Skip to Content
MDPIMDPI
VirusesViruses
PDF
  • Article
  • Open Access

14 August 2024

Re-Emergence of DENV-3 in French Guiana: Retrospective Analysis of Cases That Circulated in the French Territories of the Americas from the 2000s to the 2023–2024 Outbreak

,
,
,
,
,
,
,
,
…
1
Arbovirus National Reference Center, Virology Unit, Institut Pasteur de la Guyane, Cayenne 97300, French Guiana
2
Laboratoire Centre Hospitalier de Cayenne, Cayenne 97300, French Guiana
3
Department of Biology, West French Guiana Hospital Center, Saint-Laurent-du-Maroni 97320, French Guiana
4
Santé Publique France, Cellule Guyane, Cayenne 97300, French Guiana
Viruses2024, 16(8), 1298;https://doi.org/10.3390/v16081298
This article belongs to the Section Human Virology and Viral Diseases
Version Notes
Order Reprints
Review Reports

Abstract

French Guiana experienced an unprecedented dengue epidemic during 2023–2024. Prior to the 2023–2024 outbreak in French Guiana, DENV-3 had not circulated in an epidemic manner since 2005. We therefore studied retrospectively the strains circulating in the French Territories of the Americas (FTA)—French Guiana, Guadeloupe, and Martinique—from the 2000s to the current epidemic. To this end, DENV-3 samples from the collection of the National Reference Center for Arboviruses in French Guiana (NRCA-FG) were selected and sequenced using next-generation sequencing (NGS) based on Oxford Nanopore Technologies, ONT. Phylogenetic analysis showed that (i) the 97 FTA sequences obtained all belonged to genotype III (GIII); (ii) between the 2000s and 2013, the regional circulation of the GIII American-I lineage was the source of the FTA cases through local extinctions and re-introductions; (iii) multiple introductions of lineages of Asian origin appear to be the source of the 2019–2021 epidemic in Martinique and the 2023–2024 epidemic in French Guiana. Genomic surveillance is a key factor in identifying circulating DENV genotypes, monitoring strain evolution, and identifying import events.

1. Introduction

Dengue, which is endemic in tropical and subtropical regions, is the most common and fastest-spreading mosquito-borne disease in the world. Over the past two decades, the World Health Organization (WHO) has reported a dramatic increase in the global incidence of dengue, from 505,430 cases in 2000 to 5.2 million in 2019 [1]. Although Asia usually accounts for most of the global disease burden, the Americas region is also experiencing an exponential rise in dengue cases. In 2023, with almost 4.6 million cases reported, the Americas accounted for 80% of the global rate: 7665 severe cases and 2363 deaths (case fatality rate 0.052%) were recorded in the region [1,2,3]. For at least two decades, the epidemiology of dengue in French Guiana and the other French Territories of the Americas (FTA)—Guadeloupe and Martinique—has been characterized by an endemo-epidemic circulation of dengue, with a 3–5-year periodicity of outbreaks, often associated with a shift in the predominant circulating dengue virus (DENV) serotype [4,5,6,7]. Since July 2023, French Guiana has been facing an unprecedented dengue epidemic, which was still ongoing in April 2024. According to Santé publique France (SpF), epidemic transmission is defined by a significant increase in the main surveillance indicators (number of confirmed cases and number of clinically evocative cases of dengue) for at least two consecutive weeks, reaching or exceeding the levels observed at the start of past epidemics. A total of 17,485 clinically evocative cases of dengue have been seen in general medical services or health centers, and 10,303 confirmed cases have been reported, with co-circulation of the two serotypes DENV-2 and DENV-3 [8]. Interestingly, prior to the 2023–2024 outbreak in French Guiana, DENV-3 had not circulated in an epidemic manner since 2005. DENV-3 is subdivided into five genotypes—genotypes I to V (GI–GV) [9,10]. Genotypes I and II are detected in Asian regions; genotype III is widely distributed (Asia, the Caribbean, the Americas, and Europe); genotype IV consists of old strains, no longer detected, isolated from Tahiti (1965) and Puerto Rico (1963/1977); and finally, genotype V comprises Asian strains and a few American strains, such as those from Brazil and Colombia [10].
Few DENV sequences from French Guiana are available in public databases, and no DENV-3 sequences from the 2023–2024 epidemic in French Guiana have been reported to date. However, studying the genetic evolution of DENV is essential for our understanding of the evolutionary history of strains circulating in the region, tracing importation events, and dating common ancestors. To address this lack of knowledge, we studied DENV-3 strains that circulated in the FTA, i.e., French Guiana, Guadeloupe, and Martinique, from the 2000s to 2024. A total of 97 complete DENV3 genomes were obtained and used in phylogenetic analyses to determine the circulating genotypes and to achieve a better understanding of the dynamics of DENV-3 circulation in FTA.

2. Materials and Methods

2.1. Ethics Statement

This study was part of a public health surveillance program of the National Reference Center for Arboviruses in French Guiana (NRCA-FG), which works in collaboration with the French Public Health Agency (Santé Publique France, SPF). Accordingly, as an epidemiological record, approval by an ethics committee was not required. The samples involved in this study were chosen among remaining human serum samples received as part of standard diagnostic and expertise activities of the NRCA-FG and stored in the NRCA-FG biobank according to French legislation (article L.1211–2 and related articles of the French Public Health Code—FPHC). Human serum samples were anonymized, with no or minimal risk to patient data privacy, in accordance with the terms of the European General Data Protection Regulation and the French National Commission on Informatics and Liberty (CNIL).

2.2. Clinical Samples and Study Design

The samples used in this study came from the NRCA-FG biobank, which comprises clinical specimens received from hospitals and private laboratories in French Guiana and the French Caribbean Islands as part of the arbovirus surveillance system. Between 2001 and January 2024, 2779 samples were tested DENV-3-positive, among which 1448 had a cycle threshold (Ct) value below 26 (10 from Guadeloupe, 75 from Martinique, and 1363 from French Guiana) (Table 1). Among these samples, a selection was made in each municipality and for each detection period, leading to 97 samples collected between 2001 and 2024 (Table 1) being selected for the analysis, including 5 from Guadeloupe, 7 from Martinique, and 85 from French Guiana. The location of these different municipalities is presented in Figure A1 of Appendix A.
Table 1. Number of generated sequences (N selected) by territory/municipality and year of sampling among samples found positive for DENV-3 with a Ct < 26.

2.3. MinION Library Preparation and Multiplexed Nanopore Sequencing

Whole-genome sequencing was performed using the MinION device (Oxford Nanopore Technologies, Oxford, UK) based on a protocol from Quick et al., 2017 [11]. Briefly, 8 μL of RNA was reverse transcribed to cDNA using LunaScript RT SuperMix (NEB, Ipswich, MA, USA) following the manufacturer’s instructions. A serotype-specific multiplex polymerase chain reaction (PCR) [12] was performed with Q5 High-Fidelity DNA polymerase (NEB), and the amplifications were performed into three distinct pools (Table A1). Primer schemes were adapted from the CDC protocol (Table A1) [13,14,15]. For the multiplex PCR, the cycling conditions were 30 s at 98 °C, followed by 35 cycles at 98 °C for 15 s, and 63 °C (Pool 1 and 2) or 60 °C (Pool 3) for 5 min.
The resulting PCR products were pooled, cleaned using AmpureXP magnetic beads (Beckman Coulter, Brea, California, USA), and quantified using a Qubit dsDNA High Sensitivity assay on a Qubit 3.0 instrument (Thermo Fisher Scientific, Waltham, MA, USA). The samples were then end-repaired using the Ultra II End Repair/dA-Tailing Module (New England Biolabs, Ipswich, MA, USA) and barcoded with the native barcoding kits NBD104 and NBD196 (Oxford Nanopore Technologies, Oxford, UK) according to the manufacturers’ instructions. They were subsequently cleaned with magnetic beads and pooled before ligation of the AMII adapters with blunt/TA ligase master mix (New England Biolabs) using the SQK-LSK-109 kit (Oxford Nanopore Technologies). Sequencing libraries were loaded onto the R9.4 flow cell (Oxford Nanopore Technologies), and sequencing data were collected overnight. Sequence reads were base-called and demultiplexed using the Guppy algorithm v3.6 (Oxford Nanopore Technologies). The consensus genome sequences were produced using the Artic network’s bioinformatics pipeline, version 1.2.4 (https://artic.network/ncov-2019/ncov2019-bioinformatics-sop.html, accessed on 1 February 2024), with a reference genome (MH544651.1) and the Medaka algorithm (https://github.com/nanoporetech/medaka, accessed on 1 February 2024). Regions with insufficient coverage (minimum depth coverage set to 20) were masked with N characters.

