Flexible Fabrication and Hybridization of Bioactive Hydrogels with Robust Osteogenic Potency
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Synthesis of Tetra-PEG-SG Polymer
2.3. Synthesis and Modification of ABG Particles
2.4. Preparation of TSG-PEI and TSG-PEI@ABG Hydrogels
2.5. Nuclear Magnetic Resonance Spectra
2.6. Scanning Electron Microscopy
2.7. Compressive Measurement
2.8. Rheological Measurement
2.9. Adhesive Study
2.10. Cell Extraction and Culture
2.11. In Vitro Cytotoxicity Assay
2.12. Cell Proliferation Assay
2.13. Live/Dead Staining Assay
2.14. Alizarin Red S (ARS) Staining
2.15. Semiquantitative RT-PCR
2.16. Statistics Analysis
3. Results
3.1. Preparation and Characterization of TSG-PEI and TSG-PEI@ABG Hydrogels
3.2. Cell Viability and Proliferation
3.3. Osteogenic Differentiation of BMSCs in the Hydrogel Scaffolds In Vitro
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dimitriou, R.; Jones, E.; McGonagle, D.; Giannoudis, P.V. Bone regeneration: Current concepts and future directions. BMC. Med. 2011, 9, 66. [Google Scholar] [CrossRef]
- Oryan, A.; Alidadi, S.; Moshiri, A.; Maffulli, N. Bone regenerative medicine: Classic options, novel strategies, and future directions. J. Orthop. Surg. Res. 2014, 9, 18. [Google Scholar] [CrossRef]
- Service, R.F. Tissue engineers build new bone. Science 2000, 289, 1498–1500. [Google Scholar] [CrossRef]
- Gomez-Barrena, E.; Rosset, P.; Lozano, D.; Stanovici, J.; Ermthaller, C.; Gerbhard, F. Bone fracture healing: Cell therapy in delayed unions and nonunions. Bone 2018, 70, 93–101. [Google Scholar] [CrossRef]
- Wang, W.; Yeung, K.W.K. Bone grafts and biomaterials substitutes for bone defect repair: A review. Bioact. Mater. 2017, 2, 224–247. [Google Scholar] [CrossRef]
- Wang, C.X.; Liu, J.G.; Min, S.Y.; Liu, Y.; Liu, B.C.; Hu, Y.Y.; Wang, Z.G.; Mao, F.B.; Wang, C.M.; Ma, X.L.; et al. The effect of pore size on the mechanical properties, biodegradation and osteogenic effects of additively manufactured magnesium scaffolds after high temperature oxidation: An in vitro and in vivo study. Bioact. Mater. 2023, 28, 537–548. [Google Scholar] [CrossRef]
- da Silva, R.V.; Bertran, C.A.; Kawachi, E.Y.; Camilli, J.A. Repair of cranial bone defects with calcium phosphate ceramic implant or autogenous bone graft. J. Craniofac. Surg. 2007, 18, 281–286. [Google Scholar] [CrossRef]
- Vi, V.; Baht, G.S.; Soderblom, E.J.; Whetstone, H.; Wei, Q.; Furman, B.; Puviindran, V.; Nadesan, P.; Foster, M.; Poon, R.; et al. Alman. Macrophage cells secrete factors including LRP1 that orchestrate the rejuvenation of bone repair in mice. Nat. Commun. 2018, 9, 5191. [Google Scholar] [CrossRef]
- Wang, S.J.; Jiang, D.; Zhang, Z.Z.; Chen, Y.R.; Yang, Z.D.; Zhang, J.Y.; Shi, J.J.; Wang, X.; Yu, J.K. Biomimetic nanosilica-collagen scaffolds for in situ bone regeneration: Toward a cell-free, one-step surgery. Adv. Mater. 2019, 31, 1904341. [Google Scholar] [CrossRef]
- Wang, X.; Yang, Y.Y.; Shi, Y.; Jia, F. Editorial: Smart hydrogels in tissue engineering and regenerative medicine. Front. Chem. 2020, 8, 245. [Google Scholar] [CrossRef]
