Droplet Digital RT-PCR (dd RT-PCR) Detection of SARS-CoV-2 in Honey Bees and Honey Collected in Apiaries across the Campania Region
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Nucleic Acids Extraction from Honey Bees
2.3. Nucleic Acid Extraction from Honey
2.4. Droplet Digital RT-PCR (dd RT-PCR) for SARS-CoV-2 Detection
2.5. Molecular Characterization of Positive Samples
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- ICTV. 2023. Available online: https://ictv.global/msl (accessed on 4 February 2024).
- Woo, P.C.Y.; Huang, Y.; Lau, S.K.P.; Yuen, K.Y. Coronavirus Genomics and Bioinformatics Analysis. Viruses 2010, 2, 1805–1820. [Google Scholar] [CrossRef] [PubMed]
- Weiss, S.R. Forty Years with Coronaviruses. J. Exp. Med. 2020, 217, e20200537. [Google Scholar] [CrossRef] [PubMed]
- Ravi, V.; Saxena, S.; Panda, P.S. Basic Virology of SARS-CoV-2. Indian J. Med. Microbiol. 2022, 40, 182–186. [Google Scholar] [CrossRef]
- Cui, J.; Li, F.; Shi, Z.L. Origin and Evolution of Pathogenic Coronaviruses. Nat. Rev. Microbiol. 2019, 17, 181–192. [Google Scholar] [CrossRef] [PubMed]
- Sanjuán, R.; Nebot, M.R.; Chirico, N.; Mansky, L.M.; Belshaw, R. Viral Mutation Rates. J. Virol. 2010, 84, 9733–9748. [Google Scholar] [CrossRef]
- Santacroce, L.; Charitos, I.A.; Carretta, D.M.; De Nitto, E.; Lovero, R. The Human Coronaviruses (HCoVs) and the Molecular Mechanisms of SARS-CoV-2 Infection. J. Mol. Med. 2021, 99, 933–1106. [Google Scholar] [CrossRef]
- Su, S.; Wong, G.; Shi, W.; Liu, J.; Lai, A.C.K.; Zhou, J.; Liu, W.; Bi, Y.; Gao, G.F. Epidemiology, Genetic Recombination, and Pathogenesis of Coronaviruses. Trends Microbiol. 2016, 24, 490–502. [Google Scholar] [CrossRef]
- Tang, G.; Liu, Z.; Chen, D. Human Coronaviruses: Origin, Host and Receptor. J. Clin. Virol. 2022, 155, 105246. [Google Scholar] [CrossRef] [PubMed]
- Meo, S.A.; Alhowikan, A.M.; Al-Khlaiwi, T.; Meo, I.M.; Halepoto, D.M.; Iqbal, M.; Usmani, A.M.; Hajjar, W.; Ahmed, N. Novel Coronavirus 2019-NCoV: Prevalence, Biological and Clinical Characteristics Comparison with SARS-CoV and MERS-CoV. Eur. Rev. Med. Pharmacol. Sci. 2020, 24, 2012–2019. [Google Scholar]
- Zhang, T.; Wu, Q.; Zhang, Z. Probable Pangolin Origin of SARS-CoV-2 Associated with the COVID-19 Outbreak. Curr. Biol. 2020, 30, 1346–1351.e2. [Google Scholar] [CrossRef]
- Chan, J.F.W.; Kok, K.H.; Zhu, Z.; Chu, H.; To, K.K.W.; Yuan, S.; Yuen, K.Y. Genomic Characterization of the 2019 Novel Human-Pathogenic Coronavirus Isolated from a Patient with Atypical Pneumonia after Visiting Wuhan. Emerg. Microbes Infect. 2020, 9, 221–236. [Google Scholar] [CrossRef] [PubMed]
- Xu, R.H.; He, J.F.; Evans, M.R.; Peng, G.W.; Field, H.E.; Yu, D.W.; Lee, C.K.; Luo, H.M.; Lin, W.S.; Lin, P.; et al. Epidemiologic clues to SARS origin in China. Emerg. Infect. Dis. 2004, 10, 1030. [Google Scholar] [CrossRef] [PubMed]
- Guan, Y.; Zheng, B.J.; He, Y.Q.; Liu, X.L.; Zhuang, Z.X.; Cheung, C.L.; Luo, S.W.; Li, P.H.; Zhang, L.J.; Guan, Y.J.; et al. Isolation and Characterization of Viruses Related to the SARS Coronavirus from Animals in Southern China. Science 2003, 302, 276–278. [Google Scholar] [CrossRef] [PubMed]
