An Interspecies Molecular and Functional Study of Organic Cation Transporters at the Blood-Brain Barrier: From Rodents to Humans
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Animals
2.3. Isolation of Rat, Mouse and Human Microvessels
2.3.1. Isolation of Rodent Brain Microvessels:
2.3.2. Isolation of Human Brain Microvessels:
2.4. Human BMVECs and BBB Permeability Validation
2.4.1. Primary Human Brain Microvascular Endothelial Cell Culture (BMVECs):
2.4.2. Phenylalanine and MPP+ Permeability Assays:
2.5. Extraction and Dosage of Total RNA from Rat and Mice Brain Microvessels
2.6. Reverse Transcription (RT) and Quantitative Real-Time PCR (qRT-PCR)
2.6.1. cDNA Synthesis:
2.6.2. RT-PCR Theoretical Principles:
2.6.3. PCR Amplification:
2.7. Protein Extraction
2.8. Protein Digestion
2.9. Multiple Reaction Monitoring Quantification
2.10. Mice and Rat BBB Transport Studies by In situ Brain Perfusion
Apparent Initial Tissue Distribution Volume and Transport Parameters
2.11. Statistical Analysis
3. Results
3.1. Expression of Oct1-3, Mate-1 and Mdr1a Transporter Genes in Brain Microvessels of Swiss, FVB and C57BL/6 Mice
3.2. Expression of Oct1-3 Transporter Genes in Rat Brain Microvessels
3.3. MRM Quantification of OCT1, OCT2 and MATE1 at the Human BBB: Freshly Isolated Brain Microvessels and BMVECs
3.4. Phenylalanine and MPP+ Transport Studies in Primary Cultured Human BMVECs
3.5. [3H]-1-Methyl-4-Phenylpyridinium Transport at the Luminal BBB in Mice and Rats
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Chaves, C.; Remiao, F.; Cisternino, S.; Decleves, X. Opioids and the blood-brain barrier: A dynamic interaction with consequences on drug disposition in brain. Curr. Neuropharmacol. 2017, 15, 1156–1173. [Google Scholar] [CrossRef]
- Pardridge, W.M.; Oldendorf, W.H. Kinetics of blood-brain transport of hexoses. Biochim. Biophys. Acta 1975, 382, 377–392. [Google Scholar] [CrossRef]
- Pardridge, W.M.; Boado, R.J.; Farrell, C.R. Brain-type glucose transporter (GLUT-1) is selectively localized to the blood-brain barrier. Studies with quantitative western blotting and in situ hybridization. J. Biol. Chem. 1990, 265, 18035–18040. [Google Scholar]
- Pardridge, W.M.; Oldendorf, W.H. Kinetic analysis of blood-brain barrier transport of amino acids. Biochim. Biophys. Acta 1975, 401, 128–136. [Google Scholar] [CrossRef]
- Boado, R.J.; Li, J.Y.; Nagaya, M.; Zhang, C.; Pardridge, W.M. Selective expression of the large neutral amino acid transporter at the blood-brain barrier. Proc. Natl. Acad. Sci. USA 1999, 96, 12079–12084. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stoll, J.; Wadhwani, K.C.; Smith, Q.R. Identification of the cationic amino acid transporter (System y+) of the rat blood-brain barrier. J. Neurochem. 1993, 60, 1956–1959. [Google Scholar] [CrossRef] [PubMed]
