Composite Hydrogel of Methacrylated Hyaluronic Acid and Fragmented Polycaprolactone Nanofiber for Osteogenic Differentiation of Adipose-Derived Stem Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Preparation of Fragmented PCL Nanofibers
2.3. Preparation of Nanofiber–Hydrogel Composite
2.4. Rheological Properties of Composite
2.5. Cell Culture and Encapsulation
2.6. Cell Viability Assays
2.7. Live/Dead Assays
2.8. Morphology of Encapsulated Cells
2.9. Real-time Polymerase Chain Reaction (RT-PCR) Analysis
2.10. Immunocytochemistry
2.11. Alizarin Red Staining
2.12. Statistics Analysis
3. Results
3.1. Physical Characterization of PCL Nanofibers
3.2. Morphology of Hydrogel Scaffolds
3.3. Mechanical Properties of Composite Hydrogel
3.4. Cell Viability
3.5. Cell Morphology
3.6. Osteogenic Differentiation of ADSCs in Composite Hydrogel
4. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Tibbitt, M.W.; Anseth, K.S. Hydrogels as extracellular matrix mimics for 3D cell culture. Biotechnol. Bioeng. 2009, 103, 655–663. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Slaughter, B.V.; Khurshid, S.S.; Fisher, O.Z.; Khademhosseini, A.; Peppas, N.A. Hydrogels in regenerative medicine. Adv. Mater. 2009, 21, 3307–3329. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Z.; Li, J. Control of hyperbranched structure of Polycaprolactone/Poly(ethylene glycol) Polyurethane block copolymers by glycerol and their hydrogels for potential cell delivery. J. Phys. Chem. B 2013, 117, 14763–14774. [Google Scholar] [CrossRef] [PubMed]
- Varaprasad, K.; Raghavendra, G.M.; Jayaramudu, T.; Yallapu, M.M.; Sadiku, R. A mini review on hydrogels classification and recent developments in miscellaneous applications. Mater. Sci. Eng. C 2017, 79, 958–971. [Google Scholar] [CrossRef]
- Zhuang, Y.; Yang, X.; Li, Y.; Chen, Y.; Peng, X.; Yu, L.; Ding, J. Sustained release strategy designed for Lixisenatide delivery to synchronously treat diabetes and associated complications. ACS Appl. Mater. Interfaces 2019, 11, 29604–29618. [Google Scholar] [CrossRef]
- Patel, M.; Lee, H.J.; Son, S.; Kim, H.; Kim, J.; Jeong, B. Iron ion-releasing polypeptide thermogel for neuronal differentiation of mesenchymal stem cells. Biomacromolecules 2020, 21, 143–151. [Google Scholar] [CrossRef]
- Yeo, Y.; Highley, C.B.; Bellas, E.; Ito, T.; Marini, R.; Langer, R.; Kohane, D.S. In situ cross-inkable hyaluronic acid hydrogels prevent post-operative abdominal adhesions in a rabbit model. Biomaterials 2006, 27, 4698–4705. [Google Scholar] [CrossRef]
- Wei, C.-Z.; Hou, C.-L.; Gu, Q.-S.; Jiang, L.-X.; Zhu, B.; Sheng, A.-L. A thermosensitive chitosan-based hydrogel barrier for post-operative adhesions’ prevention. Biomaterials 2009, 30, 5534–5540. [Google Scholar] [CrossRef]
- Spicer, C.D. Hydrogel scaffolds for tissue engineering: The importance of polymer choice. Polym. Chem. 2019, 11, 184–219. [Google Scholar] [CrossRef]
- Chai, Q.; Jiao, Y.; Yu, X. Hydrogels for biomedical applications: Their characteristics and the mechanisms behind them. Gels 2017, 3, 6. [Google Scholar] [CrossRef] [Green Version]
- Nguyen, K.T.; West, J.L. Photopolymerizable hydrogels for tissue engineering applications. Biomaterials 2002, 23, 4307–4314. [Google Scholar] [CrossRef]
- Nguyen, M.K.; Alsberg, E. Bioactive factor delivery strategies from engineered polymer hydrogels for therapeutic medicine. Prog. Polym. Sci. 2014, 39, 1235–1265. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smeds, K.A.; Grinstaff, M.W. Photocrosslinkable polysaccharides for in situ hydrogel formation. J. Biomed. Mater. Res. 2001, 54, 115–121. [Google Scholar] [CrossRef]