- Leung, N.H.L.; Chu, D.K.W.; Shiu, E.Y.C.; Chan, K.H.; McDevitt, J.J.; Hau, B.J.P.; Yen, H.L.; Li, Y.; Ip, D.K.M.; Peiris, J.S.M.; et al. Respiratory Virus Shedding in Exhaled Breath and Efficacy of Face Masks. Nat. Med. 2020, 26, 676–680. [Google Scholar] [CrossRef]
- Zhang, R.; Li, Y.; Zhang, A.L.; Wang, Y.; Molina, M.J. Identifying Airborne Transmission as the Dominant Route for the Spread of COVID-19. Proc. Natl. Acad. Sci. USA 2020, 117, 14857–14863. [Google Scholar] [CrossRef] [PubMed]
- Kutter, J.S.; Spronken, M.I.; Fraaij, P.L.; Fouchier, R.A.; Herfst, S. Transmission Routes of Respiratory Viruses among Humans. Curr. Opin. Virol. 2018, 28, 142–151. [Google Scholar] [CrossRef] [PubMed]
- Tang, J.W.; Nicolle, A.D.; Klettner, C.A.; Pantelic, J.; Wang, L.; Suhaimi, A.B.; Tan, A.Y.L.; Ong, G.W.X.; Su, R.; Sekhar, C.; et al. Airflow Dynamics of Human Jets: Sneezing and Breathing—Potential Sources of Infectious Aerosols. PLoS ONE 2013, 8, e59970. [Google Scholar] [CrossRef]
- Onakpoya, I.J.; Heneghan, C.J.; Spencer, E.A.; Brassey, J.; Plüddemann, A.; Evans, D.H.; Conly, J.M.; Jefferson, T. SARS-CoV-2 and the Role of Fomite Transmission: A Systematic Review. F1000Res 2021, 10, 233. [Google Scholar] [CrossRef] [PubMed]
- Port, J.R.; Yinda, C.K.; Owusu, I.O.; Holbrook, M.; Fischer, R.; Bushmaker, T.; Avanzato, V.A.; Schulz, J.E.; Martens, C.; van Doremalen, N.; et al. SARS-CoV-2 Disease Severity and Transmission Efficiency Is Increased for Airborne Compared to Fomite Exposure in Syrian Hamsters. Nat. Commun. 2021, 12, 4985. [Google Scholar] [CrossRef]
- Kraay, A.N.M.; Hayashi, M.A.L.; Hernandez-Ceron, N.; Spicknall, I.H.; Eisenberg, M.C.; Meza, R.; Eisenberg, J.N.S. Fomite-Mediated Transmission as a Sufficient Pathway: A Comparative Analysis across Three Viral Pathogens. BMC Infect. Dis. 2018, 18, 540. [Google Scholar] [CrossRef]
- Kirubananthan, L.; Illuri, R.; Rajendran, R.; Chandrasekaran, P.R. Mechanism and Transmission Routes of COVID-19. In Environmental and Health Management of Novel Coronavirus Disease (COVID-19); Elsevier: Amsterdam, The Netherlands, 2021; pp. 65–88. ISBN 9780323857802. [Google Scholar]
- Guo, Z.D.; Wang, Z.Y.; Zhang, S.F.; Li, X.; Li, L.; Li, C.; Cui, Y.; Fu, R.B.; Dong, Y.Z.; Chi, X.Y.; et al. Aerosol and Surface Distribution of Severe Acute Respiratory Syndrome Coronavirus 2 in Hospital Wards, Wuhan, China, 2020. Emerg. Infect. Dis. 2020, 26, 1586–1591. [Google Scholar] [CrossRef] [PubMed]
- Fernstrom, A.; Goldblatt, M. Aerobiology and Its Role in the Transmission of Infectious Diseases. J. Pathog. 2013, 2013, 493960. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Ayeh, S.K.; Chidambaram, V.; Karakousis, P.C. Modes of Transmission of SARS-CoV-2 and Evidence for Preventive Behavioral Interventions. BMC Infect. Dis. 2021, 21, 496. [Google Scholar] [CrossRef] [PubMed]