2.4. Phylogenetic Analysis

Whole-genome consensus sequences of DENV-3 were aligned with the CLC Main Workbench software (version 22; Qiagen, Hilden, Germany) to DENV-3 whole-genome reference sequences downloaded from GenBank. In total, 79 reference sequences were selected with a geographical and time distribution, covering the various genotypes described to date (Table A2). The most closely related sequences of each NRCA-FG-generated sequence were retrieved from GenBank based on a BLAST search (NCBI). The 97 sequences produced in this study and described in Table A3 were aligned with the 79 reference genomes of DENV-3 from the GenBank database. The BEAST and BEAUTI (version 1.10.1) software programs were used to construct the maximum clade credibility (MCC) tree, using the GTR + G + I (General Time Reversible with Gamma distribution and Invariant sites) substitution model, corresponding to the best-fit model tested on the CLC Main Workbench software, according to the corrected Akaike information criterion (AICc), with a strict clock model and Bayesian skyline prior [16,17,18]. A Markov chain Monte Carlo (MCMC) analysis was run for 50 million generations with sampling every 1000 generations. The final MCMC sampling chains were checked using Tracer v1.7.1, with 10% burn-ins removed. Convergence was obtained by reaching an effective sample size (ESS) of >200 for all parameters using Tracer v1.7.1 [19]. The MCC tree was generated with Tree Annotator 1.10.4, and the time-scaled phylogeny was visualized using FigTree v1.4.3 (http://tree.bio.ed.ac.uk/software/figtree/, accessed on 21 June 2024).

3. Results

The phylogenetic analysis was carried out on a dataset of 176 whole-genome DENV-3 sequences (Figure 1). All of the DENV-3 complete genome sequences obtained from French Guiana (FG), Guadeloupe (GLP), and Martinique (MTQ) having circulated between 2001 and 2024 belong to genotype III (GIII) (Figure 1).
Figure 1. Bayesian phylogeny of DENV-3 whole-genome sequences. The maximum clade credibility (MCC) tree, using the GTR + G + I (General Time Reversible with Gamma distribution and Invariant sites) substitution model, was constructed with a strict clock model and Bayesian skyline prior. The analysis included 97 sequences obtained with nanopore sequencing technology (Oxford Nanopore Technologies, ONT) at NRCA-FG and 79 reference sequences downloaded from GenBank. DENV-3 OM258630 Puerto Rico 1953 (unclassified genotype) was used as the outgroup.

3.1. Circulation of Regional Strains in the Early 2000s

Looking more specifically at GIII, the FTA sequences in the early 2000s (e.g., PP582621 FG 2001-11-04 and PP582622 FG 2013-01-24) are intermingled with other American sequences during the same period, including sequences from Venezuela in 2003, Mexico in 2007, Peru in 2008, and Brazil in 2002 and in 2007 (Figure 1).

3.2. Multiple Introductions Are the Source of the 2019–2021 Epidemic in Martinique

DENV-3 sequences circulating in Martinique between 2019 and 2021 are divided into two clades: the first containing sequences from 2019 and the first half of 2020, and the second containing sequences from the second half of 2020. Sporadic cases of DENV-3 detected in Guadeloupe and French Guiana all belong to clade 2 (Figure 2). Clade 1 sequences shared 99.93–99.99% nucleotide identity/98.23–100% amino acid identity and are related to sequences from Africa (Ethiopia 2019 ON890788, MN964273). Clade 2 sequences shared 99.54–99.95% nucleotide identity/99.00–99.91% amino acid identity and are related to Asian sequence strains (Maldives 2019 ON890789, India 2016 MN018385). The percentage of nucleotide identity between these two clades ranges from 97.04% to 97.2%. A more detailed analysis of the nucleotide polymorphisms between these two clades was carried out (Table A4). The mutation rate varies throughout the coding genome, with the highest rates observed in the regions coding for the NS2A (3.21%) and NS5 (3.07%) proteins, Table A4. In addition, sequences from clade 1 shared 96.14–96.16% nucleotide identity with AY099337 Martinique 1999. The most recent common ancestor (MRCA) between AY099337 Martinique 1999 and clade 1 dates back to 1976 (95% HPD 1974–1979) (Figure 1), also suggesting a change of clade between them associated with a novel introduction.
Figure 2. Bayesian phylogeny of DENV-3 whole-genome sequences with a focus on the 2020 Martinique outbreak. The maximum clade credibility (MCC) tree, using the GTR + G + I (General Time Reversible with Gamma distribution and Invariant sites) substitution model, was constructed with a strict clock model and Bayesian skyline prior.

3.3. New Introduction Is the Source of the 2023–2024 Epidemic in French Guiana

DENV-3 sequences from the 2023–2024 French Guiana epidemic are grouped in a well-supported monophyletic clade (bootstrap support 100%) with 99.52–100% nucleotide identity, and 99.65–100% amino acid identity. They are intermingled with sequences from the Americas, notably Brazilian sequences from the same year (OQ706226; OQ706227; OQ706228), Cuban sequences (OQ821545, OQ821510, OQ821537, OQ132878), or a Surinamese sequence (OQ868517). This clade, with an MRCA dating from 2020 (95% HPD 2019–2020), is clearly distinct from the one composed of the DENV-3 sequence circulating during 2020–2021. Indeed, the MRCA of these two clades dates back to 2007 (95% HPD 2006–2009). However, these 2023–2024 sequences are related to Asian strains (ON123669 India 2018, OM865820 Bhutan 2019, and India 2021 OM638675/ON109599).

3.4. Amino Acid Substitution Analysis among the 97 FTA Sequences

Amino acid (AA) substitution analysis between the 97 FTA DENV-3 sequences was carried out to assess the degree of amino acid variability over time. A total of 159 distinct amino acid substitutions was observed between sequences (Table A5). The regions with the highest number of substitutions are those coding for the envelope protein (22 AA changes), the NS2A protein (19 AA changes), NS3 (25 AA changes), and NS5, the RNA-dependent RNA polymerase (49 AA changes). The highest AA substitution rates are observed in regions coding for NS2A (8.72%), 2K (8.70%), NS2B (6.15%), and NS5 (5.51%) proteins. Of these AA changes, 51 are conserved across all strains in a given period. Some are period-specific, as observed for the 2023–2024 epidemic period, with six specific amino acid changes: 2530 I/V, 3487 F/L, 3931 M/L, 4946–4947 T/M, 5595 D/E, and 10,060 P/S. Others are shared between different periods: between the 2019–2020 clade 2 viruses and the 2023–2024 viruses for the three AA changes 1312 V/I, 6706 L/M, and 9958 V/I; or between all strains of the 2019–2021 Martinique and 2023–2024 French Guiana epidemics for the AA changes 2596 I/T, 2851 L/M, 4204 I/V, 4510 F/L, 4597 Y/H, 7069 I/V, 8032 T/A, 8155 A/S, 8563 S/P, 8591 G/E, and 9154 Q/L. It is therefore possible to define period-specific substitution profiles (2001/2013/2019–2021/2023–2024). The clades (clades 1 and 2) of the 2019–2021 Martinique epidemic thus can be distinguished from each other (clades 1 and 2) and from other FTA strains by a combination of 18 specific AA changes (Supplementary Table S1).

