
Sex | Male vs. female | 1.06 | 1.54 | 0.69–3.45 | 0.284 |
FIV | Positive vs. negative | 3 | 3.23 | 1.50–6.96 | 0.002 |
FeLV | Positive vs. negative | 1.22 | 0.391 | 0.08–1.74 | 0.21 |
FcaGHV1 | Positive vs. negative | 4.78 | 9.27 | 3.72–23.08 | 0.0001 |
Variable | No. of Positive Samples | Male | Female | % Positive | Z Statistic | Odds Ratio | 95% CI 1 | p Value |
---|---|---|---|---|---|---|---|---|
FIV | 84 | 51 | 33 | 42.2 | 3.94 | 3.25 | 1.81–5.86 | 0.0001 |
FeLV | 24 | 12 | 12 | 12 | 0.60 | 1.30 | 0.55–3.06 | 0.54 |
FcaGHV1 | 25 | 17 | 8 | 12.2 | 2.47 | 3.08 | 1.26–7.53 | 0.013 |
FeLV + FFV | 2 | 1 | 1 | 1 | 0.16 | 1.26 | 0.07–20.50 | 0.86 |
FIV + FFV | 23 | 16 | 7 | 11.6 | 2.49 | 3.30 | 1.29–8.43 | 0.012 |
FcaGHV1 + FFV | 14 | 11 | 3 | 7.03 | 2.68 | 6.02 | 1.62–22.34 | 0.007 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
AbuEed, L.; Makundi, I.; Miyake, A.; Kawasaki, J.; Minoura, C.; Koshida, Y.; Nishigaki, K. Feline Foamy Virus Transmission in Tsushima Leopard Cats (Prionailurus bengalensis euptilurus) on Tsushima Island, Japan. Viruses 2023, 15, 835. https://doi.org/10.3390/v15040835
AbuEed L, Makundi I, Miyake A, Kawasaki J, Minoura C, Koshida Y, Nishigaki K. Feline Foamy Virus Transmission in Tsushima Leopard Cats (Prionailurus bengalensis euptilurus) on Tsushima Island, Japan. Viruses. 2023; 15(4):835. https://doi.org/10.3390/v15040835
Chicago/Turabian StyleAbuEed, Loai, Isaac Makundi, Ariko Miyake, Junna Kawasaki, Chisa Minoura, Yushi Koshida, and Kazuo Nishigaki. 2023. "Feline Foamy Virus Transmission in Tsushima Leopard Cats (Prionailurus bengalensis euptilurus) on Tsushima Island, Japan" Viruses 15, no. 4: 835. https://doi.org/10.3390/v15040835