- Greenhalgh, T.; Jimenez, J.L.; Prather, K.A.; Tufekci, Z.; Fisman, D.; Schooley, R. Ten Scientific Reasons in Support of Airborne Transmission of SARS-CoV-2. Lancet 2021, 397, 1603–1605. [Google Scholar] [CrossRef] [PubMed]
- Sedlmaier, N.; Hoppenheidt, K.; Krist, H.; Lehmann, S.; Lang, H.; Büttner, M. Generation of Avian Influenza Virus (AIV) Contaminated Fecal Fine Particulate Matter (PM2.5): Genome and Infectivity Detection and Calculation of Immission. Veter Microbiol. 2009, 139, 156–164. [Google Scholar] [CrossRef] [PubMed]
- Setti, L.; Passarini, F.; De Gennaro, G.; Barbieri, P.; Perrone, M.G.; Borelli, M.; Palmisani, J.; Di Gilio, A.; Torboli, V.; Fontana, F.; et al. SARS-Cov-2RNA Found on Particulate Matter of Bergamo in Northern Italy: First Evidence. Environ. Res. 2020, 188, 109754. [Google Scholar] [CrossRef] [PubMed]
- Comunian, S.; Dongo, D.; Milani, C.; Palestini, P. Air Pollution and COVID-19: The Role of Particulate Matter in the Spread and Increase of COVID-19’s Morbidity and Mortality. Int. J. Environ. Res. Public Health 2020, 17, 4487. [Google Scholar] [CrossRef]
- Maleki, M.; Anvari, E.; Hopke, P.K.; Noorimotlagh, Z.; Mirzaee, S.A. An Updated Systematic Review on the Association between Atmospheric Particulate Matter Pollution and Prevalence of SARS-CoV-2. Environ. Res. 2021, 195, 110898. [Google Scholar] [CrossRef]
- Santurtún, A.; Colom, M.L.; Fdez-Arroyabe, P.; del Real, Á.; Fernández-Olmo, I.; Zarrabeitia, M.T. Exposure to Particulate Matter: Direct and Indirect Role in the COVID-19 Pandemic. Environ. Res. 2022, 206, 112261. [Google Scholar] [CrossRef]
- Nor, N.S.M.; Yip, C.W.; Ibrahim, N.; Jaafar, M.H.; Rashid, Z.Z.; Mustafa, N.; Hamid, H.H.A.; Chandru, K.; Latif, M.T.; Saw, P.E.; et al. Particulate Matter (PM2.5) as a Potential SARS-CoV-2 Carrier. Sci. Rep. 2021, 11, 2508. [Google Scholar] [CrossRef]
- Negri, I.; Mavris, C.; Di Prisco, G.; Caprio, E.; Pellecchia, M. Honey Bees (Apis Mellifera, L.) as Active Samplers of Airborne Particulate Matter. PLoS ONE 2015, 10, e0132491. [Google Scholar] [CrossRef] [PubMed]
- Papa, G.; Capitani, G.; Capri, E.; Pellecchia, M.; Negri, I. Vehicle-Derived Ultrafine Particulate Contaminating Bees and Bee Products. Sci. Total Environ. 2021, 750, 141700. [Google Scholar] [CrossRef] [PubMed]
- Cilia, G.; Bortolotti, L.; Albertazzi, S.; Ghini, S.; Nanetti, A. Honey Bee (Apis Mellifera L.) Colonies as Bioindicators of Environmental SARS-CoV-2 Occurrence. Sci. Total Environ. 2022, 805, 150327. [Google Scholar] [CrossRef]
- Power, K.; Martano, M.; Altamura, G.; Piscopo, N.; Maiolino, P. Histopathological Features of Symptomatic and Asymptomatic Honeybees Naturally Infected by Deformed Wing Virus. Pathogens 2021, 10, 874. [Google Scholar] [CrossRef]
- International Organization for Standardization: ISO 15216-2:2019 Microbiology of the Food Chain—Horizontal Method for Determination of Hepatitis A Virus and Norovirus Using Real-Time RT-PCR—Part 2: Method for Detection; International Organization for Standardization: Geneva, Switzerland, 2019.