4. Discussion

In this study, we described the DENV-3 genotypes circulating in the FTA during a 20-year period as well as the recent introduction event leading to the current epidemic in French Guiana. The 97 FTA sequences obtained in this study all belong to DENV-3 GIII, which is therefore the only sequence to have been detected in French Guiana, Guadeloupe, and Martinique between the 2000s and the present. In addition, analyses of amino acid substitution profiles by period for the 97 sequences in the FTA (2001/2013/2019–2021/2023–2024) clearly show the genetic evolution over time of the DENV-3 virus circulating in this region. According to the literature, DENV-3 GIII circulates worldwide, while the other genotypes are localized in particular geographical areas [15,20,21]. This genotype has been implicated in major dengue epidemics in several regions of Asia, America, and Africa [15,20,21,22,23,24,25,26,27], which suggests that it has great potential to spread and adapt in various geographical regions of the world [15,20,22,23]. First introduced in Central America in the 1990s from Asia, the DENV-3 GIII sequence rapidly spread and expanded into the Americas [15]. The extensive transmission across the Americas observed in the subsequent years, combined with a significant separate evolution of this genotype from the Asian lineage, led to a new lineage: the DENV-3 GIII American-I lineage [15]. In the FTA, DENV-3 were first described in 1999, circulating at high levels until 2005 before falling back to low levels, with only a few sporadic cases reported over the next 15 years [5,28,29]. This study shows that between 1999 and 2013, all the FTA strains belong to the DENV-3 GIII American-I lineage, but to distinct clades, intermingled with other American sequences circulating during the same period. These observations favor the notion of a circulation in the FTA based on extinctions and re-introductions of strains from regional circulating strains rather than the re-emergence of previously circulating strains. Even though the DENV-3 GIII American-I lineage was still recorded in Mexico in 2021 [15], the diversity of DENV-3 GIII circulating in the Americas has increased significantly in recent years by introductions of new GIII lineages, as shown in this study. These multiple introductions are associated with a large re-emergence of DENV-3 in the region and have led to recent epidemics, such as the 2019–2021 outbreak in Martinique or the 2023–2024 outbreak in French Guiana.
Surprisingly, the DENV-3 sequences from the 2019–2021 Martinique epidemic belonged to two different clades, highlighting multiple introductions of DENV within a single epidemic. These two clades—the first grouped with sequences originating from Africa and the second with sequences from Asia—have already been described by Garcia Van Smévoorde et al. [30]. Interestingly, the two clades succeeded one another during the epidemic, with the first clade detected from the end of 2019 to mid-2020, associated with a moderate epidemic, which was replaced after mid-2020 by the emergence of clade 2, associated with an unprecedented epidemic peak. Overall, this was the longest epidemic (67 weeks) ever recorded in Martinique since surveillance began, the most intense, and also the most severe [31].The highest rates of signature mutations between clades 1 and 2 are observed in the regions coding for the NS2A (3.21%) and NS5 (3.07%) proteins. As the NS5 protein plays a key role in viral replication [32], this leads us to question the involvement of these mutations in the intensity and severity of the second epidemic phase. The intensity and the length of the epidemic may have been favored by multiple introductions and successive circulations.
The DENV-3 sequences from the 2023–2024 French Guiana epidemic appeared clearly distinct from both clades identified in the FTA during 2019–2020. These FG sequences belong to a well-supported monophyletic clade and are intermingled with sequences from the Americas, notably from Brazil, Cuba, and Suriname with which they share a recent common ancestor (2020). All of this suggests a recent introduction and circulation of this lineage in the American region. The closest sequences of non-American strains identified in NCBI come from Asia (India, Bhutan), suggesting an Asian origin through one or more introductions. However, other routes of introduction cannot be excluded, as these data depend on what is available in databases, which are not exhaustive.
These observations highlight the intensity of the exchanges of DENV-3 strains at a regional but also global level. In a similar way, Klitting et al. have described recent and multiple introductions of DENV-2 in the FTA [33]. The intensity of these exchanges has an impact on the diversity of DENV and on the epidemiological evolution.
The DENV-3 extinction observed between 2005 and 2023–2024 in FG could be partly explained by the population’s herd immunity caused by the dominant circulation of the DENV-3 GIII American-I lineage during the 2001–2002 and 2004–2005 epidemics. The epidemics that followed were then associated with the other serotypes, with a classic alternation of the predominant serotypes: the 2006 epidemic was associated with a majority of DENV2, the 2009–2010 epidemic with a majority of DENV-1 and a co-circulation of DENV-4, the 2012–2013 epidemic with a majority of DENV-2 and a co-circulation of DENV-4, and the 2019–2020 epidemic with a majority of DENV-1 and a co-circulation of DENV-2 strains. The long absence of DENV-3 circulation may also have been favored by the absence of a significant circulation of DENV from 2014 to 2019. This absence, unusual in endemo-epidemic regions for DENV, was concomitant with the emergence of CHIKV and ZIKV, suggesting potential viral competition for the vector Aedes aegypti [34,35,36,37].
The re-emergence of DENV-3 in FG, combined with a co-circulation of DENV-2, led to the unprecedented epidemic of 2023–2024 [34,38]. An increase in the dengue-naive population resulting from, for example, tourism in Martinique and Guadeloupe or the high birth rate in French Guiana could have favored the re-emergence of DENV-3 in the FTA [39,40,41,42,43,44].
However, a new lineage is not necessarily associated with an epidemic, as shown during 2019–2020, with the importation of another new DENV-3 GIII lineage responsible for a major epidemic in Martinique but only for sporadic cases in FG. Thus, other factors are involved in the spread and diversification of DENV, such as environmental and socioeconomic factors facilitating the adaptation and proliferation of vectors, or alterations in the population’s herd immunity resulting from changes in the level of immunity [35,45,46,47,48,49].
Infection with any DENV serotype results in long-term homotypic immunity [50]. However, the increase in genetic diversity associated with the introduction of new lineages may lead us to wonder about the impact of the genetic diversity on antigenic characteristics and therefore on the immunity induced by previous infections and their potentially protective or facilitating nature. This point is key for defining vaccine development strategies [46,50,51,52,53,54,55,56].

5. Conclusions

In conclusion, our findings showed that the sequences obtained in this study all belong to DENV-3 GIII, with distinct lineages reflecting intense exchanges in the Americas and also worldwide (with import particularly from Asia). Indeed, over a period of 20 years and especially in the last 5 years, multiple introductions have been identified. This study highlights the importance of genomic surveillance and sequencing efforts in the FTA, but also globally, for monitoring the emergence and re-emergence of DENV-3 and, more generally, of all serotypes. Studying the genetic evolution of DENV is therefore essential for understanding the evolutionary history of strains circulating in the region and for tracing import events. These data are important public health elements for monitoring epidemics.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/v16081298/s1.

Author Contributions

Conceptualization, A.E., A.L. (Anne Lavergne) and D.R.; Formal analysis, A.L. (Alisé Lagrave) and S.T.; Resources, M.P.D., J.J., J.-F.C., T.R., T.S., L.C., S.D., F.D., L.L., A.B.-A. and D.M.; Supervision, A.L. (Anne Lavergne) and D.R.; Writing—original draft, A.L. (Alisé Lagrave), A.L. (Anne Lavergne), and D.R.; Writing—review & editing, A.L. (Alisé Lagrave), A.E., S.T., M.P.D., J.J., J.-F.C., T.R., T.S., L.C., S.D., F.D., L.L., A.B.-A., D.M., A.L. (Anne Lavergne) and D.R. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financed by the NRCA-FG. The activity of the National Reference Centers is supported by the French National Health Agency (Santé Publique France).

Institutional Review Board Statement

This study was part of a public health surveillance program of the National Reference Center for Arboviruses in French Guiana (NRCA-FG), which works in collaboration with the French Public Health Agency (Santé Publique France, SPF). Accordingly, as an epidemiological record, approval by an ethics committee was not required. The samples involved in this study were chosen among remaining human serum samples received as part of standard diagnostic and expertise activities of the NRCA-FG and stored in the NRCA-FG biobank according to French legislation (article L.1211–2 and related articles of the French Public Health Code—FPHC). Human serum samples were anonymized, with no or minimal risk to patient data privacy in accordance with the terms of the European General Data Protection Regulation and the French National Commission on Informatics and Liberty (CNIL).

Data Availability Statement

All virus sequences are accessible on GenBank (accessions specified in the Supplementary Materials).

Acknowledgments

We thank the working group members of the arbovirus genomics diagnostic laboratories and their affiliations for their valuable contributions—Guadeloupe: Synergibio and INOVIE Biopôle Antilles; Martinique: Cerballiance and Eurofins; French Guiana: Eurofins and French Guiana hospital laboratories. We also thank the technicians of the National Research Center for Arboviruses of French Guiana for their input.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

AAamino acid
BEASTBayesian Evolutionary Analysis Sampling Trees
BEAUtiBayesian Evolutionary Analysis Utility
cDNAcomplementary DNA
CDScoding sequence
CLCCLC Main Workbench
CNILNational Commission on Informatics and Liberty
DENVdengue virus
DENV-3dengue virus serotype 3
ESSeffective sample size
FGFrench Guiana
FPHCFrench Public Health Code
FTAFrench Territory of the Americas
GIIIGenotype III
GTR + G + IGeneral Time Reversible with Gamma distribution and Invariant sites
95% HPD95% high-probability densities
MRCAmost recent common ancestor
NGSnext-generation sequencing
NRCA-FGNational Research Center for Arboviruses French Guiana
NSNonstructural protein
MCCmaximum clade credibility
ONTOxford Nanopore Technologies
PCRpolymerase chain reaction
SPFSanté Publique France
WHOWorld Health Organization

