Effects of Lapatinib on HER2-Positive and HER2-Negative Canine Mammary Carcinoma Cells Cultured In Vitro
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Inclusion Criteria
2.3. In Silico Analysis of HER2 Homology
2.4. Experimental Groups
2.5. HER2 Immunoreactivity
2.6. Lapatinib Treatment and Evaluation of Cellular Metabolic Activity
2.7. RNA Extraction from Paraffin-Embedded Tissue and Cell Culture Samples and RT-qPCR Analysis
2.8. Cell Migration Assay
2.9. Statistical Analysis
3. Results
3.1. HER2 Homology
3.2. Gene Expression
3.3. Cell Viability
3.4. Correlation between HER2 Expression and the IC50
3.5. Cell Migration
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Acknowledgments
Conflicts of Interest
References
- Yu, R.M.C.; Cheah, Y.K. The roles of miRNAs in human breast cancer and canine mammary tumor. Appl. Cancer Res. 2017, 37, 37. [Google Scholar] [CrossRef] [Green Version]
- Sahabi, K.; Selvarajah, G.T.; Abdullah, R.; Cheah, Y.K.; Tan, G.C. Comparative aspects of microRNA expression in canine and human cancers. J. Veter Sci. 2018, 19, 162–171. [Google Scholar] [CrossRef]
- Sorlie, T.; Perou, C.M.; Tibshirani, R.; Aas, T.; Geisler, S.; Johnsen, H.; Hastie, T.; Eisen, M.B.; van de Rijn, M.; Jeffrey, S.S.; et al. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc. Natl. Acad. Sci. USA 2001, 98, 10869–10874. [Google Scholar] [CrossRef] [Green Version]
- Fragomeni, S.M.; Sciallis, A.; Jeruss, J.S. Molecular Subtypes and Local-Regional Control of Breast Cancer. Surg. Oncol. Clin. N. Am. 2018, 27, 95–120. [Google Scholar] [CrossRef]
- Harbeck, N.; Penault-Llorca, F.; Cortes, J.; Gnant, M.; Houssami, N.; Poortmans, P.; Ruddy, K.; Tsang, J.; Cardoso, F. Breast cancer. Nat. Rev. Dis. Prim. 2019, 5, 1–31. [Google Scholar] [CrossRef]
- Ross, J.S.; Slodkowska, E.A.; Symmans, W.F.; Pusztai, L.; Ravdin, P.M.; Hortobagyi, G.N. The HER-2 Receptor and Breast Cancer: Ten Years of Targeted Anti–HER-2 Therapy and Personalized Medicine. Oncology 2009, 14, 320–368. [Google Scholar] [CrossRef] [Green Version]
- Anderson, N.G.; Ahmad, T. ErbB receptor tyrosine kinase inhibitors as therapeutic agents. Front. Biosci. 2002, 7, 1926. [Google Scholar] [CrossRef]
- Roskoski, R. The ErbB/HER receptor protein-tyrosine kinases and cancer. Biochem. Biophys. Res. Commun. 2004, 319, 1–11. [Google Scholar] [CrossRef]
- Arkhipov, A.; Shan, Y.; Kim, E.T.; O Dror, R.; E Shaw, D. Her2 activation mechanism reflects evolutionary preservation of asymmetric ectodomain dimers in the human EGFR family. eLife 2013, 2, e00708. [Google Scholar] [CrossRef]
- Holbro, T. The ErbB receptors and their role in cancer progression. Exp. Cell Res. 2003, 284, 99–110. [Google Scholar] [CrossRef]
- Arciero, C.A.; Guo, Y.; Jiang, R.; Behera, M.; O’Regan, R.; Peng, L.; Li, X. ER+/HER2+ Breast Cancer Has Different Metastatic Patterns and Better Survival Than ER−/HER2+ Breast Cancer. Clin. Breast Cancer 2019, 19, 236–245. [Google Scholar] [CrossRef]