- La Rosa, G.; Mancini, P.; Bonanno Ferraro, G.; Veneri, C.; Iaconelli, M.; Bonadonna, L.; Lucentini, L.; Suffredini, E. SARS-CoV-2 Has Been Circulating in Northern Italy since December 2019: Evidence from Environmental Monitoring. Sci. Total Environ. 2021, 750, 141711. [Google Scholar] [CrossRef]
- Pierri, B.; Mancusi, A.; Proroga, Y.T.R.; Capuano, F.; Cerino, P.; Girardi, S.; Vassallo, L.; Lo Conte, G.; Tafuro, M.; Cuomo, M.C.; et al. SARS-CoV-2 Detection in Nasopharyngeal Swabs: Performance Characteristics of a Real-Time RT-QPCR and a Droplet Digital RT-PCR Assay Based on the Exonuclease Region (ORF1b, Nsp 14). J. Virol. Methods 2022, 300, 114420. [Google Scholar] [CrossRef] [PubMed]
- Corman, V.M.; Landt, O.; Kaiser, M.; Molenkamp, R.; Meijer, A.; Chu, D.K.W.; Bleicker, T.; Brünink, S.; Schneider, J.; Schmidt, M.L.; et al. Detection of 2019 Novel Coronavirus (2019-NCoV) by Real-Time RT-PCR. Eurosurveillance 2020, 25, 2000045. [Google Scholar] [CrossRef]
- Mancusi, A.; Capuano, F.; Girardi, S.; Di Maro, O.; Suffredini, E.; Di Concilio, D.; Vassallo, L.; Cuomo, M.C.; Tafuro, M.; Signorelli, D.; et al. Detection of SARS-CoV-2 RNA in Bivalve Mollusks by Droplet Digital RT-PCR (Dd RT-PCR). Int. J. Environ. Res. Public Health 2022, 19, 943. [Google Scholar] [CrossRef]
- ISS. Available online: https://www.epicentro.iss.it/coronavirus/2020 (accessed on 4 February 2024).
- ISS. Available online: https://www.iss.it/coronavirus (accessed on 4 February 2024).