Appendix A

Viruses 16 01298 g0a1
Figure A1. Map of French Guiana, Martinique, and Guadeloupe.
Figure A1. Map of French Guiana, Martinique, and Guadeloupe.
Viruses 16 01298 g0a1
Table A1. Primer sequences used for NGS sequencing with ONT technologies.
Table A1. Primer sequences used for NGS sequencing with ONT technologies.
Primer NameSequenceAmplicon SizePool
DENV3-F-1AGTTGTTAGTCTACGTGGACCGAC4741
CDC-D3-R-1ATCATSCGYGGCTCTCCAT
CDC-D3-F-3AGCRYAGACGYGAYAAGAGATC393
CDC-D3-R-3GCCTCGGTCTTCTGRAGCTCTA
CDC-D3-F-5GAGCARGACCARAACTACGT523
DENV3-R1TGCATTGCTCCCTCTTGYGAT
CDC-D3-F-7CTCAAGGGGATGAGYTATGCAA404
CDC-D3-R-7AACRCCACCYACTGWTCCAAAG
CDC-D3-F-9TGCACCAAATATTYGGAAGTGC402
CDC-D3-R-9AGYTCATTRGCTATYTGCTTCCA
CDC-D3-F-15CGTTGACTGTYGCCTGGAGAA390
CDC-D3-R-15TGGGACACTCCTGTTTGCTCA
CDC-D3-F-17ACACAGAAAGCAGAACTGGAAGA409
CDC-D3-R-17AGYCCCACTACCTTTCCCTCT
CDC-D3-F-21GTGATYGACCCAAGAAGATGTCT402
CDC-D3-R-21TGATYCCTTCTGAKGCTACTTT
CDC-D3-F-23AAYATGGAYGTGGAAATCTGGA391
CDC-D3-R-23ACACARATRAGTCCTATTGARGTCTTT
CDC-D3-F-33GGCACGGTAATGGACATYATATCT421
CDC-D3-R-33CYACCAACTTTCTTCCATCTTTC
CNR-D3-F-36CTTCYAGAGCAACCTGGGCYC559/581
CNR-D3-R-36BisCCATTCCATTTTCTGGCGTTCTG
DENV3-R-8AGAACCTGTTGATTCAACAGCACC
CDC-D3-F-2TTGCTTTCCACTTGACYTCRCG4142
CDC-D3-R-2GCTAGTATKGTGAAMCCTGGRT
CDC-D3-F-4CCATGACAATGAGATGYGTGGGA399
CDC-D3-R-4TGMACYRCTTTTCCCTCTAT
CDC-D3-F-8GCWGAACCYCCTTTTGGGGAAA393
CDC-D3-R-8CACAYCCCATGTCAGCTTG
CDC-D3-F-10AAGAACTYAAATGYGGAAGTGGAAT413
CDC-D3-R-10CTCTTGAGGCAYTTGGACACTC
CDC-D3-F-12GGCTAYTGGATAGAAAGCCA415
CDC-D3-R-12GGTCTRATTTCCATRCCATACCA
CDC-D3-F-14CAGGGCARATAACATGGAGA424
CDC-D3-R-14CATGCTCGAAGACTGGCACA
CDC-D3-F-16CATAACTGGCACGTCAGCAGAC395
CDC-D3-R-16ACTCCTTCTTTTTGYACTCCAAC
CDC-D3-F-18GGGGARATAGGRGCRATTGCAC397
CDC-D3-R-18GTGTGTTCAGATTTTGTTGC
CDC-D3-F-20ACGCTCATGGAATTCAGGCAAT407
CDC-D3-R-20TGGCCCGTGAATATGTAYTG
CDC-D3-F-22CCAGAAGGAATCATACCAGCT394
CDC-D3-R-22GGCACTCTTCCTATTTCTGTCACA
CDC-D3-F-24CCAGARACAATGGAAACACT427
CDC-D3-R-24TACAATGTCCARGCTGATGCT
CDC-D3-F-26AGGTCCAGGAYTGCARGCA400
CDC-D3-R-26CACCTTGWGASCCTGTTC
CDC-D3-F-28GTGGAAGAGGAGGCTGGTCATA406
CDC-D3-R-28CATTTCRTGCGTGGAGTTTCG
CDC-D3-F-30TAAAAAGRATCAAGGAGGAGC415
CDC-D3-R-30CCATTGGTTCTCCTCYGTGAA
CDC-D3-F-32CATGTGGTTGGGAGCCA427
CDC-D3-R-32CTGGGCTTCCATGTTRGTRAAT
CDC-D3-F-34TGGCATGAYTGGCARCAGGT391
CDC-D3-R-34ACTGGAGTTTTGTCYTCCATCCA
CDC-D3-F-6TACCATGGACATCAGGRG3083
CDC-D3-R-6GTATTGTCCCATGYTGYGT
CDC-D3-F-11ATAGTGACAGCWGAAAYAC427
CDC-D3-R-11GCCGTYTGGGTGTGRTA
CDC-D3-F-13GAAGGAACAACRGTWGTCAT406
CDC-D3-R-13GCGTTGGAYCCAATCATT
CDC-D3-F-19TGGAAGAAGCAYTGAAAGG402
CDC-D3-R-19ATGCTRGGGACAAACCAC
CDC-D3-F-25TYGCATATGTYGTRATAGGC615
CDC-D3-R-25GCCCATGATGTTCTCAT
CDC-D3-F-27ACRATAGCYGTYTCMATG415
CDC-D3-R-27CCTTTTGTGTATCCTCGYACT
CDC-D3-F-29GGAGGAATGCTTGTGAGAAA361
CDC-D3-R-29TTTATCATGGAGGAGGCTGAGC
CDC-D3-F-31GAGAACYCTGGGAAGGAAYAAA395
CDC-D3-R-31TTRTGCARTCCTTCYCCTTC
CDC-D3-F-35GAAAGCCTAYGCYCAAATGTG438
CDC-D3-R-35TTTACCAAATGGCTCCCT
Table A2. List of reference sequences from https://www.ncbi.nlm.nih.gov/, along with collected information.
Table A2. List of reference sequences from https://www.ncbi.nlm.nih.gov/, along with collected information.
A. NumberCountryCollection DateGenotype
1OQ821545.1Cuba2022III
2OQ821510.1Cuba2022III
3OQ132878.1Niger imported from Cuba2022III
4OQ706226.1Roraima State Brazil2023III
5OQ706227.1 Roraima State Brazil2023III
6OQ706228.1Roraima State Brazil2023III
7OQ821537.1Cuba2022III
8OQ868517.1Suriname2023III
9ON123669.1India2018III
10OM865820.1Bhutan2019III
11OM638675.1India2021III
12ON109599.1India2021III
13OR229981.1Guadeloupe2020III
14OR229978.1Martinique2020III
15MN018385.1India2016III
16OR229982.1Martinique2020III
17ON890789.1Maldives2019III
18OQ339138.1India2022III
19OR029719.1China2019III
20OR418423.1Thailand2023III
21OR229984.1Martinique2020III
22ON890788.1Ethiopia2019III
23MN964273.1 Ethiopia2019III
24MT261978.1Burkina Faso2017III
25MW288037.1Senegal2018III
26MT261977.1Burkina Faso2017III
27KU509282.1Senegal2009III
28KU509286.1 India2011III
29KU509281.1 India2009III
30GU131862.1Sao Paulo Brazil2007III
31EF643017.1Brazil2003III
32JX669508.1 Brazil2006III
33JF808120.1Brazil2009III
34AY679147.1Rio de Janeiro Brazil2002III
35OQ727062.1Amazonas Manaus Brazil2006III
36AY099337.1Martinique1999III
37KU509278.1Barbados2007III
38FJ898464.1Guyana2002III
39GQ868617.1Trinidad and Tobago2002III
40FJ898464.1Saint Lucia2001III
41EU529691.1Venezuela2001III
42FJ850094.1Northern Brazil2008III
43EU529696.1Puerto Rico1999III
44FJ898474.1Venezuela2007III
45FJ024470.1Puerto Rico2004III
46KT726354.1Cuba2001III
47EU529703.1Puerto Rico1998III
48MH544651.1Colombia2016III
49KJ189298.1Peru2008III
50FJ639786.1Venezuela2003III
51FJ639804.1Venezuela2005III
52KF955479.1Venezuela2001III
53HQ332171.1Cuba2006III
54FJ898442.1Mexico2007III
55KU509283.1Sri Lanka2006III
56EU081210.1Singapore2005III
57NC_001475.2 Sri Lanka2000III
58KU509280.1 Thailand2011II
59GU131906.1Cambodia2003II
60AY923865.1Thailand1994II
61OQ103113.1 Sri Lanka2020I
62OQ103317.1 Sri Lanka2022I
63MH823209.1Indonesia2016I