- Waks, A.G.; Winer, E.P. Breast Cancer Treatment: A Review. JAMA 2019, 321, 288–300. [Google Scholar] [CrossRef]
- Howlader, N.; Cronin, K.A.; Kurian, A.W.; Andridge, R. Differences in Breast Cancer Survival by Molecular Subtypes in the United States. Cancer Epidemiol. Biomark. Prev. 2018, 27, 619–626. [Google Scholar] [CrossRef] [Green Version]
- Escrivá-De-Romaní, S.; Arumí, M.; Bellet, M.; Saura, C. HER2-positive breast cancer: Current and new therapeutic strategies. Breast 2018, 39, 80–88. [Google Scholar] [CrossRef]
- Kreutzfeldt, J.; Rozeboom, B.; Dey, N.; De, P. The trastuzumab era: Current and upcoming targeted HER2+ breast cancer therapies. Am. J. Cancer Res. 2020, 10, 1045–1067. [Google Scholar] [PubMed]
- Arteaga, C.L.; Sliwkowski, M.X.; Osborne, C.K.; Perez, E.A.; Puglisi, F.; Gianni, L. Treatment of HER2-positive breast cancer: Current status and future perspectives. Nat. Rev. Clin. Oncol. 2011, 9, 16–32. [Google Scholar] [CrossRef]
- Patel, T.A.; Ensor, J.E.; Creamer, S.L.; Boone, T.; Rodriguez, A.A.; Niravath, P.A.; Darcourt, J.G.; Meisel, J.L.; Li, X.; Zhao, J.; et al. A randomized, controlled phase II trial of neoadjuvant ado-trastuzumab emtansine, lapatinib, and nab-paclitaxel versus trastuzumab, pertuzumab, and paclitaxel in HER2-positive breast cancer (TEAL study). Breast Cancer Res. 2019, 21, 1–9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vernieri, C.; Milano, M.; Brambilla, M.; Mennitto, A.; Maggi, C.; Cona, M.S.; Prisciandaro, M.; Fabbroni, C.; Celio, L.; Mariani, G.; et al. The trastuzumab era: Current and upcoming targeted HER2+ breast cancer therapies. Am. J. Cancer Res. 2020, 10, 1045–1067, PMCID:PMC7191090. [Google Scholar] [PubMed]
- Bredin, P.; Walshe, J.M.; Denduluri, N. Systemic therapy for metastatic HER2-positive breast cancer. Semin. Oncol. 2020, 47, 259–269. [Google Scholar] [CrossRef]
- Kunte, S.; Abraham, J.; Montero, A.J. Novel HER2–targeted therapies for HER2–positive metastatic breast cancer. Cancer 2020, 126, 4278–4288. [Google Scholar] [CrossRef]
- Gameiro, A.; Nascimento, C.; Correia, J.; Ferreira, F. HER2-Targeted Immunotherapy and Combined Protocols Showed Promising Antiproliferative Effects in Feline Mammary Carcinoma Cell-Based Models. Cancers 2021, 13, 2007. [Google Scholar] [CrossRef] [PubMed]
- Gameiro, A.; Almeida, F.; Nascimento, C.; Correia, J.; Ferreira, F. Tyrosine Kinase Inhibitors Are Promising Therapeutic Tools for Cats with HER2-Positive Mammary Carcinoma. Pharmaceutics 2021, 13, 346. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, F.; Peña, L.; Ibisch, C.; Loussouarn, D.; Gama, A.; Rieder, N.; Belousov, A.; Campone, M.; Abadie, J. Canine invasive mammary carcinomas as models of human breast cancer. Part 1: Natural history and prognostic factors. Breast Cancer Res. Treat. 2018, 167, 635–648. [Google Scholar] [CrossRef] [Green Version]