- Cerino, P.; Buonerba, C.; Brambilla, G.; Atripaldi, L.; Tafuro, M.; Concilio, D.D.; Vassallo, L.; Conte, G.L.; Cuomo, M.C.; Maiello, I.; et al. No Detection of SARS-CoV-2 in Animals Exposed to Infected Keepers: Results of a COVID-19 Surveillance Program. Future Sci. OA 2021, 7, FSO711. [Google Scholar] [CrossRef]
- Ghini, S.; Girotti, S.; Calzolari, A.; Sabatini, A.G.; Alessandrini, A.; Zeri, L.; Porrini, C. Use of honeybees (Apis mellifera L.) as indicators of the presence of the phytopathogenic bacteria Erwinia amylovora. Insect. Soc. Life 2002, 4, 69–77. [Google Scholar]
- Carreck, N.L.; Andree, M.; Brent, C.S.; Cox-Foster, D.; Dade, H.A.; Ellis, J.D.; Hatjina, F.; Van Englesdorp, D. Standard Methods for Apis Mellifera Anatomy and Dissection. J. Apic. Res. 2013, 52, 1–40. [Google Scholar] [CrossRef]
- Sauthier, R.; I’Anson Price, R.; Grüter, C. Worker Size in Honeybees and Its Relationship with Season and Foraging Distance. Apidologie 2017, 48, 234–246. [Google Scholar] [CrossRef]
- Couvillon, M.J.; Riddell Pearce, F.C.; Accleton, C.; Fensome, K.A.; Quah, S.K.L.; Taylor, E.L.; Ratnieks, F.L.W. Honey Bee Foraging Distance Depends on Month and Forage Type. Apidologie 2015, 46, 61–70. [Google Scholar] [CrossRef]
- He, X.; Wang, W.; Qin, Q.; Zeng, Z.; Zhang, S.; Barron, A.B. Assessment of Flight Activity and Homing Ability in Asian and European Honey Bee Species, Apis Cerana and Apis Mellifera, Measured with Radio Frequency Tags. Apidologie 2013, 44, 38–51. [Google Scholar] [CrossRef]
- Perry, C.J.; Søvik, E.; Myerscough, M.R.; Barron, A.B. Rapid Behavioral Maturation Accelerates Failure of Stressed Honey Bee Colonies. Proc. Natl. Acad. Sci. USA 2015, 112, 3427–3432. [Google Scholar] [CrossRef] [PubMed]
- Rodney, S.; Purdy, J. Dietary Requirements of Individual Nectar Foragers, and Colony-Level Pollen and Nectar Consumption: A Review to Support Pesticide Exposure Assessment for Honey Bees. Apidologie 2020, 51, 163–179. [Google Scholar] [CrossRef]
- Jo, W.K.; de Oliveira-Filho, E.F.; Rasche, A.; Greenwood, A.D.; Osterrieder, K.; Drexler, J.F. Potential Zoonotic Sources of SARS-CoV-2 Infections. Transbound. Emerg. Dis. 2021, 68, 1824–1834. [Google Scholar] [CrossRef]
- Decaro, N.; Balboni, A.; Bertolotti, L.; Martino, P.A.; Mazzei, M.; Mira, F.; Pagnini, U. SARS-CoV-2 Infection in Dogs and Cats: Facts and Speculations. Front. Veter. Sci. 2021, 8, 619207. [Google Scholar] [CrossRef]
- Delahay, R.J.; de la Fuente, J.; Smith, G.C.; Sharun, K.; Snary, E.L.; Flores Girón, L.; Nziza, J.; Fooks, A.R.; Brookes, S.M.; Lean, F.Z.X.; et al. Assessing the Risks of SARS-CoV-2 in Wildlife. One Health Outlook 2021, 3, 7. [Google Scholar] [CrossRef]
- Fenollar, F.; Mediannikov, O.; Maurin, M.; Devaux, C.; Colson, P.; Levasseur, A.; Fournier, P.E.; Raoult, D. Mink, SARS-CoV-2, and the Human-Animal Interface. Front. Microbiol. 2021, 12, 663815. [Google Scholar] [CrossRef]
