Wastewater-Based Epidemiology for Viral Surveillance from an Endemic Perspective: Evidence and Challenges
Abstract
:1. Introduction
2. Materials and Methods
2.1. Environmental Sampling Strategy
2.2. Sample Concentration
2.3. Extraction and Purification of Viral Nucleic Acids
2.4. Detection of Viral Nucleic Acids
2.5. Data Adjustment and Normalization
- -
- Normalized Viral Load (hereafter viral load) is expressed as GC/100,000 inhabitants/day, and x is the identification number of each WWTP (namely: 1, 2, 3, 4);
- -
- Conc.virus is the concentration of virus detected (GC/L);
- -
- Fd is the daily wastewater flow rate of the WWTPs (L/day);
- -
- 105 is a constant used to relate the viral load to 100,000 inhabitants;
- -
- P is the number of inhabitants served by each WWTP.
2.6. Historical Data on SARS-CoV-2
2.7. Statistical Analysis
3. Results
3.1. Descriptive Analysis of Virus Data
3.2. SARS-CoV-2 Annual Trend from 2021 to 2022
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Melnick, J.L. Poliomyelitis virus in urban sewage in epidemic and in nonepidemic times. Am. J. Epidemiol. 1947, 45, 240–253. [Google Scholar] [CrossRef]
- Hovi, T.; Shulman, L.M.; Van Der Avoort, H.; Deshpande, J.; Roivainen, M.; De Gourville, E.M. Role of environmental poliovirus surveillance in global polio eradication and beyond. Epidemiol. Infect. 2012, 140, 1–13. [Google Scholar] [CrossRef]
- Zoni, R.; Mezzetta, S.; Affanni, P.; Colucci, M.E.; Fiore, S.; Fontana, S.; Bracchi, M.; Capobianco, E.; Veronesi, L. Poliovirus and non-polio-enterovirus environmental surveillance in Parma within the “Global Polio Eradication Program” (GPEI). Acta Biomed. 2019, 90, 95–97. [Google Scholar] [CrossRef]
- Klapsa, D.; Wilton, T.; Zealand, A.; Bujaki, E.; Saxentoff, E.; Troman, C.; Shaw, A.G.; Tedcastle, A.; Majumdar, M.; Mate, R.; et al. Sustained detection of type 2 poliovirus in London sewage between February and July, 2022, by enhanced environmental surveillance. Lancet 2022, 400, 1531–1538. [Google Scholar] [CrossRef]
- Zuckerman, N.S.; Bar-Or, I.; Sofer, D.; Bucris, E.; Morad, H.; Shulman, L.M.; Levi, N.; Weiss, L.; Aguvaev, I.; Cohen, Z.; et al. Emergence of genetically linked vaccine-originated poliovirus type 2 in the absence of oral polio vaccine, Jerusalem, April to July 2022. Eurosurveillance 2022, 27, 2200694. [Google Scholar] [CrossRef] [PubMed]
- Ryerson, A.B.; Lang, D.; Alazawi, M.A.; Neyra, M.; Hill, D.R.; St George, K.; Fuschino, M.; Lutterloh, E.; Backenson, B.; Rulli, S.; et al. Wastewater Testing and Detection of Poliovirus Type 2 Genetically Linked to Virus Isolated from a Paralytic Polio Case—New York, March 9–October 11, 2022. Available online: https://polioeradication.org/wp-content/uploads/2016/09/ (accessed on 4 January 2024).