64ON890832.1China2019I
65ON907583.1 Bangladesh2019I
66MN018388.1 China2017I
67KC762693.1 Indonesia2010I
68MN018384.1 China2016I
69KU509285.1 Thailand2010I
70AY858047.2 Indonesia2004I
71AB214882.1Timor-Leste2005I
72AB189128.1 Indonesia1998I
73KU509279.1Philippines2008I
74AY744683.1French Polynesia1992I
75JQ920486.1 New Caledonia1996I
76AY744679.1 French Polynesia1990I
77AY496879.2Philippines1997I
78JQ922554.1 USA1963V
79OM258630.1 Puerto Rico1953unclassified
Table A3. French Guiana, Guadeloupe, and Martinique DENV-3 sequences obtained by NGS (n = 97).
Table A3. French Guiana, Guadeloupe, and Martinique DENV-3 sequences obtained by NGS (n = 97).
Sequence IDAccession NumberSize (PB)Territory: MunicipalityCollection Date
107083/DENV3/FG/2001-11-04PP58262110 625French Guiana: Cayenne2001-11-04
225179/DENV3/FG/2013-01-24PP58262210 708French Guiana: Cayenne2013-01-24
331054/DENV3/FG/2013-02-05PP58262310 708French Guiana: Cayenne2013-02-05
404133/DENV3/MTQ/2019-10-11PP58262410 233Martinique: Le Vauclin2019-10-11
504086/DENV3/MTQ/2019-11-25PP58262510 227Martinique: Les Trois-Îlets2019-11-25
609088/DENV3/GLP/2019-12-20PP58262610 227Guadeloupe: Baie-Mahault2019-12-20
727341/DENV3/MTQ/2020-01-09PP58262710 708Martinique: Les Anses-d’Arlet2020-01-09
828089/DENV3/MTQ/2020-02-06PP58262810 236Martinique: Les Trois-Îlets2020-02-06
924087/DENV3/FG/2020-08-24PP58262910 603French Guiana: Rémire-Montjoly2020-08-24
1015178/DENV3/FG/2020-09-15PP58263010 227French Guiana: Matoury2020-09-15
1120156/DENV3/GLP/2020-10-01PP58263110 227Guadeloupe: Le Gosier2020-10-01
1220150/DENV3/GLP/2020-10-07PP58263210 708Guadeloupe: Le Gosier2020-10-07
1323065/DENV3/FG/2020-10-23PP58263310 236French Guiana: Rémire-Montjoly2020-10-23
1420163/DENV3/GLP/2020-10-28PP58263410 235Guadeloupe: Baie-Mahault2020-10-28
1520157/DENV3/GLP/2020-11-03PP58263510 708Guadeloupe: Les Abymes2020-11-03
1609124/DENV3/FG/2020-11-09PP58263610 227French Guiana: Tonate-Macouria2020-11-09
1707178/DENV3/FG/2021-01-07PP58263710 708French Guiana: Cayenne2021-01-07
1826144/DENV3/FG/2021-01-26PP58263810 708French Guiana: Cayenne2021-01-26
1906017/DENV3/FG/2022-11-23PP58263910 708French Guiana: Kourou2022-11-23
2018013/DENV3/FG/2023-01-09PP58264010 244French Guiana: Kourou2023-01-09
2110005/DENV3/FG/2023-03-10PP58264110 708French Guiana: Montsinery2023-03-10
2226005/DENV3/FG/2023-04-23PP58264210 708French Guiana: Kourou2023-04-23
2315024/DENV3/FG/2023-05-15PP58264310 475French Guiana: Kourou2023-05-15
2402031/DENV3/FG/2023-06-01PP58264410 227French Guiana: St Laurent du Maroni2023-06-01
2507015/DENV3/FG/2023-06-06PP58264510 227French Guiana: Kourou2023-06-06
2613012/DENV3/FG/2023-06-10PP58264610 227French Guiana: Kourou2023-06-10
2713168/DENV3/FG/2023-06-13PP58264710 227French Guiana: St Laurent du Maroni2023-06-13
2816010/DENV3/FG/2023-06-15PP58264810 227French Guiana: Iracoubo2023-06-15
2923030/DENV3/FG/2023-06-20PP58264910 227French Guiana: Maripasoula2023-06-20
3022011/DENV3/FG/2023-06-21PP58265010 227French Guiana: Kourou2023-06-21
3123026/DENV3/FG/2023-06-21PP58265110 227French Guiana: Maripasoula2023-06-21
3230024/DENV3/FG/2023-06-29PP58265210 708French Guiana: Mana2023-06-29
3303018/DENV3/FG/2023-07-03PP58265310 227French Guiana: Kourou2023-07-03
3407027/DENV3/FG/2023-07-06PP58265410 708French Guiana: St Laurent du Maroni2023-07-06
3507026/DENV3/FG/2023-07-07PP58265510 708French Guiana: Mana2023-07-07
3607039/DENV3/FG/2023-07-07PP58265610 227French Guiana: Kourou2023-07-07
3707041/DENV3/FG/2023-07-07PP58265710 708French Guiana: St Laurent du Maroni2023-07-07
3817045/DENV3/FG/2023-07-13PP58265810 708French Guiana: Maripasoula2023-07-13
3917053/DENV3/FG/2023-07-17PP58265910 708French Guiana: Cayenne2023-07-17
4019028/DENV3/FG/2023-07-19PP58266010 708French Guiana: Cayenne2023-07-19
4120025/DENV3/FG/2023-07-19PP58266110 708French Guiana: Mana2023-07-19
4220003/DENV3/FG/2023-07-20PP58266210 708French Guiana: Matoury2023-07-20
4320026/DENV3/FG/2023-07-20PP58266310 227French Guiana: Mana2023-07-20
4421022/DENV3/FG/2023-07-21PP58266410 708French Guiana: Kourou2023-07-21
4522008/DENV3/FG/2023-07-22PP58266510 708French Guiana: Kourou2023-07-22
4624008/DENV3/FG/2023-07-24PP58266610 708French Guiana: Cayenne2023-07-24
4725006/DENV3/FG/2023-07-25PP58266710 708French Guiana: Cayenne2023-07-25
4825030/DENV3/FG/2023-07-25PP58266810 708French Guiana: St Laurent du Maroni2023-07-25
4903024/DENV3/FG/2023-07-30PP58266910 708French Guiana: Maripasoula2023-07-30
5003027/DENV3/FG/2023-07-30PP58267010 708French Guiana: Antecum Pata2023-07-30
5101044/DENV3/FG/2023-08-01PP58267110 227French Guiana: Kourou2023-08-01
5204035/DENV3/FG/2023-08-03PP58267210 227French Guiana: St Laurent du Maroni2023-08-03
5307062/DENV3/FG/2023-08-07PP58267310 227French Guiana: St Laurent du Maroni2023-08-07
5409024/DENV3/FG/2023-08-09PP58267410 708French Guiana: Kourou2023-08-09
5511020/DENV3/FG/2023-08-09PP58267510 708French Guiana: Grand-Santi2023-08-09