- Gortázar, C.; Barroso-Arévalo, S.; Ferreras-Colino, E.; Isla, J.; de la Fuente, G.; Rivera, B.; Domínguez, L.; de la Fuente, J.; Sánchez-Vizcaíno, J.M. Natural SARS-CoV-2 Infection in Kept Ferrets, Spain. Emerg. Infect. Dis. 2021, 27, 1994–1996. [Google Scholar] [CrossRef] [PubMed]
- Palmer, M.V.; Martins, M.; Falkenberg, S.; Buckley, A.; Caserta, L.C.; Mitchell, P.K.; Cassmann, E.D.; Rollins, A.; Zylich, N.C.; Renshaw, R.W.; et al. Susceptibility of White-Tailed Deer (Odocoileus Virginianus) to SARS-CoV-2. J. Virol. 2021, 95, 10–1128. [Google Scholar] [CrossRef] [PubMed]
- Clayton, E.; Ackerley, J.; Aelmans, M.; Ali, N.; Ashcroft, Z.; Ashton, C.; Barker, R.; Budryte, V.; Burrows, C.; Cai, S.; et al. Structural Bases of Zoonotic and Zooanthroponotic Transmission of SARS-CoV-2. Viruses 2022, 14, 418. [Google Scholar] [CrossRef]
- Michelitsch, A.; Wernike, K.; Ulrich, L.; Mettenleiter, T.C.; Beer, M. SARS-CoV-2 in Animals: From Potential Hosts to Animal Models. In Advances in Virus Research; Academic Press Inc.: Cambridge, MA, USA, 2021; Volume 110, pp. 59–102. ISBN 9780128246047. [Google Scholar]
- Jackson, C.B.; Farzan, M.; Chen, B.; Choe, H. Mechanisms of SARS-CoV-2 Entry into Cells. Nat. Rev. Mol. Cell Biol. 2022, 23, 3–20. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Yang, C.; Xu, X.; Xu, W.; Liu, S. wen Structural and Functional Properties of SARS-CoV-2 Spike Protein: Potential Antivirus Drug Development for COVID-19. Acta Pharmacol. Sin. 2020, 41, 1141–1149. [Google Scholar] [CrossRef]
- Qiu, Y.; Zhao, Y.B.; Wang, Q.; Li, J.Y.; Zhou, Z.J.; Liao, C.H.; Ge, X.Y. Predicting the Angiotensin Converting Enzyme 2 (ACE2) Utilizing Capability as the Receptor of SARS-CoV-2. Microbes Infect. 2020, 22, 221–225. [Google Scholar] [CrossRef] [PubMed]
- John, S.C.; Gyles, E. Cozier ORCID logo; Charlotte Harrison; R. Elwyn Isaac; K. Ravi Acharya Crystal Structures of Angiotensin-Converting Enzyme from Anopheles Gambiae in Its Native Form and with a Bound Inhibitor. Biochem. J. 2019, 476, 3505–3520. [Google Scholar]
- Dehghani, R.; Kassiri, H. A Brief Review on the Possible Role of Houseflies and Cockroaches in the Mechanical Transmission of Coronavirus Disease 2019 (COVID-19). Arch. Clin. Infect. Dis. 2020, 15, e102863. [Google Scholar] [CrossRef]
- Xia, H.; Atoni, E.; Zhao, L.; Ren, N.; Huang, D.; Pei, R.; Chen, Z.; Xiong, J.; Nyaruaba, R.; Xiao, S.; et al. SARS-CoV-2 Does Not Replicate in Aedes Mosquito Cells nor Present in Field-Caught Mosquitoes from Wuhan. Virol. Sin. 2020, 35, 355–358. [Google Scholar] [CrossRef]
- Available online: https://www.iaea.org/newscenter/news/how-is-the-covid-19-virus-detected-using-real-time-rt-pcr (accessed on 4 February 2024).
- Available online: https://covid-19-diagnostics.jrc.ec.europa.eu/devices (accessed on 4 February 2024).