- Tiwari, A.; Lipponen, A.; Hokajärvi, A.M.; Luomala, O.; Sarekoski, A.; Rytkönen, A.; Österlund, P.; Al-Hello, H.; Juutinen, A.; Miettinen, I.T.; et al. Detection and quantification of SARS-CoV-2 RNA in wastewater influent in relation to reported COVID-19 incidence in Finland. Water Res. 2022, 215, 118220. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, W.; Angel, N.; Edson, J.; Bibby, K.; Bivins, A.; O’Brien, J.W.; Choi, P.M.; Kitajima, M.; Simpson, S.L.; Li, J.; et al. First confirmed detection of SARS-CoV-2 in untreated wastewater in Australia: A proof of concept for the wastewater surveillance of COVID-19 in the community. Sci. Total Environ. 2020, 728, 138764. [Google Scholar] [CrossRef] [PubMed]
- Islam, M.A.; Rahman, M.A.; Jakariya, M.; Bahadur, N.M.; Hossen, F.; Mukharjee, S.K.; Hossain, M.S.; Tasneem, A.; Haque, M.A.; Sera, F.; et al. A 30-day follow-up study on the prevalence of SARS-COV-2 genetic markers in wastewater from the residence of COVID-19 patient and comparison with clinical positivity. Sci. Total Environ. 2023, 858 Pt 3, 159350. [Google Scholar] [CrossRef] [PubMed]
- Kumar, M.; Joshi, M.; Jiang, G.; Yamada, R.; Honda, R.; Srivastava, V.; Mahlknecht, J.; Barcelo, D.; Chidambram, S.; Khursheed, A.; et al. Response of wastewater-based epidemiology predictor for the second wave of COVID-19 in Ahmedabad, India: A long-term data Perspective. Environ. Pollut. 2023, 337, 122471. [Google Scholar] [CrossRef]
- Haramoto, E.; Malla, B.; Thakali, O.; Kitajima, M. First environmental surveillance for the presence of SARS-CoV-2 RNA in wastewater and river water in Japan. Sci. Total Environ. 2020, 737, 140405. [Google Scholar] [CrossRef] [PubMed]
- Sherchan, S.P.; Shahin, S.; Ward, L.M.; Tandukar, S.; Aw, T.G.; Schmitz, B.; Ahmed, W.; Kitajima, M. First detection of SARS-CoV-2 RNA in wastewater in North America: A study in Louisiana, USA. Sci. Total Environ. 2020, 743, 140621. [Google Scholar] [CrossRef]
- World Health Organization. Guidelines for Drinking-Water Quality: Fourth Edition Incorporating the First and Second Addenda, 4th ed.; World Health Organization: Geneva, Switzerland, 2022; ISBN 978-92-4-004506-4. [Google Scholar]
- Dzinamarira, T.; Pierre, G.; Iradukunda, P.G.; Tungwarara, N.; Mukwenha, S.; Mpabuka, E.; Kidson Mataruka, K.; Chitungo, I.; Musukaf, G.; Murewanhema, G. Epidemiological surveillance of enteric viral diseases using wastewater in Africa—A rapid review. J. Infect. Public Health 2022, 15, 703–707. [Google Scholar] [CrossRef]
- Hellmér, M.; Paxéus, N.; Magnius, L.; Enache, L.; Arnholm, N.; Johansson, A.; Bergström, T.; Norder, H. Detection of pathogenic viruses in sewage provided early warnings of hepatitis A virus and norovirus outbreaks. Appl. Environ. Microbiol. 2014, 80, 6771–6781. [Google Scholar] [CrossRef] [PubMed]
- Carducci, A.; Verani, M.; Battistini, R.; Pizzi, F.; Rovini, E.; Andreoli, E.; Casini, B. Epidemiological surveillance of human enteric viruses by monitoring of different environmental matrices. Water Sci. Technol. 2006, 54, 239–244. [Google Scholar] [CrossRef] [PubMed]
- Sedmak, G.; Bina, D.; MacDonald, J. Assessment of an Enterovirus Sewage Surveillance System by Comparison of Clinical Isolates with Sewage Isolates from Milwaukee, Wisconsin, Collected August 1994 to December 2002. Appl. Environ. Microbiol. 2003, 69, 7181–7187. [Google Scholar] [CrossRef] [PubMed]