5612016/DENV3/FG/2023-08-12PP58267610 708French Guiana: St Laurent du Maroni2023-08-12
5715024/DENV3/FG/2023-08-15PP58267710 708French Guiana: Sinnamary2023-08-15
5816005/DENV3/FG/2023-08-16PP58267810 708French Guiana: Saint-Georges2023-08-16
5918005/DENV3/FG/2023-08-17PP58267910 708French Guiana: Kourou2023-08-17
6022034/DENV3/FG/2023-08-21PP58268010 708French Guiana: Maripasoula2023-08-21
6129015/DENV3/FG/2023-08-28PP58268110 227French Guiana: Kourou2023-08-28
6229017/DENV3/FG/2023-08-28PP58268210 227French Guiana: Remire-Montjoly2023-08-28
6301004/DENV3/FG/2023-09-01PP58268310 708French Guiana: Matoury2023-09-01
6425128/DENV3/MTQ/2020-11-10PP58268410 457Martinique: Le Robert2020-11-10
6525141/DENV3/MTQ/2020-11-10PP58268510 227Martinique: Fort-de-France2020-11-10
6625144/DENV3/MTQ/2020-11-10PP58268610 227Martinique: Schoelcher2020-11-10
6705041/DENV3/FG/2023-07-05PP58268710 227French Guiana: Kourou2023-07-05
6815001/DENV3/FG/2023-10-14PP58268810 227French Guiana: Sinnamary2023-10-14
6916026/DENV3/FG/2023-10-10PP58268910 227French Guiana: Matoury2023-10-10
7017023/DENV3/FG/2023-10-14PP58269010 227French Guiana: Kourou2023-10-14
7118016/DENV3/FG/2023-10-16PP58269110 474French Guiana: Remire-Montjoly2023-10-16
7224035/DENV3/FG/2023-10-23PP58269210 472French Guiana: St Laurent du Maroni2023-10-23
7302029/DENV3/FG/2023-10-31PP58269310 227French Guiana: Apatou2023-10-31
7403031/DENV3/FG/2023-10-30PP58269410 470French Guiana: Papaïchton2023-10-30
7508043/DENV3/FG/2023-11-06PP58269510 474French Guiana: Grand-Santi2023-11-06
7610006/DENV3/FG/2023-07-24PP58269610 474French Guiana: Kourou2023-07-24
7713035/DENV3/FG/2023-11-12PP58269710 227French Guiana: Mana2023-11-12
7818004/DENV3/FG/2023-11-16PP58269810 686French Guiana: Cayenne2023-11-16
7921053/DENV3/FG/2023-11-21PP58269910 227French Guiana: St Laurent du Maroni2023-11-21
8022039/DENV3/FG/2023-11-20PP58270010 470French Guiana: Apatou2023-11-20
8123032/DENV3/FG/2023-11-21PP58270110 227French Guiana: Remire-Montjoly2023-11-21
8227076/DENV3/FG/2023-11-23PP58270210 227French Guiana: Matoury2023-11-23
8330002/DENV3/FG/2023-11-28PP58270310 227French Guiana: Maripasoula2023-11-28
8406045/DENV3/FG/2023-12-04PP58270410 227French Guiana: Remire-Montjoly2023-12-04
8507104/DENV3/FG/2023-12-07PP58270510 227French Guiana: Tonate-Macouria2023-12-07
8607115/DENV3/FG/2023-12-05PP58270610 461French Guiana: Grand-Santi2023-12-05
8707118/DENV3/FG/2023-12-06PP58270710 227French Guiana: Sinnamary2023-12-06
8812075/DENV3/FG/2023-12-12PP58270810 227French Guiana: Kourou2023-12-12
8918049/DENV3/FG/2023-12-16PP58270910 227French Guiana: St Laurent du Maroni2023-12-16
9022056/DENV3/FG/2023-12-21PP58271010 468French Guiana: Cayenne2023-12-21
9127038/DENV3/FG/2023-12-24PP58271110 227French Guiana: Matoury2023-12-24
9212036/DENV3/FG/2024-01-11PP58271210 227French Guiana: St Laurent du Maroni2024-01-11
9316073/DENV3/FG/2024-01-14PP58271310 227French Guiana: Kourou2024-01-14
9418030/DENV3/FG/2024-01-16PP58271410 227French Guiana: Sinnamary2024-01-16
9520026/DENV3/FG/2024-01-17PP58271510 227French Guiana: Tonate-Macouria2024-01-17
9624011/DENV3/FG/2024-01-24PP58271610 227French Guiana: Remire-Montjoly2024-01-24
9723163/DENV3/FG/2024-01-22PP58271710 471French Guiana: Matoury2024-01-22
Table A4. Total number of nucleotide mutations with number of signature mutations between clades 1 and 2 of the 2019–2021 epidemic in Martinique.
Table A4. Total number of nucleotide mutations with number of signature mutations between clades 1 and 2 of the 2019–2021 epidemic in Martinique.
Gene Coding for ProteinNucleotide Positions 2Length 2Total Number of Nucleotide MutationsNucleotide Signature MutationsSignature Mutation Rate (%)
AncC1–3423421072.05
prM343–84049817112.21
E841–2319147965382.57
NS12320–3375105636262.46
NS2A3376–402965435213.21
NS2B4030–441939019112.82
NS34420–6276185768402.15
NS4A6277–66573811251.31
2K6658–672669211.45
NS4B6727–747074428202.69
NS57471–10,140 12670125823.07
TOTAL 417262
1 cds ends at 10,170 but the analysis was done until the 10,140 position, at which all sequences were complete. 2 on cds (coding sequence).
Table A5. Number of amino acid substitutions detected between DENV-3 sequences obtained by NGS (n = 97) on the coding sequence (cds).
Table A5. Number of amino acid substitutions detected between DENV-3 sequences obtained by NGS (n = 97) on the coding sequence (cds).
Gene Coding for ProteinNucleotide Positions 2Length AANo. of AA SubstitutionsAA Substitution Rate (%)Specific AA Substitutions ProfileSpecific AA Substitution Profile Rate (%)
AncC1–34211465.2610.88
prM343–84016642.4110.60
E841–2319493224.4651.01
NS12320–3375352133.6951.42
NS2A3376–4029218198.7294.13
NS2B4030–441913086.1543.08
NS34420–6276619254.0460.97
NS4A6277–665712753.9400.00
2K6658–67262328.7014.35
NS4B6727–747024862.4220.81
NS57471–10,140 1890495.51171.94
TOTAL159 51
1 cds ends at 10,170 but the analysis was done until the 10,140 position, at which all sequences were complete. 2 on cds (coding sequence).