- Hindson, B.J.; Ness, K.D.; Masquelier, D.A.; Belgrader, P.; Heredia, N.J.; Makarewicz, A.J.; Bright, I.J.; Lucero, M.Y.; Hiddessen, A.L.; Legler, T.C.; et al. High-Throughput Droplet Digital PCR System for Absolute Quantitation of DNA Copy Number. Anal. Chem. 2011, 83, 8604–8610. [Google Scholar] [CrossRef]
- Taylor, S.C.; Carbonneau, J.; Shelton, D.N.; Boivin, G. Optimization of Droplet Digital PCR from RNA and DNA Extracts with Direct Comparison to RT-QPCR: Clinical Implications for Quantification of Oseltamivir-Resistant Subpopulations. J. Virol. Methods 2015, 224, 58–66. [Google Scholar] [CrossRef] [PubMed]
- Suo, T.; Liu, X.; Feng, J.; Guo, M.; Hu, W.; Guo, D.; Ullah, H.; Yang, Y.; Zhang, Q.; Wang, X.; et al. DdPCR: A More Accurate Tool for SARS-CoV-2 Detection in Low Viral Load Specimens. Emerg. Microbes Infect. 2020, 9, 1259–1268. [Google Scholar] [CrossRef] [PubMed]
- Filetti, V.; Falzone, L.; Rapisarda, V.; Caltabiano, R.; Eleonora Graziano, A.C.; Ledda, C.; Loreto, C. Modulation of MicroRNA Expression Levels after Naturally Occurring Asbestiform Fibers Exposure as a Diagnostic Biomarker of Mesothelial Neoplastic Transformation. Ecotoxicol. Environ. Saf. 2020, 198, 110640. [Google Scholar] [CrossRef] [PubMed]
- Whale, A.S.; Huggett, J.F.; Cowen, S.; Speirs, V.; Shaw, J.; Ellison, S.; Foy, C.A.; Scott, D.J. Comparison of Microfluidic Digital PCR and Conventional Quantitative PCR for Measuring Copy Number Variation. Nucleic Acids Res. 2012, 40, e82. [Google Scholar] [CrossRef] [PubMed]
- Dilokthornsakul, W.; Kosiyaporn, R.; Wuttipongwaragon, R.; Dilokthornsakul, P. Potential Effects of Propolis and Honey in COVID-19 Prevention and Treatment: A Systematic Review of in Silico and Clinical Studies. J. Integr. Med. 2022, 20, 114–125. [Google Scholar] [CrossRef] [PubMed]
- Mackin, C.; Dahiya, D.; Nigam, P.S. Honey as a Natural Nutraceutical: Its Combinational Therapeutic Strategies Applicable to Blood Infections—Septicemia, HIV, SARS-CoV-2, Malaria. Pharmaceuticals 2023, 16, 1154. [Google Scholar] [CrossRef] [PubMed]
- Abedi, F.; Ghasemi, S.; Farkhondeh, T.; Azimi-Nezhad, M.; Shakibaei, M.; Samarghandian, S. Possible Potential Effects of Honey and Its Main Components Against COVID-19 Infection. Dose-Response 2021, 19, 1559325820982423. [Google Scholar] [CrossRef] [PubMed]
- Iba, T.; Levy, J.H.; Connors, J.M.; Warkentin, T.E.; Thachil, J.; Levi, M. The Unique Characteristics of COVID-19 Coagulopathy. Crit. Care 2020, 24, 360. [Google Scholar] [CrossRef]
- Mair, K.S.; Irrgeher, J.; Haluza, D. Elucidating the Role of Honey Bees as Biomonitors in Environmental Health Research. Insects 2023, 14, 874. [Google Scholar] [CrossRef]
- Van Der Steen, J.J.M. The Colony of the Honeybee (Apis mellifera L.) as a Bio-Sampler for Pollutants and Plant Pathogens. Ph.D. Thesis, Wageningen University and Research, Wageningen, The Netherlands, 2016. [Google Scholar]