- Chacón, L.; Morales, E.; Valiente, C.; Reyes, L.; Barrantes, K. Wastewater-based epidemiology of enteric viruses and surveillance of acute gastrointestinal illness outbreaks in a resource-limited region. Am. J. Trop. Med. Hyg. 2021, 105, 1004–1012. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Neyvaldt, J.; Enache, L.; Sikora, P.; Mattsson, A.; Johansson, A.; Lindh, M.; Bergstedt, O.; Norder, H. Variations among Viruses in Influent Water and Effluent Water at a Wastewater Plant over One Year as Assessed by Quantitative PCR and Metagenomics. Appl. Environ. Microbiol. 2020, 86, e02073-20. [Google Scholar] [CrossRef] [PubMed]
- Gonçalves, J.; Torres-Franco, A.; Rodriguéz, E.; Diaz, I.; Koritnik, T.; Gomes da Silva, P.; Mesquita, J.R.; Trkov, M.; Paragi, M.; Muñoz, R.; et al. Centralized and decentralized wastewater-based epidemiology to infer COVID-19 transmission—A brief review. One Health 2022, 15, 100405. [Google Scholar] [CrossRef] [PubMed]
- Brinkman, N.E.; Fout, G.S.; Keely, S.P. Retrospective Surveillance of Wastewater to Examine Seasonal Dynamics of Enterovirus Infections. mSphere 2017, 2, e00099-17. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Li, J.; O’Brien, J.; Sivakumar, M.; Jiang, G. Back-estimation of norovirus infections through wastewater-based epidemiology: A systematic review and parameter sensitivity. Water Res. 2022, 219, 118610. [Google Scholar] [CrossRef]
- Kallem, P.; Hegab, H.; Alsafar, H.; Hasan, S.W.; Banat, F. SARS-CoV-2 detection and inactivation in water and wastewater: Review on analytical methods, limitations and future research recommendations. Emerg. Microbes Infect. 2023, 12, 2222850. [Google Scholar] [CrossRef]
- Ciannella, S.; González-Fernández, C.; Gomez-Pastora, J. Recent progress on wastewater-based epidemiology for COVID-19 surveillance: A systematic review of analytical procedures and epidemiological modeling. Sci. Total Environ. 2023, 878, 162953. [Google Scholar] [CrossRef]
- European Commission (EU) Commission Recommendation (EU) n° 2021/472 of 17 March 2021 on a Common Approach to Establish a Systematic Surveillance of SARS-CoV-2 and Its Variants in Wastewaters in the EU-Publications Office of the EU. Available online: https://op.europa.eu/en/publication-detail/-/publication/05b46cb0-8855-11eb-ac4c-01aa75ed71a1/language-en/format-PDF (accessed on 15 January 2024).
- Verani, M.; Federigi, I.; Muzio, S.; Lauretani, G.; Calà, P.; Mancuso, F.; Salvadori, R.; Valentini, C.; La Rosa, G.; Suffredini, E.; et al. Calibration of Methods for SARS-CoV-2 Environmental Surveillance: A Case Study from Northwest Tuscany. Int. J. Environ. Res. Public Health 2022, 19, 16588. [Google Scholar] [CrossRef]
- Carducci, A.; Federigi, I.; Lauretani, G.; Muzio, S.; Pagani, A.; Atomsa, N.T.; Verani, M. Critical Needs for Integrated Surveillance: Wastewater-Based and Clinical Epidemiology in Evolving Scenarios with Lessons Learned from SARS-CoV-2. Food Environ. Virol, 2024; Online ahead of print. [Google Scholar] [CrossRef]
- La Rosa, G.; Bonadonna, L.; Suffredini, E. Protocollo della Sorveglianza di SARS-CoV-2 in reflui urbani (SARI)—rev. 3. 25/07/2021. Istituto Superiore di Sanità, V.le Regina Elena, Roma. Zenodo. Available online: https://zenodo.org/records/5758725 (accessed on 15 January 2024).