References

  1. Epidemiological Update Dengue in the Region of the Americas 28 March 2023—PAHO/WHO|Pan American Health Organization. Available online: https://www.paho.org/en/documents/epidemiological-update-dengue-region-americas-28-march-2023 (accessed on 17 April 2024).
  2. Dengue and Severe Dengue. Available online: https://www.who.int/news-room/fact-sheets/detail/dengue-and-severe-dengue (accessed on 15 January 2024).
  3. Epidemiological Update—Increase in Dengue Cases in the Region of the Americas—29 March 2024—PAHO/WHO|Pan American Health Organization. Available online: https://www.paho.org/en/documents/epidemiological-update-increase-dengue-cases-region-americas-29-march-2024 (accessed on 30 April 2024).
  4. Dussart, P.; Lavergne, A.; Lagathu, G.; Lacoste, V.; Martial, J.; Morvan, J.; Cesaire, R. Reemergence of Dengue Virus Type 4, French Antilles and French Guiana, 2004–2005. Emerg. Infect. Dis. 2006, 12, 1748–1751. [Google Scholar] [CrossRef] [PubMed]
  5. L’Azou, M.; Taurel, A.-F.; Flamand, C.; Quénel, P. Recent Epidemiological Trends of Dengue in the French Territories of the Americas (2000–2012): A Systematic Literature Review. PLoS Negl. Trop. Dis. 2014, 8, e3235. [Google Scholar] [CrossRef] [PubMed]
  6. Messina, J.P.; Brady, O.J.; Scott, T.W.; Zou, C.; Pigott, D.M.; Duda, K.A.; Bhatt, S.; Katzelnick, L.; Howes, R.E.; Battle, K.E.; et al. Global Spread of Dengue Virus Types: Mapping the 70 Year History. Trends Microbiol. 2014, 22, 138–146. [Google Scholar] [CrossRef] [PubMed]
  7. Márquez, S.; Lee, G.; Gutiérrez, B.; Bennett, S.; Coloma, J.; Eisenberg, J.N.S.; Trueba, G. Phylogenetic Analysis of Transmission Dynamics of Dengue in Large and Small Population Centers, Northern Ecuador. Emerg. Infect. Dis. 2023, 29, 888–897. [Google Scholar] [CrossRef] [PubMed]
  8. SPF Dengue en Guyane. Point au 28 Mars 2024. Available online: https://www.santepubliquefrance.fr/regions/guyane/documents/bulletin-regional/2024/dengue-en-guyane.-point-au-28-mars-2024 (accessed on 17 April 2024).
  9. Lanciotti, R.S.; Lewis, J.G.; Gubler, D.J.; Trent, D.W. Molecular Evolution and Epidemiology of Dengue-3 Viruses. J. Gen. Virol. 1994, 75, 65–75. [Google Scholar] [CrossRef] [PubMed]
  10. Waman, V.P.; Kale, M.M.; Kulkarni-Kale, U. Genetic Diversity and Evolution of Dengue Virus Serotype 3: A Comparative Genomics Study. Infect. Genet. Evol. 2017, 49, 234–240. [Google Scholar] [CrossRef] [PubMed]
  11. Quick, J.; Grubaugh, N.D.; Pullan, S.T.; Claro, I.M.; Smith, A.D.; Gangavarapu, K.; Oliveira, G.; Robles-Sikisaka, R.; Rogers, T.F.; Beutler, N.A.; et al. Multiplex PCR Method for MinION and Illumina Sequencing of Zika and Other Virus Genomes Directly from Clinical Samples. Nat. Protoc. 2017, 12, 1261–1276. [Google Scholar] [CrossRef] [PubMed]
  12. Santiago, G.A.; Vergne, E.; Quiles, Y.; Cosme, J.; Vazquez, J.; Medina, J.F.; Medina, F.; Colón, C.; Margolis, H.; Muñoz-Jordán, J.L. Analytical and Clinical Performance of the CDC Real Time RT-PCR Assay for Detection and Typing of Dengue Virus. PLoS Negl. Trop. Dis. 2013, 7, e2311. [Google Scholar] [CrossRef]
  13. Jones, F.K.; Morrison, A.M.; Santiago, G.A.; Rysava, K.; Zimler, R.A.; Heberlein, L.A.; Kopp, E.; Saunders, K.E.; Baudin, S.; Rico, E.; et al. Introduction and Spread of Dengue Virus 3, Florida, USA, May 2022–April 2023. Emerg. Infect. Dis. J. CDC 2024, 30, 376–379. [Google Scholar] [CrossRef]
  14. Rowe, D.; McDermott, C.; Veliz, Y.; Kerr, A.; Whiteside, M.; Coss, M.; Huff, C.; Leal, A.; Kopp, E.; LaCrue, A.; et al. Dengue Outbreak Response during COVID-19 Pandemic, Key Largo, Florida, USA, 2020. Emerg. Infect. Dis. J. CDC 2023, 29, 1643–1647. [Google Scholar] [CrossRef]
  15. Naveca, F.G.; Santiago, G.A.; Maito, R.M.; Ribeiro Meneses, C.A.; do Nascimento, V.A.; de Souza, V.C.; do Nascimento, F.O.; Silva, D.; Mejía, M.; Gonçalves, L.; et al. Reemergence of Dengue Virus Serotype 3, Brazil, 2023. Emerg. Infect. Dis. 2023, 29, 1482–1484. [Google Scholar] [CrossRef] [PubMed]
  16. Barido-Sottani, J.; Schwery, O.; Warnock, R.C.M.; Zhang, C.; Wright, A.M. Practical Guidelines for Bayesian Phylogenetic Inference Using Markov Chain Monte Carlo (MCMC). Open Res. Eur. 2023, 3, 204. [Google Scholar] [CrossRef] [PubMed]
  17. Suchard, M.A.; Lemey, P.; Baele, G.; Ayres, D.L.; Drummond, A.J.; Rambaut, A. Bayesian Phylogenetic and Phylodynamic Data Integration Using BEAST 1.10. Virus Evol. 2018, 4, vey016. [Google Scholar] [CrossRef]
  18. Baele, G.; Lemey, P.; Bedford, T.; Rambaut, A.; Suchard, M.A.; Alekseyenko, A.V. Improving the Accuracy of Demographic and Molecular Clock Model Comparison While Accommodating Phylogenetic Uncertainty. Mol. Biol. Evol. 2012, 29, 2157–2167. [Google Scholar] [CrossRef] [PubMed]
  19. Rambaut, A.; Drummond, A.J.; Xie, D.; Baele, G.; Suchard, M.A. Posterior Summarization in Bayesian Phylogenetics Using Tracer 1.7. Syst. Biol. 2018, 67, 901–904. [Google Scholar] [CrossRef] [PubMed]
  20. Araújo, J.M.G.; Nogueira, R.M.R.; Schatzmayr, H.G.; Zanotto, P.M.d.A.; Bello, G. Phylogeography and Evolutionary History of Dengue Virus Type 3. Infect. Genet. Evol. 2009, 9, 716–725. [Google Scholar] [CrossRef] [PubMed]
  21. Messer, W.B.; Gubler, D.J.; Harris, E.; Sivananthan, K.; de Silva, A.M. Emergence and Global Spread of a Dengue Serotype 3, Subtype III Virus. Emerg. Infect. Dis. 2003, 9, 800–809. [Google Scholar] [CrossRef] [PubMed]
  22. Liang, H.; Luo, L.; Yang, Z.; Di, B.; Bai, Z.; He, P.; Jing, Q.; Zheng, X. Re-Emergence of Dengue Virus Type 3 in Canton, China, 2009–2010, Associated with Multiple Introductions through Different Geographical Routes. PLoS ONE 2013, 8, e55353. [Google Scholar] [CrossRef] [PubMed]
  23. Tan, K.-K.; Zulkifle, N.-I.; Sulaiman, S.; Pang, S.-P.; NorAmdan, N.; MatRahim, N.; Abd-Jamil, J.; Shu, M.-H.; Mahadi, N.M.; AbuBakar, S. Emergence of the Asian Lineage Dengue Virus Type 3 Genotype III in Malaysia. BMC Evol. Biol. 2018, 18, 58. [Google Scholar] [CrossRef]
  24. Titir, S.R.; Paul, S.K.; Ahmed, S.; Haque, N.; Nasreen, S.A.; Hossain, K.S.; Ahmad, F.U.; Nila, S.S.; Khanam, J.; Nowsher, N.; et al. Nationwide Distribution of Dengue Virus Type 3 (DENV-3) Genotype I and Emergence of DENV-3 Genotype III during the 2019 Outbreak in Bangladesh. Trop. Med. Infect. Dis. 2021, 6, 58. [Google Scholar] [CrossRef]
  25. Eldigail, M.H.; Abubaker, H.A.; Khalid, F.A.; Abdallah, T.M.; Musa, H.H.; Ahmed, M.E.; Adam, G.K.; Elbashir, M.I.; Aradaib, I.E. Association of Genotype III of Dengue Virus Serotype 3 with Disease Outbreak in Eastern Sudan, 2019. Virol. J. 2020, 17, 118. [Google Scholar] [CrossRef] [PubMed]
  26. Monteil, V.; Maquart, M.; Caro, V.; Jaffar-Bandjee, M.-C.; Dosso, M.; Akoua-Koffi, C.; Grandadam, M.; Leparc-Goffart, I. Circulation of Dengue Virus Type 3 Genotype III in Africa Since 2008. J. Hum. Virol. Retrovirol. 2016, 4, 00128. [Google Scholar] [CrossRef][Green Version]
  27. Usme-Ciro, J.A.; Mendez, J.A.; Tenorio, A.; Rey, G.J.; Domingo, C.; Gallego-Gomez, J.C. Simultaneous Circulation of Genotypes I and III of Dengue Virus 3 in Colombia. Virol. J. 2008, 5, 101. [Google Scholar] [CrossRef] [PubMed]
  28. Peyrefitte, C.N.; Couissinier-Paris, P.; Mercier-Perennec, V.; Bessaud, M.; Martial, J.; Kenane, N.; Durand, J.-P.A.; Tolou, H.J. Genetic Characterization of Newly Reintroduced Dengue Virus Type 3 in Martinique (French West Indies). J. Clin. Microbiol. 2003, 41, 5195–5198. [Google Scholar] [CrossRef]
  29. Peyrefitte, C.N.; Pastorino, B.A.M.; Bessaud, M.; Gravier, P.; Tock, F.; Couissinier-Paris, P.; Martial, J.; Huc-Anais, P.; Césaire, R.; Grandadam, M.; et al. Dengue Type 3 Virus, Saint Martin, 2003–2004. Emerg. Infect. Dis. 2005, 11, 757–761. [Google Scholar] [CrossRef] [PubMed]