- Lozano, E.; Herraez, E.; Briz, O.; Robledo, V.S.; Hernandez-Iglesias, J.; Gonzalez-Hernandez, A.; Marin, J.J. Role of the plasma membrane transporter of organic cations OCT1 and its genetic variants in modern liver pharmacology. Biomed. Res. Int. 2013, 2013, 692071. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Andre, P.; Saubamea, B.; Cochois-Guegan, V.; Marie-Claire, C.; Cattelotte, J.; Smirnova, M.; Schinkel, A.H.; Scherrmann, J.M.; Cisternino, S. Transport of biogenic amine neurotransmitters at the mouse blood-retina and blood-brain barriers by uptake1 and uptake2. J. Cereb. Blood Flow Metab. 2012, 32, 1989–2001. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, K.C.; Lu, Y.H.; Peng, Y.H.; Tsai, T.F.; Kao, Y.H.; Yang, H.T.; Lin, C.J. Decreased expression of organic cation transporters, Oct1 and Oct2, in brain microvessels and its implication to MPTP-induced dopaminergic toxicity in aged mice. J. Cereb. Blood Flow Metab. 2015, 35, 37–47. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Uchida, Y.; Ohtsuki, S.; Katsukura, Y.; Ikeda, C.; Suzuki, T.; Kamiie, J.; Terasaki, T. Quantitative targeted absolute proteomics of human blood-brain barrier transporters and receptors. J. Neurochem. 2011, 117, 333–345. [Google Scholar] [CrossRef]
- Shawahna, R.; Uchida, Y.; Decleves, X.; Ohtsuki, S.; Yousif, S.; Dauchy, S.; Jacob, A.; Chassoux, F.; Daumas-Duport, C.; Couraud, P.O.; et al. Transcriptomic and quantitative proteomic analysis of transporters and drug metabolizing enzymes in freshly isolated human brain microvessels. Mol. Pharm. 2011, 8, 1332–1341. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.J.; Tai, Y.; Huang, M.T.; Tsai, Y.F.; Hsu, H.J.; Tzen, K.Y.; Liou, H.H. Cellular localization of the organic cation transporters, OCT1 and OCT2, in brain microvessel endothelial cells and its implication for MPTP transport across the blood-brain barrier and MPTP-induced dopaminergic toxicity in rodents. J. Neurochem. 2010, 114, 717–727. [Google Scholar] [CrossRef] [PubMed]
- Yousif, S.; Saubamea, B.; Cisternino, S.; Marie-Claire, C.; Dauchy, S.; Scherrmann, J.M.; Decleves, X. Effect of chronic exposure to morphine on the rat blood-brain barrier: Focus on the P-glycoprotein. J. Neurochem. 2008, 107, 647–657. [Google Scholar] [CrossRef]
- Perriere, N.; Demeuse, P.; Garcia, E.; Regina, A.; Debray, M.; Andreux, J.P.; Couvreur, P.; Scherrmann, J.M.; Temsamani, J.; Couraud, P.O.; et al. Puromycin-based purification of rat brain capillary endothelial cell cultures. Effect on the expression of blood-brain barrier-specific properties. J. Neurochem. 2005, 93, 279–289. [Google Scholar] [CrossRef]
- Chaves, C.; Gomez-Zepeda, D.; Auvity, S.; Menet, M.C.; Crété, D.; Labat, L.; Remiao, F.; Cisternino, S.; Decleves, X. Effect of subchronic intravenous morphine infusion and naloxone-precipitated morphine withdrawal on P-gp and Bcrp at the rat blood-brain barrier. J. Pharm. Sci. 2016, 105, 350–358. [Google Scholar] [CrossRef] [PubMed]
- Gerber, S.A.; Rush, J.; Stemman, O.; Kirschner, M.W.; Gygi, S.P. Absolute quantification of proteins and phosphoproteins from cell lysates by tandem MS. Proc. Natl. Acad. Sci. USA 2003, 100, 6940–6945. [Google Scholar] [CrossRef] [Green Version]