- Hernroth, B.E.; Conden-Hansson, A.C.; Rehnstam-Holm, A.S.; Girones, R.; Allard, A.K. Environmental factors influencing human viral pathogens and their potential indicator organisms in the blue mussel, Mytilus edulis: The first Scandinavian report. Appl. Environ. Microbiol. 2002, 68, 4523–4533. [Google Scholar] [CrossRef]
- Donaldson, K.A.; Griffin, D.W.; Paul, J.H. Detection, quantitation and identification of enteroviruses from surface waters and sponge tissue from the Florida Keys using real-time RT-PCR. Water Res. 2002, 36, 2505–2514. [Google Scholar] [CrossRef]
- Skraber, S.; Ogorzaly, L.; Helmi, K.; Maul, A.; Hoffmann, L.; Cauchie, H.M.; Gantzer, C. Occurrence and persistence of enteroviruses, noroviruses and F-specific RNA phages in natural wastewater biofilms. Water Res. 2009, 43, 4780–4789. [Google Scholar] [CrossRef] [PubMed]
- Bisseux, M.; Colombet, J.; Mirand, A.; Archimbaud, C.; Peigue-Lafeuille, H.; Roque-Afonso, A.M.; Abravanel, F.; Izopet, J.; Debroas, D.; Bailly, J.L.; et al. Monitoring human enteric viruses in wastewater and relevance to infections encountered in the clinical setting: A one-year experiment in central France. Eurosurveillance 2018, 23, 17–00237. [Google Scholar] [CrossRef] [PubMed]
- Vetter, M.R.; Staggemeier, R.; Vecchia, A.D.; Henzel, A.; Rigotto, C.; Spilki, F.R. Seasonal variation on the presence of adenoviruses in stools from non-diarrheic patients. Braz. J. Microbiol. 2015, 46, 749–752. [Google Scholar] [CrossRef] [PubMed]
- Maniah, K.; Nour, I.; Hanif, A.; Yassin, M.T.; Alkathiri, A.; Al-Ashkar, I.; Eifan, S. Molecular Identification of Human Adenovirus Isolated from Different Wastewater Treatment Plants in Riyadh, Saudi Arabia: Surveillance and Meteorological Impacts. Water 2023, 15, 1367. [Google Scholar] [CrossRef]
- Elmahdy, E.M.; Ahmed, N.I.; Shaheen, M.N.F.; Mohamed, E.C.B.; Loutfy, S.A. Molecular detection of human adenovirus in urban wastewater in Egypt and among children suffering from acute gastroenteritis. J. Water Health 2019, 17, 287–294. [Google Scholar] [CrossRef] [PubMed]
- Price, R.H.M.; Graham, C.; Ramalingam, S. Association between viral seasonality and meteorological factors. Sci. Rep. 2019, 9, 929. [Google Scholar] [CrossRef]
- Fong, T.T.; Phanikumar, M.S.; Xagoraraki, I.; Rose, J.B. Quantitative detection of human adenoviruses in wastewater and combined sewer overflows influencing a Michigan river. Appl. Environ. Microbiol. 2010, 76, 715–723. [Google Scholar] [CrossRef]
- Takuissu, G.R.; Kenmoe, S.; Ebogo-Belobo, J.T.; Kengne-Ndé, C.; Mbaga, D.S.; Bowo-Ngandji, A.; Ondigui Ndzie, J.L.; Kenfack-Momo, R.; Tchatchouang, S.; Kenfack-Zanguim, J.; et al. Exploring adenovirus in water environments: A systematic review and meta-analysis. Int. J. Environ. Health Res. 2023; Online ahead of print. [Google Scholar] [CrossRef]
- Iaconelli, M.; Valdazo-González, B.; Equestre, M.; Ciccaglione, A.R.; Marcantonio, C.; Della Libera, S.; La Rosa, G. Molecular characterization of human adenoviruses in urban wastewaters using next generation and Sanger sequencing. Water Res. 2017, 121, 240–247. [Google Scholar] [CrossRef]