  30. Garcia Van Smévoorde, M.; Piorkowski, G.; Emboulé, L.; Dos Santos, G.; Loraux, C.; Guyomard-Rabenirina, S.; Joannes, M.-O.; Fagour, L.; Najioullah, F.; Cabié, A.; et al. Phylogenetic Investigations of Dengue 2019–2021 Outbreak in Guadeloupe and Martinique Caribbean Islands. Pathogens 2023, 12, 1182. [Google Scholar] [CrossRef]
  31. Point Epidémiologique Antilles 28 Mai 2021Dengue ARS N°05/2021 Surveillance de la dengue Guadeloupe, Martinique, Saint-Martin, Saint-Barthélemy. Available online: https://www.bing.com/search?q=Point+épidémiologique+Antilles+28+Mai+2021Dengue+ARS+N°05%2F2021+Surveillance+de+la+dengue+Guadeloupe%2C+Martinique%2C+Saint-Martin%2C+Saint-Barthélemy&qs=n&form=QBRE&sp=-1&lq=1&pq=point+épidémiologique+antilles+28+mai+2021dengue+ars+n°05%2F2021+surveillance+de+la+dengue+guadeloupe%2C+martinique%2C+saint-martin%2C+saint-barthélemy&sc=0-143&sk=&cvid=B5B94C850DFA4A0397807879E9D30C9B&ghsh=0&ghacc=0&ghpl= (accessed on 24 June 2024).
  32. Duan, Y.; Zeng, M.; Jiang, B.; Zhang, W.; Wang, M.; Jia, R.; Zhu, D.; Liu, M.; Zhao, X.; Yang, Q.; et al. Flavivirus RNA-Dependent RNA Polymerase Interacts with Genome UTRs and Viral Proteins to Facilitate Flavivirus RNA Replication. Viruses 2019, 11, 929. [Google Scholar] [CrossRef] [PubMed]
  33. Klitting, R.; Piorkowski, G.; Rousset, D.; Cabié, A.; Frumence, E.; Lagrave, A.; Lavergne, A.; Enfissi, A.; Santos, G.D.; Fagour, L.; et al. Molecular Epidemiology Identifies the Expansion of the DENV2 Epidemic Lineage from the French Caribbean Islands to French Guiana and Mainland France, 2023 to 2024. Eurosurveillance 2024, 29, 2400123. [Google Scholar] [CrossRef]
  34. Bonifay, T.; Le Turnier, P.; Epelboin, Y.; Carvalho, L.; De Thoisy, B.; Djossou, F.; Duchemin, J.-B.; Dussart, P.; Enfissi, A.; Lavergne, A.; et al. Review on Main Arboviruses Circulating on French Guiana, An Ultra-Peripheric European Region in South America. Viruses 2023, 15, 1268. [Google Scholar] [CrossRef]
  35. Santos, L.L.M.; de Aquino, E.C.; Fernandes, S.M.; Ternes, Y.M.F.; Feres, V.C.D.R. Dengue, Chikungunya, and Zika Virus Infections in Latin America and the Caribbean: A Systematic Review. Rev. Panam. Salud Publica. 2023, 47, e34. [Google Scholar] [CrossRef]
  36. Bailly, S.; Rousset, D.; Fritzell, C.; Hozé, N.; Ben Achour, S.; Berthelot, L.; Enfissi, A.; Vanhomwegen, J.; Salje, H.; Fernandes-Pellerin, S.; et al. Spatial Distribution and Burden of Emerging Arboviruses in French Guiana. Viruses 2021, 13, 1299. [Google Scholar] [CrossRef] [PubMed]
  37. Marcondes, C.B.; Contigiani, M.; Gleiser, R.M. Emergent and Reemergent Arboviruses in South America and the Caribbean: Why So Many and Why Now? J. Med. Entomol. 2017, 54, 509–532. [Google Scholar] [CrossRef] [PubMed]
  38. Epelboin, L.; Abboud, P.; Abdelmoumen, K.; About, F.; Adenis, A.; Blaise, T.; Blaizot, R.; Bonifay, T.; Bourne-Watrin, M.; Boutrou, M.; et al. [Overview of infectious and non-infectious diseases in French Guiana in 2022]. Med. Trop. Sante Int. 2023, 3, mtsi.v3i1.2023.308. [Google Scholar] [CrossRef]
  39. Mavian, C.; Dulcey, M.; Munoz, O.; Salemi, M.; Vittor, A.Y.; Capua, I. Islands as Hotspots for Emerging Mosquito-Borne Viruses: A One-Health Perspective. Viruses 2019, 11, 11. [Google Scholar] [CrossRef] [PubMed]
  40. Pollett, S.; Melendrez, M.C.; Maljkovic Berry, I.; Duchêne, S.; Salje, H.; Cummings, D.A.T.; Jarman, R.G. Understanding Dengue Virus Evolution to Support Epidemic Surveillance and Counter-Measure Development. Infect. Genet. Evol. 2018, 62, 279–295. [Google Scholar] [CrossRef] [PubMed]
  41. Torres, J.R.; Orduna, T.A.; Piña-Pozas, M.; Vázquez-Vega, D.; Sarti, E. Epidemiological Characteristics of Dengue Disease in Latin America and in the Caribbean: A Systematic Review of the Literature. J. Trop. Med. 2017, 2017, e8045435. [Google Scholar] [CrossRef] [PubMed]
  42. Wearing, H.J.; Robert, M.A.; Christofferson, R.C. Dengue and Chikungunya: Modelling the Expansion of Mosquito-Borne Viruses into Naïve Populations. Parasitology 2016, 143, 860–873. [Google Scholar] [CrossRef] [PubMed]
  43. Rezza, G. Dengue and Chikungunya: Long-Distance Spread and Outbreaks in Naïve Areas. Pathog. Glob. Health 2014, 108, 349–355. [Google Scholar] [CrossRef] [PubMed]
  44. Grange, L.; Simon-Loriere, E.; Sakuntabhai, A.; Gresh, L.; Paul, R.; Harris, E. Epidemiological Risk Factors Associated with High Global Frequency of Inapparent Dengue Virus Infections. Front. Immunol. 2014, 5, 280. [Google Scholar] [CrossRef]
  45. Adelino, T.; Lima, M.; Guimarães, N.R.; Xavier, J.; Fonseca, V.; Tomé, L.M.R.; Pereira, M.A.; Machado, V.F.; Alcantara, L.C.J.; Iani, F.C.D.M.; et al. Resurgence of Dengue Virus Serotype 3 in Minas Gerais, Brazil: A Case Report. Pathogens 2024, 13, 202. [Google Scholar] [CrossRef]
  46. Dias, M.; Pattabiraman, C.; Siddappa, S.; Gowda, M.; Shet, A.; Smith, D.; Muehlemann, B.; Tamma, K.; Solomon, T.; Jones, T.; et al. Complete Assembly of a Dengue Virus Type 3 Genome from a Recent Genotype III Clade by Metagenomic Sequencing of Serum. Wellcome Open Res. 2019, 3, 44. [Google Scholar] [CrossRef] [PubMed]
  47. Vega-Rúa, A.; Zouache, K.; Girod, R.; Failloux, A.-B.; Lourenço-de-Oliveira, R. High Level of Vector Competence of Aedes Aegypti and Aedes Albopictus from Ten American Countries as a Crucial Factor in the Spread of Chikungunya Virus. J. Virol. 2014, 88, 6294–6306. [Google Scholar] [CrossRef] [PubMed]
  48. Allicock, O.M.; Lemey, P.; Tatem, A.J.; Pybus, O.G.; Bennett, S.N.; Mueller, B.A.; Suchard, M.A.; Foster, J.E.; Rambaut, A.; Carrington, C.V.F. Phylogeography and Population Dynamics of Dengue Viruses in the Americas. Mol. Biol. Evol. 2012, 29, 1533–1543. [Google Scholar] [CrossRef]
  49. Flamand, C.; Quenel, P.; Ardillon, V.; Carvalho, L.; Bringay, S.; Teisseire, M. The Epidemiologic Surveillance of Dengue-Fever in French Guiana: When Achievements Trigger Higher Goals. In User Centred Networked Health Care; IOS Press: Amsterdam, The Netherlands, 2011; pp. 629–633. [Google Scholar]
  50. Guzman, M.G.; Gubler, D.J.; Izquierdo, A.; Martinez, E.; Halstead, S.B. Dengue Infection. Nat. Rev. Dis. Primers 2016, 2, 16055. [Google Scholar] [CrossRef]
  51. Bos, S.; Graber, A.L.; Cardona-Ospina, J.A.; Duarte, E.M.; Zambrana, J.V.; Ruíz Salinas, J.A.; Mercado-Hernandez, R.; Singh, T.; Katzelnick, L.C.; de Silva, A.; et al. Protection against Symptomatic Dengue Infection by Neutralizing Antibodies Varies by Infection History and Infecting Serotype. Nat. Commun. 2024, 15, 382. [Google Scholar] [CrossRef] [PubMed]
  52. Pintado Silva, J.; Fernandez-Sesma, A. Challenges on the Development of a Dengue Vaccine: A Comprehensive Review of the State of the Art. J. Gen. Virol. 2023, 104, 001831. [Google Scholar] [CrossRef]
  53. Palanichamy Kala, M.; St John, A.L.; Rathore, A.P.S. Dengue: Update on Clinically Relevant Therapeutic Strategies and Vaccines. Curr. Treat Options. Infect. Dis. 2023, 15, 27–52. [Google Scholar] [CrossRef]
  54. Malik, S.; Ahsan, O.; Mumtaz, H.; Tahir Khan, M.; Sah, R.; Waheed, Y. Tracing down the Updates on Dengue Virus—Molecular Biology, Antivirals, and Vaccine Strategies. Vaccines 2023, 11, 1328. [Google Scholar] [CrossRef] [PubMed]
  55. Khan, M.B.; Yang, Z.-S.; Lin, C.-Y.; Hsu, M.-C.; Urbina, A.N.; Assavalapsakul, W.; Wang, W.-H.; Chen, Y.-H.; Wang, S.-F. Dengue Overview: An Updated Systemic Review. J. Infect. Public Health 2023, 16, 1625–1642. [Google Scholar] [CrossRef]
  56. Hussain, Z.; Rani, S.; Ma, F.; Li, W.; Shen, W.; Gao, T.; Wang, J.; Pei, R. Dengue Determinants: Necessities and Challenges for Universal Dengue Vaccine Development. Rev. Med. Virol. 2023, 33, e2425. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Article Metrics

Citations

Article Access Statistics

Journal Statistics
Multiple requests from the same IP address are counted as one view.
Mayaro Virus: An Emerging Alphavirus in the Americas
Previous
Practical Suggestions for Assessing Rabbit Haemorrhagic Disease Virus 2 Risk to Endangered Native Lagomorphs in North America and Southern Africa
Next