- Peña, L.; De Andrés, P.J.; Clemente, M.; Cuesta, P.; Pérez-Alenza, M.D. Prognostic Value of Histological Grading in Noninflammatory Canine Mammary Carcinomas in a Prospective Study with Two-Year Follow-Up. Veter Pathol. 2012, 50, 94–105. [Google Scholar] [CrossRef] [PubMed]
- Gama, A.; Alves, A.; Schmitt, F. Identification of molecular phenotypes in canine mammary carcinomas with clinical implications: Application of the human classification. Virchows Archiv. 2008, 453, 123–132. [Google Scholar] [CrossRef]
- Cassali, G.; Damasceno, K.; Bertagnolli, A.; Estrela-Lima, A.; Lavalle, G.; Santis, G.; Nardi, A.; Fernandes, C.; Cogliati, B.; Sobral, R.; et al. Consensus regarding the diagnosis, prognosis and treatment of canine mammary tumors: Benign mixed tumors, carcinomas in mixed tumors and carcinosarcomas. Braz. J. Veter Pathol. 2017, 10, 555–574. [Google Scholar] [CrossRef]
- Lavalle, G.E.; Campos, C.B.; Bertagnolli, A.C.; Cassali, G.D. Canine malignant mammary gland neoplasias with advanced clinical staging treated with carboplatin and cyclooxygenase inhibitors. In Vivo 2012, 2693, 375–379. [Google Scholar] [PubMed]
- Tran, C.M.; Moore, A.S.; Frimberger, A. Surgical treatment of mammary carcinomas in dogs with or without postoperative chemotherapy. Veter Comp. Oncol. 2016, 14, 252–262. [Google Scholar] [CrossRef] [PubMed]
- Goldschmidt, M.; Peña, L.; Rasotto, R.; Zappulli, V. Classification and Grading of Canine Mammary Tumors. Veter Pathol. 2011, 48, 117–131. [Google Scholar] [CrossRef]
- Lainetti, P.D.F.; Brandi, A.; Filho, A.F.L.; Prado, M.C.M.; Kobayashi, P.E.; Laufer-Amorim, R.; Fonseca-Alves, C.E. Establishment and Characterization of Canine Mammary Gland Carcinoma Cell Lines with Vasculogenic Mimicry Ability in vitro and in vivo. Front. Veter Sci. 2020, 7, 583874. [Google Scholar] [CrossRef]
- Lazic, S.E.; Clarke-Williams, C.J.; Munafò, M.R. What exactly is ‘N’ in cell culture and animal experiments? PLoS Biol. 2018, 16, e2005282. [Google Scholar] [CrossRef] [Green Version]
- Nahta, R.; Yuan, L.X.; Du, Y.; Esteva, F.J. Lapatinib induces apoptosis in trastuzumab-resistant breast cancer cells: Effects on insulin-like growth factor I signaling. Mol. Cancer Ther. 2007, 6, 667–674. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Negri, J.M.; McMillin, D.W.; Delmore, J.; Mitsiades, N.; Hayden, P.; Klippel, S.; Hideshima, T.; Chauhan, D.; Munshi, N.C.; Buser, C.A.; et al. In vitroanti-myeloma activity of the Aurora kinase inhibitor VE-465. Br. J. Haematol. 2009, 147, 672–676. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2–ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Maximiano, S.; Magalhães, P.; Guerreiro, M.P.; Morgado, M. Trastuzumab in the Treatment of Breast Cancer. BioDrugs 2016, 30, 75–86. [Google Scholar] [CrossRef] [PubMed]
- Riera, R.; De Soárez, P.C.; Puga, M.E.D.S.; Ferraz, M.B. Lapatinib for treatment of advanced or metastasized breast cancer: Systematic review. Sao Paulo Med. J. 2009, 127, 295–301. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Opdam, F.L.; Guchelaar, H.-J.; Beijnen, J.H.; Schellens, J.H. Lapatinib for Advanced or Metastatic Breast Cancer. Oncology 2012, 17, 536–542. [Google Scholar] [CrossRef] [Green Version]