- Langer, R.; Vacanti, J.P. Tissue engineering. Science 1993, 260, 920–926. [Google Scholar] [CrossRef] [PubMed]
- Richter, R.F.; Vater, C.; Korn, M.; Ahlfeld, T.; Rauner, M.; Pradel, W.; Stadlinger, B.; Gelinsky, M.; Lode, A.; Korn, P. Treatment of critical bone defects using calcium phosphate cement and mesoporous bioactive glass providing spatiotemporal drug delivery. Bioact. Mater. 2023, 28, 402–419. [Google Scholar] [CrossRef]
- Ren, X.X.; Chen, X.; Geng, Z.J.; Su, J.C. Bone-targeted biomaterials: Strategies and applications. Chem. Eng. J. 2022, 446, 137133. [Google Scholar] [CrossRef]
- Tang, G.K.; Liu, Z.Q.; Liu, Y.; Yu, J.M.; Wang, X.; Tan, Z.H.; Ye, X.J. Recent trends in the development of bone regenerative biomaterials. Front. Cell Dev. Biol. 2021, 9, 665813. [Google Scholar] [CrossRef]
- Armiento, A.R.; Hatt, L.P.; Rosenberg, G.S.; Thompson, K.; Stoddart, M.J. Functional biomaterials for bone regeneration: A lesson in complex biology. Adv. Funct. Mater. 2020, 30, 1909874. [Google Scholar] [CrossRef]
- Yu, Y.; Yu, T.T.; Wang, X.; Liu, D.W. Functional hydrogels and their applications in craniomaxillofacial bone regeneration. Pharmaceutics 2023, 15, 150. [Google Scholar] [CrossRef]
- Huang, S.M.; Chen, W.W.; Wu, C.C.; Liu, S.M.; Ko, C.L.; Chen, J.C.; Shih, C.J. Synergistic effect of drug/antibiotic-impregnated micro/nanohybrid mesoporous bioactive glass/calcium phosphate composite bone cement on antibacterial and osteoconductive activities. Biomater. Adv. 2023, 152, 213524. [Google Scholar] [CrossRef]
- Shang, F.Q.; Yu, Y.; Liu, S.Y.; Ming, L.G.; Zhang, Y.J.; Zhou, Z.F.; Zhao, J.Y.; Jin, Y. Advancing application of mesenchymal stem cell-based bone tissue regeneration. Bioact. Mater. 2021, 6, 666–683. [Google Scholar] [CrossRef]
- Wang, X.; Meng, F.H.; Lei, Z.Y.; Fan, D.Y.; Lou, B. Editorial: Bone targeting nanoparticle drug delivery system in bone metabolism and bone-related tumor diseases. Front. Pharmacol. 2022, 13, 1016631. [Google Scholar] [CrossRef]
- Seliktar, D. Designing cell-compatible hydrogels for biomedical applications. Science 2012, 336, 1124–1128. [Google Scholar] [CrossRef]
- Chen, Y.R.; Yan, X.; Yuan, F.Z.; Lin, L.; Wang, S.J.; Ye, J.; Zhang, J.Y.; Yang, M.; Wu, D.C.; Wang, X.; et al. KGN-conjugated double-network hydrogel combined with stem cells transplantation and tracing for cartilage repair. Adv. Sci. 2022, 9, 2105571. [Google Scholar] [CrossRef]
- Hwang, H.S.; Lee, C.S. Recent progress in hyaluronic-acid-based hydrogels for bone tissue engineering. Gels 2023, 9, 588. [Google Scholar] [CrossRef]
- Dou, X.Y.; Wang, H.F.; Yang, F.; Shen, H.; Wang, X.; Wu, D.C. One-step soaking strategy toward anti-swelling hydrogels with a stiff “armor”. Adv. Sci. 2023, 10, 2206242. [Google Scholar] [CrossRef] [PubMed]
- Dou, X.Y.; Cao, Q.C.; Sun, F.F.; Wang, Y.Q.; Wang, H.F.; Shen, H.; Yang, F.; Wang, X.; Wu, D.C. Synergistic control of dual cross-linking strategy toward tailor-made hydrogels. Sci. China Chem. 2020, 63, 1793–1798. [Google Scholar] [CrossRef]