- Kamiie, J.; Ohtsuki, S.; Iwase, R.; Ohmine, K.; Katsukura, Y.; Yanai, K.; Sekine, Y.; Uchida, Y.; Ito, S.; Terasaki, T. Quantitative atlas of membrane transporter proteins: Development and application of a highly sensitive simultaneous LC/MS/MS method combined with novel in-silico peptide selection criteria. Pharm. Res. 2008, 25, 1469–1483. [Google Scholar] [CrossRef]
- Mani, D.R.; Abbatiello, S.E.; Carr, S.A. Statistical characterization of multiple-reaction monitoring mass spectrometry (MRM-MS) assays for quantitative proteomics. BMC Bioinf. 2012, 13, S9. [Google Scholar] [CrossRef] [Green Version]
- Pelkonen, L.; Sato, K.; Reinisalo, M.; Kidron, H.; Tachikawa, M.; Watanabe, M.; Uchida, Y.; Urtti, A.; Terasaki, T. LC-MS/MS Based Quantitation of ABC and SLC Transporter Proteins in Plasma Membranes of Cultured Primary Human Retinal Pigment Epithelium Cells and Immortalized ARPE19 Cell Line. Mol. Pharm. 2017, 14, 605–613. [Google Scholar] [CrossRef]
- Maclean, B.; Tomazela, D.M.; Abbatiello, S.E.; Zhang, S.; Whiteaker, J.R.; Paulovich, A.G.; Carr, S.A.; Maccoss, M.J. Effect of collision energy optimization on the measurement of peptides by selected reaction monitoring (SRM) mass spectrometry. Anal. Chem. 2010, 82, 10116–10124. [Google Scholar] [CrossRef] [Green Version]
- MacLean, B.; Tomazela, D.M.; Shulman, N.; Chambers, M.; Finney, G.L.; Frewen, B.; Kern, R.; Tabb, D.L.; Liebler, D.C.; MacCoss, M.J. Skyline: An open source document editor for creating and analyzing targeted proteomics experiments. Bioinformatics 2010, 26, 966–968. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cattelotte, J.; Andre, P.; Ouellet, M.; Bourasset, F.; Scherrmann, J.M.; Cisternino, S. In situ mouse carotid perfusion model: Glucose and cholesterol transport in the eye and brain. J. Cereb. Blood Flow Metab. 2008, 28, 1449–1459. [Google Scholar] [CrossRef] [PubMed]
- Cisternino, S.; Rousselle, C.; Debray, M.; Scherrmann, J.M. In vivo saturation of the transport of vinblastine and colchicine by P-glycoprotein at the rat blood-brain barrier. Pharm. Res. 2003, 20, 1607–1611. [Google Scholar] [CrossRef] [PubMed]
- Takasato, Y.; Rapoport, S.I.; Smith, Q.R. An in situ brain perfusion technique to study cerebrovascular transport in the rat. Am. J. Physiol. 1984, 247, H484–H493. [Google Scholar] [CrossRef]
- Dagenais, C.; Rousselle, C.; Pollack, G.M.; Scherrmann, J.M. Development of an in situ mouse brain perfusion model and its application to mdr1a P-glycoprotein-deficient mice. J. Cereb. Blood Flow Metab. 2000, 20, 381–386. [Google Scholar] [CrossRef] [Green Version]
- Jonker, J.W.; Schinkel, A.H. Pharmacological and physiological functions of the polyspecific organic cation transporters: OCT1, 2, and 3 (SLC22A1-3). J. Pharmacol. Exp. Ther. 2004, 308, 2–9. [Google Scholar] [CrossRef] [Green Version]
- Grundemann, D.; Schechinger, B.; Rappold, G.A.; Schomig, E. Molecular identification of the corticosterone-sensitive extraneuronal catecholamine transporter. Nat. Neurosci. 1998, 1, 349–351. [Google Scholar] [CrossRef]
- Inazu, M.; Takeda, H.; Matsumiya, T. Expression and functional characterization of the extraneuronal monoamine transporter in normal human astrocytes. J. Neurochem. 2003, 84, 43–52. [Google Scholar] [CrossRef]