Sample | Sampling Period | Time Period |
---|---|---|
S1–S28 | September 2020–December 2020 | T1 |
S29–S50 | April 2021–July 2021 | T2 |
S51–S69 | September 2021–February 2022 | T3 |
S70–S91 | April 2022–June 2022 | T4 |
Sample | Sampling Site |
---|---|
H1 | Sant’Anastasia (NA) |
H2 | Cassano Irpino (AV) |
H3 | Succivo (CE) |
H4 | Formicola (CE) |
H5 | Marano (NA) |
H6 | Ercolano (NA) |
Primer Name | Sequence | Concentrations | Reference |
---|---|---|---|
N_Sarbeco_F | CACATTGGCACCCGCAATC | 600 nM | Corman et al., 2020 [40] |
N_Sarbeco_R | GAGGAACGAGAAGAGGCTTG | 800 nM | |
N_Sarbeco_P | FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ * | 200 nM | |
2297-CoV-2-F | ACATGGCTTTGAGTTGACATCT | 500 nM | La Rosa et al., 2021 [38] |
2298-CoV-2-R | AGCAGTGGAAAAGCATGTGG | 900 nM | |
2299-CoV-2-P | FAM-CATAGACAACAGGTGCGCTC-MGBEQ * | 250 nM |
Sample * | SARS-CoV-2 Concentration | Sampling Site | |
---|---|---|---|
Orf1b nsp14 g.c./µL RNA | N Gene g.c./µL RNA | ||
S30 | 1.9 | 0.4 | Pozzuoli (NA) |
S37 * | 0.29 | 0.21 | Cava dei Tirreni (SA) |
S39 | 0.14 | 0.54 | Teano (CE) |
S51 | 6.1 | 1.2 | Ercolano (NA) |
S54 | 0.9 | 0.25 | San Giorgio la Molara (BN) |
S60 | 7.8 | 1.6 | Napoli (NA) |
S62 | 7.8 | 1.2 | Torchiati (AV) |
S68 | 0.7 | 0.3 | Bellona (CE) |
S70 | 1.7 | 0.22 | Formicola (CE) |
S73 | 0.23 | 0.2 | Sant’Anastasia (NA) |
S75 | 1.2 | 0.31 | Marano (NA) |
S88 | 1.0 | - | Solofra (AV) |
Sample | SARS-CoV-2 Concentration | Sampling Site | |
---|---|---|---|
Orf1b nsp14 g.c./µL RNA | N Gene g.c./µL RNA | ||
H1 | 0.28 | 0.15 | Sant’Anastasia (NA) |
H6 | 0.6 | 0.23 | Ercolano (NA) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mancusi, A.; Proroga, Y.T.R.; Maiolino, P.; Marrone, R.; D’Emilio, C.; Girardi, S.; Egidio, M.; Boni, A.; Vicenza, T.; Suffredini, E.; et al. Droplet Digital RT-PCR (dd RT-PCR) Detection of SARS-CoV-2 in Honey Bees and Honey Collected in Apiaries across the Campania Region. Viruses 2024, 16, 729. https://doi.org/10.3390/v16050729
Mancusi A, Proroga YTR, Maiolino P, Marrone R, D’Emilio C, Girardi S, Egidio M, Boni A, Vicenza T, Suffredini E, et al. Droplet Digital RT-PCR (dd RT-PCR) Detection of SARS-CoV-2 in Honey Bees and Honey Collected in Apiaries across the Campania Region. Viruses. 2024; 16(5):729. https://doi.org/10.3390/v16050729
Chicago/Turabian StyleMancusi, Andrea, Yolande Thérèse Rose Proroga, Paola Maiolino, Raffaele Marrone, Claudia D’Emilio, Santa Girardi, Marica Egidio, Arianna Boni, Teresa Vicenza, Elisabetta Suffredini, and et al. 2024. "Droplet Digital RT-PCR (dd RT-PCR) Detection of SARS-CoV-2 in Honey Bees and Honey Collected in Apiaries across the Campania Region" Viruses 16, no. 5: 729. https://doi.org/10.3390/v16050729