- Yang, Y.Y.; Zhou, M.H.; Peng, J.B.; Wang, X.; Liu, Y.; Wang, W.J.; Wu, D.C. Robust, anti-freezing and conductive bonding of chitosan-based double-network hydrogels for stable-performance flexible electronic. Carbohyd. Polym. 2022, 276, 118753. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.Y.; Wang, X.; Yang, F.; Wang, L.N.; Wu, D.C. Highly elastic and ultratough hybrid ionic-covalent hydrogels with tunable structures and mechanics. Adv. Mater. 2018, 30, 1707071. [Google Scholar] [CrossRef]
- Wang, H.F.; Wang, X.; Wu, D.C. Recent advances of natural polysaccharide-based double network hydrogels for tissue repair. Chem-Asian J. 2022, 17, e202200659. [Google Scholar] [CrossRef]
- Liu, Z.Y.; Liu, J.H.; Cui, X.; Wang, X.; Zhang, L.C.; Wu, D.C. Recent advances on magnetic sensitive hydrogels in tissue engineering. Front. Chem. 2020, 8, 124. [Google Scholar] [CrossRef]
- Wang, X.; Wang, Y.Q.; Wu, D.C. Facile fabrication of hyperbranched polyacetal quaternary ammonium with pH-responsive curcumin release for synergistic antibacterial activity. Chin. J. Polym. Sci. 2023, 41, 564–573. [Google Scholar] [CrossRef]
- Wang, X.; Gao, P.Y.; Wang, J.; Yang, Y.Y.; You, Y.Z.; Wu, D.C. A robust strategy for precise fabrication of rigid-flexible coupling dendrimers toward self-coordinated hierarchical assembly. CCS Chem. 2020, 2, 1093–1194. [Google Scholar] [CrossRef]
- Fan, L.F.; Hou, C.L.; Wang, X.; Hou, C.Y.; Yan, L.T. Tunable multiple morphological transformation of supramolecular hyperbranched polymers based on an A2B6-type POSS monomer. Chin. J. Polym. Sci. 2021, 39, 1562–1571. [Google Scholar] [CrossRef]
- Wang, X.; Yang, Y.Y.; Fan, L.F.; Yang, F.; Wu, D.C. POSS-embedded supramolecular hyperbranched polymers constructed from a 1→7 branching monomer with controllable morphology transitions. Sci. China Chem. 2018, 61, 311–318. [Google Scholar] [CrossRef]
- Moncal, K.K.; Yeo, M.J.; Celik, N.; Acri, T.M.; Rizk, E.; Wee, H.; Lewis, G.S.; Salem, A.K.; Ozbolat, I.T. Comparison of in-situ versus ex-situ delivery of polyethylenimine-BMP-2 polyplexes for rat calvarial defect repair via intraoperative bioprinting. Biofabrication 2023, 15, 015011. [Google Scholar] [CrossRef] [PubMed]
- Zhu, T.J.; Wang, H.F.; Jing, Z.H.; Fan, D.Y.; Liu, Z.Z.; Wang, X.; Tian, Y. High efficacy of tetra-PEG hydrogel sealants for sutureless dural closure. Bioact. Mater. 2022, 8, 12–19. [Google Scholar] [CrossRef] [PubMed]
- Das, S.; Subuddhi, U. Controlled delivery of ibuprofen from poly(vinyl alcohol)-poly(ethylene glycol) interpenetrating polymeric network hydrogels. J. Pharm. Anal. 2019, 9, 108–116. [Google Scholar] [CrossRef]
- Wang, X.Y.; Fang, X.; Gao, X.; Wang, H.; Li, S.H.; Li, C.; Qing, Y.N.; Qin, Y.G. Strong adhesive and drug-loaded hydrogels for enhancing bone–implant interface fixation and anti-infection properties. Colloids Surf. B 2022, 219, 112817. [Google Scholar] [CrossRef]
- Guo, H.; Fang, X.; Zhang, L.; Sun, J.Q. Facile fabrication of room-temperature self-healing, mechanically robust, highly stretchable, and tough polymers using dual dynamic cross-linked polymer complexes. ACS Appl. Mater. Interfaces 2019, 11, 33356–33363. [Google Scholar] [CrossRef]