- Wu, X.; Kekuda, R.; Huang, W.; Fei, Y.J.; Leibach, F.H.; Chen, J.; Conway, S.J.; Ganapathy, V. Identity of the organic cation transporter OCT3 as the extraneuronal monoamine transporter (uptake2) and evidence for the expression of the transporter in the brain. J. Biol. Chem. 1998, 273, 32776–32786. [Google Scholar] [CrossRef] [Green Version]
- Friedrich, A.; George, R.L.; Bridges, C.C.; Prasad, P.D.; Ganapathy, V. Transport of choline and its relationship to the expression of the organic cation transporters in a rat brain microvessel endothelial cell line (RBE4). Biochim. Biophys. Acta 2001, 1512, 299–307. [Google Scholar] [CrossRef] [Green Version]
- Okura, T.; Kato, S.; Takano, Y.; Sato, T.; Yamashita, A.; Morimoto, R.; Ohtsuki, S.; Terasaki, T.; Deguchi, Y. Functional characterization of rat plasma membrane monoamine transporter in the blood-brain and blood-cerebrospinal fluid barriers. J. Pharm. Sci. 2011, 100, 3924–3938. [Google Scholar] [CrossRef] [PubMed]
- Liou, H.H.; Hsu, H.J.; Tsai, Y.F.; Shih, C.Y.; Chang, Y.C.; Lin, C.J. Interaction between nicotine and MPTP/MPP+ in rat brain endothelial cells. Life Sci. 2007, 81, 664–672. [Google Scholar] [CrossRef] [PubMed]
- Dickens, D.; Owen, A.; Alfirevic, A.; Giannoudis, A.; Davies, A.; Weksler, B.; Romero, I.A.; Couraud, P.O.; Pirmohamed, M. Lamotrigine is a substrate for OCT1 in brain endothelial cells. Biochem. Pharmacol. 2012, 83, 805–814. [Google Scholar] [CrossRef] [PubMed]
- Dos Santos Pereira, J.N.; Tadjerpisheh, S.; Abu Abed, M.; Saadatmand, A.R.; Weksler, B.; Romero, I.A.; Couraud, P.O.; Brockmoller, J.; Tzvetkov, M.V. The poorly membrane permeable antipsychotic drugs amisulpride and sulpiride are substrates of the organic cation transporters from the SLC22 family. AAPS J. 2014, 16, 1247–1258. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lyck, R.; Ruderisch, N.; Moll, A.G.; Steiner, O.; Cohen, C.D.; Engelhardt, B.; Makrides, V.; Verrey, F. Culture-induced changes in blood-brain barrier transcriptome: Implications for amino-acid transporters in vivo. J. Cereb. Blood Flow Metab. 2009, 29, 1491–1502. [Google Scholar] [CrossRef] [Green Version]
- Geier, E.G.; Chen, E.C.; Webb, A.; Papp, A.C.; Yee, S.W.; Sadee, W.; Giacomini, K.M. Profiling solute carrier transporters in the human blood-brain barrier. Clin. Pharmacol. Ther. 2013, 94, 636–639. [Google Scholar] [CrossRef]
- Yousif, S.; Marie-Claire, C.; Roux, F.; Scherrmann, J.M.; Decleves, X. Expression of drug transporters at the blood-brain barrier using an optimized isolated rat brain microvessel strategy. Brain Res. 2007, 1134, 1–11. [Google Scholar] [CrossRef]
- Vanlandewijck, M.; He, L.; Mäe, M.A.; Andrae, J.; Ando, K.; Del Gaudio, F.; Nahar, K.; Lebouvier, T.; Laviña, B.; Gouveia, L.; et al. Molecular Atlas of Cell Types and Zonation in the Brain Vasculature. Nature 2018, 554, 475–480. [Google Scholar] [CrossRef] [Green Version]