- Jeon, O.; Bouhadir, K.H.; Mansour, J.M.; Alsberg, E. Photocrosslinked alginate hydrogels with tunable biodegradation rates and mechanical properties. Biomaterials 2009, 30, 2724–2734. [Google Scholar] [CrossRef] [PubMed]
- Yang, K.; Sun, J.; Wei, D.; Yuan, L.; Yang, J.; Guo, L.; Fan, H.; Zhanga, X. Photo-crosslinked mono-component type II collagen hydrogel as a matrix to induce chondrogenic differentiation of bone marrow mesenchymal stem cells. J. Mater. Chem. B 2017, 5, 8707–8718. [Google Scholar] [CrossRef] [PubMed]
- Bochove, B.; Grijpma, D.W. Photo-crosslinked synthetic biodegradable polymer networks for biomedical applications. J. Biomater. Sci. Polym. 2019, 30, 77–106. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choi, J.R.; Yong, K.W.; Choi, J.Y.; Cowie, A.C. Recent advances in photo-crosslinkable hydrogels for biomedical applications. Biotechniques 2019, 66, 40–53. [Google Scholar] [CrossRef] [Green Version]
- Coradini, D.; Pellizzaro, C.; Miglierini, G.; Daidone, M.G.; Perbellini, A. Hyaluronic acid as drug delivery for sodium butyrate: Improvement of the anti-proliferative activity on a breast-cancer cell line. Int. J. Cancer 1999, 81, 411–416. [Google Scholar] [CrossRef]
- Markwald, R.R.; Fitzharris, T.P.; Bernanke, D.H. Morphologic recognition of complex carbohydrates in embryonic cardiac extracellular matrix. J. Histochem. Cytochem. 1979, 27, 1171–1173. [Google Scholar] [CrossRef] [Green Version]
- Mason, M.; Vercruysse, K.P.; Kirker, K.R.; Frisch, R.; Marecak, D.M.; Prestwich, C.D.; Pitt, W.G. Attachment of hyaluronic acid to polypropylene, polystyrene, and polytetrafluoroethylene. Biomaterials 2000, 21, 31–36. [Google Scholar] [CrossRef]
- Verheye, S.; Markou, C.P.; Salame, M.Y.; Wan, B.; King, S.B.; Robinson, K.A.; Chronos, N.A.F.; Hanson, S.R. Reduced thrombus formation by hyaluronic acid coating of endovascular devices. Arterioscler. Thromb. Vasc. Biol. 2000, 20, 1168–1172. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.; Kim, I.S.; Cho, T.H.; Lee, K.B.; Hwang, S.J.; Tae, G.; Noh, I.; Lee, S.H.; Park, Y.; Sun, K. Bone regeneration using hyaluronic acid-based hydrogel with bone morphogenic protein-2 and human mesenchymal stem cells. Biomaterials 2007, 28, 1830–1837. [Google Scholar] [CrossRef] [PubMed]
- Kisiel, M.; Martino, M.M.; Ventura, M.; Hubbell, J.A.; Hilborn, J.; Ossipov, D.A. Improving the osteogenic potential of BMP-2 with hyaluronic acid hydrogel modified with integrin-specific fibronectin fragment. Biomaterials 2013, 34, 704–712. [Google Scholar] [CrossRef] [PubMed]
- Hulsart-Billström, G.; Yuen, P.K.; Marsell, R.; Hilborn, J.; Larsoon, S.; Ossipov, D.A. Bisphosphonate-linked hyaluronic acid hydrogel sequesters and enzymatically releases active bone morphogenetic protein-2 for induction of osteogenic differentiation. Biomacromolecules 2013, 14, 3055–3063. [Google Scholar] [CrossRef] [PubMed]
- Aslan, M.; Şimşek, G.; Dayi, E. The effect of hyaluronic acid-supplemented bone graft in bone healing: Experimental study in rabbits. J. Biomat. Appl. 2006, 20, 209–220. [Google Scholar] [CrossRef]
- Lee, S.J.; Nah, H.; Heo, D.N.; Kim, K.-H.; Seok, J.M.; Heo, M.; Moon, H.-J.; Lee, D.; Lee, J.S.; An, S.Y. Induction of osteogenic differentiation in a rat calvarial bone defect model using an in situ forming graphene oxide incorporated glycol chitosan/oxidized hyaluronic acid injectable hydrogel. Carbon 2020, 168, 264–277. [Google Scholar] [CrossRef]