- Granel, H.; Bossard, C.; Nucke, L.; Wauquier, F.; Rochefort, G.Y.; Guicheux, J.; Jallot, E.; Lao, J.; Wittrant, Y. Optimized bioactive glass: The quest for the bony graft. Adv. Healthc. Mater. 2019, 8, 1801542. [Google Scholar] [CrossRef]
- Zhang, K.; Zhou, Y.; Xiao, C.; Zhao, W.L.; Wu, H.F.; Tang, J.Q.; Li, Z.T.; Yu, S.; Li, X.F.; Min, L.; et al. Application of hydroxyapatite nanoparticles in tumor-associated bone segmental defect. Sci. Adv. 2019, 5, eaax6946. [Google Scholar] [CrossRef]
- Bai, X.; Lü, S.Y.; Liu, H.D.; Cao, Z.; Ning, P.; Wang, Z.Q.; Gao, C.M.; Ni, B.L.; Ma, D.Y.; Liu, M.Z. Polysaccharides based injectable hydrogel compositing bio-glass for cranial bone repair. Carbohyd. Polym. 2017, 175, 557–564. [Google Scholar] [CrossRef]
- Chang, S.; Wang, J.D.; Xu, N.F.; Wang, S.B.; Cai, H.; Liu, Z.Z.; Wang, X. Facile construction of hybrid hydrogels with high strength and biocompatibility for cranial bone regeneration. Gels 2022, 8, 745. [Google Scholar] [CrossRef] [PubMed]
- Tang, J.C.; Xi, K.; Chen, H.; Wang, L.J.; Li, D.Y.; Xu, Y.; Xin, T.W.; Wu, L.; Zhou, Y.D.; Bian, J.; et al. Flexible osteogenic glue as an all-in-one solution to assist fracture fixation and healing. Adv. Funct. Mater. 2021, 31, 2102465. [Google Scholar] [CrossRef]
- Atala, A.; Bauer, S.B.; Soker, S.; Yoo, J.J.; Retik, A.B. Tissue-engineered autologous bladders for patients needing cystoplasty. Lancet 2006, 367, 1241. [Google Scholar] [CrossRef] [PubMed]
- Fan, H.; Wang, J.; Gong, J.P. Barnacle cement proteinsinspired tough hydrogels with robust, long-lasting, and repeatable underwater adhesion. Adv. Funct. Mater. 2021, 31, 2009334. [Google Scholar] [CrossRef]
- Wang, L.; Zhang, X.; Yang, K.; Fu, Y.V.; Xu, T.; Li, S.; Zhang, D.; Wang, L.N.; Lee, C.S. A novel double-crosslinking-doublenetwork design for injectable hydrogels with enhanced tissue adhesion and antibacterial capability for wound treatment. Adv. Funct. Mater. 2020, 30, 1904156. [Google Scholar] [CrossRef]
Gene | Forward Primers (5′–3′) | Reverse Primers (5′–3′) |
---|---|---|
GAPDH | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA |
RUNX2 | AGTGACTGGGAAACCAGATGCTGA | GCTCTTGGCAAATCTGGCGTGTAA |
ALP | CCAACTCTTTTGTGCCAGAGA | GGCTACATTGGTGTTGAGCTTTT |
OCN | CTGACCTCACAGATCCCAAGC | TGGTCTGATAGCTCGTCACAAG |
Osterix | ATGGCGTCCTCTCTGCTTG | TGAAAGGTCAGCGTATGGCTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, L.; Hou, Q.; Yan, M.; Gao, W.; Tang, G.; Liu, Z. Flexible Fabrication and Hybridization of Bioactive Hydrogels with Robust Osteogenic Potency. Pharmaceutics 2023, 15, 2384. https://doi.org/10.3390/pharmaceutics15102384
Zhu L, Hou Q, Yan M, Gao W, Tang G, Liu Z. Flexible Fabrication and Hybridization of Bioactive Hydrogels with Robust Osteogenic Potency. Pharmaceutics. 2023; 15(10):2384. https://doi.org/10.3390/pharmaceutics15102384
Chicago/Turabian StyleZhu, Liang, Qian Hou, Meijun Yan, Wentao Gao, Guoke Tang, and Zhiqing Liu. 2023. "Flexible Fabrication and Hybridization of Bioactive Hydrogels with Robust Osteogenic Potency" Pharmaceutics 15, no. 10: 2384. https://doi.org/10.3390/pharmaceutics15102384