- Zamora-Figueroa, A.; Rosales, R.E.; Fernández, R.; Ramírez, V.; Bastardo, M.; Farías, A.; Vizzi, E. Detection and diversity of gastrointestinal viruses in wastewater from Caracas, Venezuela, 2021–2022. Virology 2024, 589, 109913. [Google Scholar] [CrossRef]
- Allayeh, A.K.; Al-Daim, S.A.; Ahmed, N.; El-Gayar, M.; Mostafa, A. Isolation and Genotyping of Adenoviruses from Wastewater and Diarrheal Samples in Egypt from 2016 to 2020. Viruses 2022, 14, 2192. [Google Scholar] [CrossRef]
- Lei, Y.; Zhuang, Z.; Liu, Y.; Tan, Z.; Gao, X.; Li, X.; Yang, D. Whole Genomic Sequence Analysis of Human Adenovirus Species C Shows Frequent Recombination in Tianjin, China. Viruses 2023, 15, 1004. [Google Scholar] [CrossRef]
- Carducci, A.; Viviani, L.; Pagani, A.; Atomsa, N.T.; Lauretani, G.; Federigi, I.; Verani, M. Wastewater Based Surveillance of Respiratory Viruses for public health purposes: Opportunities and challenges. In Proceedings of the IWA World Water Congress & Exhibition, Toronto, ON, Canada, 11–15 August 2024. submitted. [Google Scholar]
- Pons-Salort, M.; Oberste, M.S.; Pallansch, M.A.; Abedi, G.R.; Takahashi, S.; Grenfell, B.T.; Grassly, N.C. The seasonality of nonpolio enteroviruses in the United States: Patterns and drivers. Proc. Natl. Acad. Sci. USA 2018, 115, 3078–3083. [Google Scholar] [CrossRef] [PubMed]
- Baek, K.; Yeo, S.; Lee, B.; Park, K.; Song, J.; Yu, J.; Rheem, I.; Kim, J.; Hwang, S.; Choi, Y.; et al. Epidemics of enterovirus infection in Chungnam Korea, 2008 and 2009. Virol. J. 2011, 8, 297. [Google Scholar] [CrossRef] [PubMed]
- Rajtar, B.; Majek, M.; Polański, Ł.; Polz-Dacewicz, M. Enteroviruses in water environment-a potential threat to public health. Ann. Agric. Environ. Med. 2008, 15, 199–203. [Google Scholar] [PubMed]
- Rohayem, J. Norovirus seasonality and the potential impact of climate change. Clin. Microbiol. Infect. 2009, 15, 524–527. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Huang, J.; Li, C.; Zhao, Y.; Wang, D.; Huang, Z.; Yang, K. The role of seasonality in the spread of COVID-19 pandemic. Environ. Res. 2021, 195, 110874. [Google Scholar] [CrossRef] [PubMed]
- Sharun, K.; Tiwari, R.; Dhama, K. COVID-19 and sunlight: Impact on SARS-CoV-2 transmissibility, morbidity, and mortality. Ann. Med. Surg. 2021, 66, 102419. [Google Scholar] [CrossRef] [PubMed]
- Gibson, J.; Poon, B.P.; Lam, J.; Sultana, A.; Christie-Holmes, N.; Mubareka, S.; Gray-Owen, S.D.; Farnood, R. Exploring the Differences in the Response of SARS-CoV-2 Delta and Omicron to Ultraviolet Radiation. ACS EST Eng. 2023, 3, 1159–1164. [Google Scholar] [CrossRef]
- Lorente-González, M.; Suarez-Ortiz, M.; Landete, P. Evolution and Clinical Trend of SARS-CoV-2 Variants. Open Respir. Arch. 2022, 4, 100169. [Google Scholar] [CrossRef]
- Fantilli, A.; Cola, G.D.; Castro, G.; Sicilia, P.; Cachi, A.M.; de Los Ángeles Marinzalda, M.; Ibarra, G.; López, L.; Valduvino, C.; Barbás, G.; et al. Hepatitis A virus monitoring in wastewater: A complementary tool to clinical surveillance. Water Res. 2023, 241, 120102. [Google Scholar] [CrossRef]