- Yang, S.; Zhu, B.; Yin, P.; Zhao, L.; Wang, Y.; Fu, Z.; Dang, R.; Xu, J.; Zhang, J.; Wen, N. Integration of human umbilical cord mesenchymal stem cells-derived exosomes with hydroxyapatite-embedded hyaluronic acid-alginate hydrogel for bone regeneration. ACS Biomater. Sci. Eng. 2020, 6, 1590–1602. [Google Scholar] [CrossRef]
- Zhou, Y.; Gu, Z.; Liu, J.; Huang, K.; Liu, G.; Wu, J. Arginine based poly (ester amide)/hyaluronic acid hybrid hydrogels for bone tissue Engineering. Carbohydr. Polym. 2020, 230, 115640. [Google Scholar] [CrossRef]
- Ma, J.; Cai, H.; Long, X.; Cheng, K.; Xu, X.; Zhang, D.; Li, J. Hyaluronic acid bioinspired polymers for the regulation of cell chondrogenic and osteogenic differentiation. Int. J. Biol. Macromol. 2020, 161, 1011–1020. [Google Scholar] [CrossRef]
- Zhao, D.; Zhu, T.; Li, J.; Cui, L.; Zhang, Z.; Zhuang, X.; Ding, J. Poly(lactic-co-glycolic acid)-based composite bone-substitute materials. Bioact. Mater. 2021, 6, 346–360. [Google Scholar] [CrossRef]
- Masters, K.S.; Shah, D.N.; Leinwand, L.A.; Anseth, K.S. Crosslinked hyaluronan scaffolds as a biologically active carrier for valvular interstitial cells. Biomaterials 2005, 26, 2517–2525. [Google Scholar] [CrossRef]
- Burdick, J.A.; Chung, C.; Jia, X.; Randolph, M.A.; Langer, R. Controlled degradation and mechanical behavior of photopolymerized hyaluronic acid networks. Biomacromolecules 2005, 6, 386–391. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Q.; Shou, P.; Zheng, C.; Jiang, M.; Cao, G.; Yang, Q.; Cao, J.; Xie, N.; Velletri, T.; Zhang, X.; et al. Fate decision of mesenchymal stem cells: Adipocytes or osteoblasts? Cell Death Differ. 2016, 23, 1128–1139. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Camci-Unal, G.; Cuttica, D.; Annabi, N.; Demarchi, D.; Khademhosseini, A. Synthesis and characterization of hybrid hyaluronic acid-gelatin hydrogels. Biomacromolecules 2013, 14, 1085–1092. [Google Scholar] [CrossRef]
- Camci-Unal, G.; Aubin, H.; Ahari, A.F.; Bae, H.; Nichol, J.W.; Khademhosseini, A. Surface-modified hyaluronic acid hydrogels to capture endothelial progenitor cells. Soft Matter 2010, 6, 5120–5126. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gwon, K.; Kim, E.; Tae, G. Heparin-hyaluronic acid hydrogel in support of cellular activities of 3D encapsulated adipose derived stem cells. Acta Biomater. 2017, 49, 284–295. [Google Scholar] [CrossRef]
- Peppas, N.A.; Hilt, J.Z.; Khademhosseini, A.; Langer, R. Hydrogels in biology and medicine: From molecular principles to bionanotechnology. Adv. Mater. 2006, 18, 1345–1360. [Google Scholar] [CrossRef]
- Hsieh, A.; Zahir, T.; Lapitsky, Y.; Amsden, B.; Wan, W.; Shoichet, M.S. Hydrogel/electrospun fiber composites influence neural stem/progenitor cell fate. Soft Matter 2010, 6, 2227–2237. [Google Scholar] [CrossRef] [Green Version]
- Mohabatpour, F.; Karkhaneh, A.; Sharifi, A.M. A hydrogel/fiber composite scaffold for chondrocyte encapsulation in cartilage tissue regeneration. RSC Adv. 2016, 6, 83135–83145. [Google Scholar] [CrossRef]
- Lee, S.; Kim, H.S.; Yoo, H.S. Electrospun nanofibrils embedded hydrogel composites for cell cultivation in a biomimetic environment. RSC Adv. 2017, 7, 54246–54253. [Google Scholar] [CrossRef] [Green Version]
- Han, Y.; Li, X.; Zhang, Y.; Han, Y.; Chang, F.; Ding, J. Mesenchymal stem cells for regenerative medicine. Cells 2019, 8, 886. [Google Scholar] [CrossRef] [Green Version]
- Brittany, L.B.; Justin, L.B. Polymeric biomaterials in nanomedicine. In Natural Synthetic Biomedical Polymers; Elsevier Science: Amsterdam, The Netherlands, 2014; pp. 387–395. [Google Scholar]