- Jonker, J.W.; Wagenaar, E.; Mol, C.A.; Buitelaar, M.; Koepsell, H.; Smit, J.W.; Schinkel, A.H. Reduced hepatic uptake and intestinal excretion of organic cations in mice with a targeted disruption of the organic cation transporter 1 (Oct1 [Slc22a1]) gene. Mol. Cell. Biol. 2001, 21, 5471–5477. [Google Scholar] [CrossRef] [Green Version]
- Amphoux, A.; Vialou, V.; Drescher, E.; Bruss, M.; Mannoury La Cour, C.; Rochat, C.; Millan, M.J.; Giros, B.; Bonisch, H.; Gautron, S. Differential pharmacological in vitro properties of organic cation transporters and regional distribution in rat brain. Neuropharmacology 2006, 50, 941–952. [Google Scholar] [CrossRef]
- Vialou, V.; Amphoux, A.; Zwart, R.; Giros, B.; Gautron, S. Organic cation transporter 3 (Slc22a3) is implicated in salt-intake regulation. J. Cereb. Blood Flow Metab. 2004, 24, 2846–2851. [Google Scholar] [CrossRef] [PubMed]
- Bartlett, R.M.; Holden, J.E.; Nickles, R.J.; Murali, D.; Barbee, D.L.; Barnhart, T.E.; Christian, B.T.; DeJesus, O.T. Paraquat is excluded by the blood brain barrier in rhesus macaque: An in vivo pet study. Brain Res. 2009, 1259, 74–79. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Naylor, J.L.; Widdowson, P.S.; Simpson, M.G.; Farnworth, M.; Ellis, M.K.; Lock, E.A. Further evidence that the blood/brain barrier impedes paraquat entry into the brain. Hum. Exp. Toxicol. 1995, 14, 587–594. [Google Scholar] [CrossRef] [PubMed]
- Widdowson, P.S.; Farnworth, M.J.; Upton, R.; Simpson, M.G. No changes in behaviour, nigro-striatal system neurochemistry or neuronal cell death following toxic multiple oral paraquat administration to rats. Hum. Exp. Toxicol. 1996, 15, 583–591. [Google Scholar] [CrossRef] [PubMed]
- Bartlett, R.M.; Murali, D.; Nickles, R.J.; Barnhart, T.E.; Holden, J.E.; DeJesus, O.T. Assessment of fetal brain uptake of paraquat in utero using in vivo PET/CT imaging. Toxicol. Sci. 2011, 122, 551–556. [Google Scholar] [CrossRef] [Green Version]
- Chiueh, C.C.; Markey, S.P.; Burns, R.S.; Johannessen, J.N.; Jacobowitz, D.M.; Kopin, I.J. Neurochemical and behavioral effects of 1-methyl-4-phenyl-1,2,3,6- tetrahydropyridine (MPTP) in rat, guinea pig, and monkey. Psychopharmacol. Bull. 1984, 20, 548–553. [Google Scholar]
- Boyce, S.; Kelly, E.; Reavill, C.; Jenner, P.; Marsden, C.D. Repeated administration of N-methyl-4-phenyl 1,2,5,6-tetrahydropyridine to rats is not toxic to striatal dopamine neurones. Biochem. Pharmacol. 1984, 33, 1747–1752. [Google Scholar] [CrossRef]
- Rojo, A.I.; Montero, C.; Salazar, M.; Close, R.M.; Fernandez-Ruiz, J.; Sanchez-Gonzalez, M.A.; de Sagarra, M.R.; Jackson-Lewis, V.; Cavada, C.; Cuadrado, A. Persistent penetration of MPTP through the nasal route induces Parkinson’s disease in mice. Eur. J. Neurosci. 2006, 24, 1874–1884. [Google Scholar] [CrossRef]
- Kalaria, R.N.; Mitchell, M.J.; Harik, S.I. Correlation of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine neurotoxicity with blood-brain barrier monoamine oxidase activity. Proc. Natl. Acad. Sci. USA 1987, 84, 3521–3525. [Google Scholar] [CrossRef] [Green Version]