- Yang, F.; Huang, X.; Sun, C.; Li, J.; Wang, B.; Yan, M.; Jin, F.; Wang, H.; Zhang, J.; Fu, P.; et al. Lapatinib in combination with capecitabine versus continued use of trastuzumab in breast cancer patients with trastuzumab-resistance: A retrospective study of a Chinese population. BMC Cancer 2020, 20, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Al-Mansour, M.A.; Kubba, M.A.; Al-Azreg, S.A.; Dribika, S.A. Comparative histopathology and immunohistochemistry of human and canine mammary tumors. Open Veter J. 2018, 8, 243–249. [Google Scholar] [CrossRef]
- De Andrés, P.J.; Illera, J.C.; Cáceres, S.; Díez, L.; Pérez-Alenza, M.D.; Peña, L. Increased levels of interleukins 8 and 10 as findings of canine inflammatory mammary cancer. Veter Immunol. Immunopathol. 2013, 152, 245–251. [Google Scholar] [CrossRef]
- Singer, J.; Weichselbaumer, M.; Stockner, T.; Mechtcheriakova, D.; Sobanov, Y.; Bajna, E.; Wrba, F.; Horvat, R.; Thalhammer, J.G.; Willmann, M.; et al. Comparative oncology: ErbB-1 and ErbB-2 homologues in canine cancer are susceptible to cetuximab and trastuzumab targeting. Mol. Immunol. 2012, 50, 200–209. [Google Scholar] [CrossRef]
- Guan, M.; Tong, Y.; Guan, M.; Liu, X.; Wang, M.; Niu, R.; Zhang, F.; Dong, N.; Shao, J.; Zhou, Y. Lapatinib Inhibits Breast Cancer Cell Proliferation by Influencing PKM2 Expression. Technol. Cancer Res. Treat. 2018, 17. [Google Scholar] [CrossRef] [Green Version]
- Showalter, L.E.; Oechsle, C.; Ghimirey, N.; Steele, C.; Czerniecki, B.J.; Koski, G.K. Th1 cytokines sensitize HER-expressing breast cancer cells to lapatinib. PLoS ONE 2019, 14, e0210209. [Google Scholar] [CrossRef] [PubMed]
- Ma, S.; Dielschneider, R.F.; Henson, E.S.; Xiao, W.; Choquette, T.R.; Blankstein, A.R.; Chen, Y.; Gibson, S.B. Ferroptosis and autophagy induced cell death occur independently after siramesine and lapatinib treatment in breast cancer cells. PLoS ONE 2017, 12, e0182921. [Google Scholar] [CrossRef] [Green Version]
- Kaczyńska, A.; Herman-Antosiewicz, A. Combination of lapatinib with isothiocyanates overcomes drug resistance and inhibits migration of HER2 positive breast cancer cells. Breast Cancer 2016, 24, 271–280. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, X.; Zhou, Q.-H.; Xu, K. Are isothiocyanates potential anti-cancer drugs? Acta Pharmacol. Sin. 2009, 30, 501–512. [Google Scholar] [CrossRef] [Green Version]
- Simiczyjew, A.; Dratkiewicz, E.; Van Troys, M.; Ampe, C.; Styczeń, I.; Nowak, D. Combination of EGFR Inhibitor Lapatinib and MET Inhibitor Foretinib Inhibits Migration of Triple Negative Breast Cancer Cell Lines. Cancers 2018, 10, 335. [Google Scholar] [CrossRef] [Green Version]