- Casares-Jimenez, M.; Garcia-Garcia, T.; Suárez-Cárdenas, J.M.; Perez-Jimenez, A.B.; Martín, M.A.; Caballero-Gómez, J.; Michán, C.; Corona-Mata, D.; Risalde, M.A.; Perez-Valero, I.; et al. Correlation of hepatitis E and rat hepatitis E viruses urban wastewater monitoring and clinical cases. Sci. Total Environ. 2024, 908, 168203. [Google Scholar] [CrossRef]
- Rački, N.; Dreo, T.; Gutierrez-Aguirre, I.; Blejec, A.; Ravnikar, M. Reverse transcriptase droplet digital PCR shows high resilience to PCR inhibitors from plant, soil and water samples. Plant Methods 2014, 10, 42. [Google Scholar] [CrossRef]
Virus | Target Region | Primers and Probes | Sequences (5′-3′) | Reference |
---|---|---|---|---|
Human Adenovirus | Ad hexon gene | AdF | CWTACATGCACATCKCSGG | [29] |
AdR | CRCGGGCRAAYTGCACCAG | |||
AdP1 | FAM-CCGGGCTCAGGTACTCCGAGGCGTCCT-TAMRA | |||
Enterovirus | 5′UTR region | EVF | GGCCCCTGAATGCGGCTAAT | [30] |
EVR | CACCGGATGGCCAATCCAA | |||
EV | FAM-CGGACACCCAAAGTAGTCGGTTCCG-TAMRA | |||
Norovirus ggII | ORF1-ORF2 region: RNA-dependent RNA polymerase (RdRp) | JJV2F | CAAGAGTCAATGTTTAGGTGGATGAG | [31] |
COG2R | TCGACGCCATCTTCATTCACA | |||
RING2-TP | FAM-TGGGAGGGCGATCGCAATCT-BHQ | |||
SARS-CoV-2 | ORF1ab region: nsp14; 3′ to 5′ exonuclease | 2297 CoV-2-F | ACATGGCTTTGAGTTGACATCT | [26,27] |
2298 CoV-2-R | AGCAGTGGAAAAGCATGTGG | |||
2299 CoV-2-P | FAM-CATAGACAACAGGTGCGCTC-MGBEQ |
Virus | WWTP1 | WWTP2 | WWTP3 | WWTP4 | Total | |
---|---|---|---|---|---|---|
Human Adenovirus | Positive samples (no., %) | 42/48, 87.5% | 45/48, 93.7% | 36/51, 78.6% | 35/50, 70% | 158/197, 80.2% |
Viral load Log10(GC/100,000 inh/day) | 10.3 ± 2.3 | 10.3 ± 1.6 | 8.5± 2.8 | 8.6 ± 2.9 | 9.4 ± 2.6 | |
Enterovirus | Positive samples (no., %) | 30/48, 62.5% | 4/48, 8.3% | 24/51, 47% | 29/50, 58.0% | 87/197, 44.2% |
Viral load Log10(GC/100,000 inh/day) | 7.0 ± 2.3 | 4.3 ± 1 | 5.9 ± 2.1 | 6.6 ± 2.2 | 5.9 ± 2.2 | |
Norovirus genogroup II | Positive samples (no., %) | 44/48, 91.7% | 33/48, 68.7% | 42/51, 82.3% | 47/50, 94% | 166/197, 84.3% |
Viral load Log10(GC/100,000 inh/day) | 9.1 ± 1.6 | 7.4 ± 2.4 | 8.2 ± 2.1 | 9.1 ± 1.4 | 8.5 ± 2.0 | |
SARS-CoV-2 | Positive samples (no., %) | 30/48, 62.5% | 21/48, 43.7% | 22/51, 43.1% | 27/50, 54% | 100/197, 50.8% |
Viral load Log10(GC/100,000 inh/day) | 7.2 ± 2.1 | 6.1 ± 1.9 | 6.2 ± 2.1 | 6.6 ± 2.1 | 6.5 ± 2.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Verani, M.; Pagani, A.; Federigi, I.; Lauretani, G.; Atomsa, N.T.; Rossi, V.; Viviani, L.; Carducci, A. Wastewater-Based Epidemiology for Viral Surveillance from an Endemic Perspective: Evidence and Challenges. Viruses 2024, 16, 482. https://doi.org/10.3390/v16030482
Verani M, Pagani A, Federigi I, Lauretani G, Atomsa NT, Rossi V, Viviani L, Carducci A. Wastewater-Based Epidemiology for Viral Surveillance from an Endemic Perspective: Evidence and Challenges. Viruses. 2024; 16(3):482. https://doi.org/10.3390/v16030482
Chicago/Turabian StyleVerani, Marco, Alessandra Pagani, Ileana Federigi, Giulia Lauretani, Nebiyu Tariku Atomsa, Virginia Rossi, Luca Viviani, and Annalaura Carducci. 2024. "Wastewater-Based Epidemiology for Viral Surveillance from an Endemic Perspective: Evidence and Challenges" Viruses 16, no. 3: 482. https://doi.org/10.3390/v16030482