- Kalaria, R.N.; Harik, S.I. Blood-brain barrier monoamine oxidase: Enzyme characterization in cerebral microvessels and other tissues from six mammalian species, including human. J. Neurochem. 1987, 49, 856–864. [Google Scholar] [CrossRef]
- Vilas-Boas, V.; Silva, R.; Guedes-de-Pinho, P.; Carvalho, F.; Bastos, M.L.; Remiao, F. RBE4 cells are highly resistant to paraquat-induced cytotoxicity: Studies on uptake and efflux mechanisms. J. Appl. Toxicol. 2014, 34, 1023–1030. [Google Scholar] [CrossRef] [PubMed]
- Silva, R.; Palmeira, A.; Carmo, H.; Barbosa, D.J.; Gameiro, M.; Gomes, A.; Paiva, A.M.; Sousa, E.; Pinto, M.; de Lourdes Bastos, M.; et al. P-glycoprotein induction in Caco-2 cells by newly synthetized thioxanthones prevents paraquat cytotoxicity. Arch. Toxicol. 2015, 89, 1783–1800. [Google Scholar] [CrossRef] [PubMed]
- Dinis-Oliveira, R.J.; Remiao, F.; Duarte, J.A.; Ferreira, R.; Sanchez Navarro, A.; Bastos, M.L.; Carvalho, F. P-glycoprotein induction: An antidotal pathway for paraquat-induced lung toxicity. Free Radic. Biol. Med. 2006, 41, 1213–1224. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer (Sense) (5′–3′) | Reverse Primer (Antisense) (5′–3′) | Length (bp) |
---|---|---|---|
β-actin | CTGGCCCGGACCTGACAGA | GCGGCAGTGGCCATCTCTC | 132 |
Oct-1 mice | ATAGCGGCATCAAATCTGGT | GACAAGCGAGGGTCACATTC | 94 |
Oct-2 mice | GAGCCACTTGCCACTGAG | ATCCAGGAGTGAGCACACACTAG | 102 |
Oct-3 mice | GTGAGCCAGTTTGACCTTGTCT | GATGAGCCTGCCATATCTGTC | 129 |
Mate-1 mice | GCCATCGTTAATGCCATCGGGTA | CAGGCCGATCACTCCCAGCTT | 90 |
Oct-1 rat | CGGTGGCTGTTGTCCCAGA | GAGCATCTTCAGGTCAGCAGG | 102 |
Oct-2 rat | GCCGGTCTCTCTTCAGAACCT | TGTGTTTCCTTATCTGAGGGGT | 101 |
Oct-3 rat | CAGCCAGTTTGACCTTGTCT | GTAAAAGCCCCAGCCAGGA | 90 |
fmol µg−1 | |||||||
---|---|---|---|---|---|---|---|
Protein | Peptide | LOD | LLOQ | ULOQ | Slope | Intercept | R² |
SLC22A1 | LSPSFADLFR | 0.48 | 0.75 | 62.5 | 1.243 | −0.110 | 0.9855 |
SLC22A2 | SLPASLQR | 0.15 | 0.23 | 125 | 1.037 | −0.018 | 0.9996 |
SLC47A1 | GGPEATLEVR | 0.35 | 0.56 | 62.5 | 1.794 | 0.339 | 0.9984 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chaves, C.; Campanelli, F.; Chapy, H.; Gomez-Zepeda, D.; Glacial, F.; Smirnova, M.; Taghi, M.; Pallud, J.; Perrière, N.; Declèves, X.; et al. An Interspecies Molecular and Functional Study of Organic Cation Transporters at the Blood-Brain Barrier: From Rodents to Humans. Pharmaceutics 2020, 12, 308. https://doi.org/10.3390/pharmaceutics12040308
Chaves C, Campanelli F, Chapy H, Gomez-Zepeda D, Glacial F, Smirnova M, Taghi M, Pallud J, Perrière N, Declèves X, et al. An Interspecies Molecular and Functional Study of Organic Cation Transporters at the Blood-Brain Barrier: From Rodents to Humans. Pharmaceutics. 2020; 12(4):308. https://doi.org/10.3390/pharmaceutics12040308
Chicago/Turabian StyleChaves, Catarina, Federica Campanelli, Hélène Chapy, David Gomez-Zepeda, Fabienne Glacial, Maria Smirnova, Meryam Taghi, Johan Pallud, Nicolas Perrière, Xavier Declèves, and et al. 2020. "An Interspecies Molecular and Functional Study of Organic Cation Transporters at the Blood-Brain Barrier: From Rodents to Humans" Pharmaceutics 12, no. 4: 308. https://doi.org/10.3390/pharmaceutics12040308