- Stringer-Reasor, E.M.; May, J.E.; Olariu, E.; Caterinicchia, V.; Li, Y.; Chen, D.; Della Manna, D.L.; Rocque, G.B.; Vaklavas, C.; Falkson, C.I.; et al. An open-label, pilot study of veliparib and lapatinib in patients with metastatic, triple-negative breast cancer. Breast Cancer Res. 2021, 23, 1–12. [Google Scholar] [CrossRef]
- Ma, F.; Ouyang, Q.; Li, W.; Jiang, Z.; Tong, Z.; Liu, Y.; Li, H.; Yu, S.; Feng, J.; Wang, S.; et al. Pyrotinib or Lapatinib Combined With Capecitabine in HER2–Positive Metastatic Breast Cancer with Prior Taxanes, Anthracyclines, and/or Trastuzumab: A Randomized, Phase II Study. J. Clin. Oncol. 2019, 37, 2610–2619. [Google Scholar] [CrossRef] [PubMed]
- Abo-Zeid, M.A.; Abo-Elfadl, M.T.; Gamal-Eldeen, A.M. Evaluation of lapatinib cytotoxicity and genotoxicity on MDA-MB-231 breast cancer cell line. Environ. Toxicol. Pharmacol. 2019, 71, 103207. [Google Scholar] [CrossRef] [PubMed]
- Broekman, F. Tyrosine kinase inhibitors: Multi-targeted or single-targeted? World J. Clin. Oncol. 2011, 2, 80–93. [Google Scholar] [CrossRef] [PubMed]
- Konecny, G.E.; Pegram, M.D.; Venkatesan, N.; Finn, R.; Yang, G.; Rahmeh, M.; Untch, M.; Rusnak, D.W.; Spehar, G.; Mullin, R.J.; et al. Activity of the Dual Kinase Inhibitor Lapatinib (GW572016) against HER-2-Overexpressing and Trastuzumab-Treated Breast Cancer Cells. Cancer Res. 2006, 66, 1630–1639. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Cell Type | UNESP-MM1 | UNESP-MM4 | UNESP-CM1 | UNESP-CM5 | UNESP-CM9 | UNESP-CM60 |
---|---|---|---|---|---|---|
HER2 expression | 0 | 1+ | 3+ | 1+ | 3+ | 3+ |
Access Gene Symbol 1 | Oligonucleotide Sequence (5′ > 3′) |
---|---|
HPRT | Forward primer (5′-3′) AGCTTGCTGGTGAAAAGGAC |
Reverse primer (3′-5′) TTATAGTCAAGGGCATATCC | |
RPS19 | Forward primer (5′-3′) CCTTCCTCAAAAAGTCTGGG |
Reverse primer (3′-5′) GAACGAGGGATGCTACTCTTG | |
RPS5 | Forward primer (5′-3′) TCACTGGTGAGAACCCCCT |
Reverse primer (3′-5′) TCACTGGTGAGAACCCCCT | |
HER2 | Forward primer (5′-3′) GCTCTGGAGGGAGTCACAGGTTA |
Reverse primer (3′-5′) ACTGAGGTTAGGCAGGCTGTCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Leis-Filho, A.F.; de Faria Lainetti, P.; Emiko Kobayashi, P.; Fonseca-Alves, C.E.; Laufer-Amorim, R. Effects of Lapatinib on HER2-Positive and HER2-Negative Canine Mammary Carcinoma Cells Cultured In Vitro. Pharmaceutics 2021, 13, 897. https://doi.org/10.3390/pharmaceutics13060897
Leis-Filho AF, de Faria Lainetti P, Emiko Kobayashi P, Fonseca-Alves CE, Laufer-Amorim R. Effects of Lapatinib on HER2-Positive and HER2-Negative Canine Mammary Carcinoma Cells Cultured In Vitro. Pharmaceutics. 2021; 13(6):897. https://doi.org/10.3390/pharmaceutics13060897
Chicago/Turabian StyleLeis-Filho, Antonio Fernando, Patrícia de Faria Lainetti, Priscila Emiko Kobayashi, Carlos Eduardo Fonseca-Alves, and Renée Laufer-Amorim. 2021. "Effects of Lapatinib on HER2-Positive and HER2-Negative Canine Mammary Carcinoma Cells Cultured In Vitro" Pharmaceutics 13, no. 6: 897. https://doi.org/10.3390/pharmaceutics13060897