- Beachley, V.; Wen, X. Effect of electrospinning parameters on the nanofiber diameter and length. Mater. Sci. Eng. C Mater. Biol. Appl. 2009, 29, 663–668. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sawawi, M.; Wang, T.Y.; Nisbet, D.R.; Simon, G.P. Scission of electrospun polymer fibres by ultrasonication. Polymer 2013, 54, 4237–4252. [Google Scholar] [CrossRef]
- Fujihara, K.; Kumar, A.; Jose, R.; Ramakrishna, S.; Uchida, S. Spray deposition of electrospun TiO2 nanorods for dye-sensitized solar cell. Nanotechnology 2007, 18, 365709. [Google Scholar] [CrossRef]
- Jo, J.H.E.; Lee, J.; Shin, D.S.; Kim, H.E.; Kim, H.W.; Koh, Y.H.; Jang, J.H. In vitro/in vivo biocompatibility and mechanical properties of bioactive glass nanofiber and poly (ε-caprolactone) composite materials. J. Biomed. Mater. Res. Part B 2009, 91, 213–220. [Google Scholar] [CrossRef] [Green Version]
- Kriha, O.; Becker, M.; Lehmann, M.; Kriha, D.; Krieglstein, J.; Yosef, M.; Schlecht, S.; Wehrspohn, R.B.; Wendorff, J.H.; Greiner, A. Connection of hippocampal neurons by magnetically controlled movement of short electrospun polymer fibers—A route to magnetic micromanipulators. Adv. Mater. 2007, 19, 2483–2485. [Google Scholar] [CrossRef]
- Coburn, J.; Gibson, M.; Bandalini, P.A.; Laird, C.; Mao, H.Q.; Moroni, L.; Seliktar, D.; Elisseeff, J. Biomimetics of the extracellular matrix: An integrated three-dimensional fiber-hydrogel composite for cartilage tissue engineering. Smart Struct. Syst. 2011, 7, 213–222. [Google Scholar] [CrossRef]
- Engler, A.J.; Sen, S.; Sweeney, H.L.; Discher, D.E. Matrix elasticity directs stem cell lineage specification. Cell 2006, 126, 677–689. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Murphy, C.M.; Matsiko, A.; Haugh, M.G.; Gleeson, J.P.; O’Brien, F.J. Mesenchymal stem cell fate is regulated by the composition and mechanical properties of collagen–glycosaminoglycan scaffolds. J. Mech. Behav. Biomed. Mater. 2012, 11, 53–62. [Google Scholar] [CrossRef]
- Twine, N.A.; Chen, L.; Pang, C.N.; Wilkins, M.R.; Kassem, M. Identification of differentiation-stage specific markers that define the ex vivo osteoblastic phenotype. Bone 2014, 67, 23–32. [Google Scholar] [CrossRef]
- Tsai, M.T.; Li, W.J.; Tuan, R.S.; Chang, W.H. Modulation of osteogenesis in human mesenchymal stem cells by specific pulsed electromagnetic field stimulation. J. Orthop. Res. 2009, 27, 1169–1174. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, J.; Li, Z.; Hou, Y.; Fang, W. Potential mechanisms underlying the Runx2 induced osteogenesis of bone marrow mesenchymal stem cells. Am. J. Transl. Res. 2015, 7, 2527–2535. [Google Scholar] [PubMed]
Col1 | F: TCCCTTTGGAGCACTTCTTATC R: CTTGGAGGCTGTTTCCTTACT |
ALP | F: TGGAGTATGAGAGTGACGAGAA R: GGCTACCTTGTATCTCGGTTTG |
RUNX2 | F: CAGACAGAAGCTTGATGACTCTAA R: CGGGACACCTACTCTCATACT |
GAPDH | F: CTCCTCACAGTTGCCATGTA R: GTTGAGCACAGGGTACTTTATTG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Patel, M.; Koh, W.-G. Composite Hydrogel of Methacrylated Hyaluronic Acid and Fragmented Polycaprolactone Nanofiber for Osteogenic Differentiation of Adipose-Derived Stem Cells. Pharmaceutics 2020, 12, 902. https://doi.org/10.3390/pharmaceutics12090902
Patel M, Koh W-G. Composite Hydrogel of Methacrylated Hyaluronic Acid and Fragmented Polycaprolactone Nanofiber for Osteogenic Differentiation of Adipose-Derived Stem Cells. Pharmaceutics. 2020; 12(9):902. https://doi.org/10.3390/pharmaceutics12090902
Chicago/Turabian StylePatel, Madhumita, and Won-Gun Koh. 2020. "Composite Hydrogel of Methacrylated Hyaluronic Acid and Fragmented Polycaprolactone Nanofiber for Osteogenic Differentiation of Adipose-Derived Stem Cells" Pharmaceutics 12, no. 9: 902. https://doi.org/10.3390/pharmaceutics12090902