Collagenase-Responsive Hydrogel Loaded with GSK2606414 Nanoparticles for Periodontitis Treatment through Inhibiting Inflammation-Induced Expression of PERK of Periodontal Ligament Stem Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Synthesis of PDLLA-PEG-PDLLA
2.3. Preparation and Characterization of NanoGSK
2.4. Preparation and Characterization of HA-AC
2.5. Gelation and In Vitro Degradation of the HM Hydrogel
2.6. Drug Loading and Drug Release of the HM Hydrogel
2.7. In Vitro Uptake Experiment
2.8. In Vitro Cytotoxicity
2.9. Cell Proliferation Experiment
2.10. In Vitro Osteogenic Capacity
2.11. Periodontal Tissue Regeneration In Situ
2.12. Statistical Analysis
3. Results and Discussion
3.1. Preparation and Characterization of NanoGSK
3.2. Preparation and Characterization of Drug-Loaded Hydrogel
3.3. In Vitro Cellular Uptake and Cell Cytotoxicity of NGHM
3.4. In Vitro Expression of Osteogenic Markers and Mineralized Nodule Formation of NGHM
3.5. The Hydrogel Delivery System Decreased Inflammation and Promoted Periodontal Bone Tissue Regeneration In Vivo
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Tonetti, M.S.; Greenwell, H.; Kornman, K.S. Staging and grading of periodontitis: Framework and proposal of a new classification and case definition. J. Clin. Periodontol. 2018, 45, S149–S161. [Google Scholar] [CrossRef] [PubMed]
- Abusleme, L.; Dupuy, A.K.; Dutzan, N.; Silva, N.; Burleson, J.A.; Strausbaugh, L.D.; Gamonal, J.; Diaz, P.I. The subgingival microbiome in health and periodontitis and its relationship with community biomass and inflammation. Isme J. 2013, 7, 1016–1025. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, O.; Sibuyi, N.R.S.; Fadaka, A.O.; Madiehe, M.A.; Maboza, E.; Meyer, M.; Geerts, G. Plant Extract-Synthesized Silver Nanoparticles for Application in Dental Therapy. Pharmaceutics 2022, 14, 380. [Google Scholar] [CrossRef] [PubMed]
- Chapple, I.L.; Genco, R.; Working Group 2 of the Joint EFP/AAP Workshop. Diabetes and periodontal diseases: Consensus report of the Joint EFP/AAP Workshop on Periodontitis and Systemic Diseases. J. Periodontol. 2013, 84, S106–S112. [Google Scholar] [CrossRef] [PubMed]
- Engebretson, S.P.; Hyman, L.G.; Michalowicz, B.S.; Schoenfeld, E.R.; Gelato, M.C.; Hou, W.; Seaquist, E.R.; Reddy, M.S.; Lewis, C.E.; Oates, T.W.; et al. The Effect of Nonsurgical Periodontal Therapy on Hemoglobin A1c Levels in Persons With Type 2 Diabetes and Chronic Periodontitis: A Randomized Clinical Trial. JAMA 2013, 310, 2523–2532. [Google Scholar] [CrossRef] [PubMed]
- Al-hebshi, N.N.; Shuga-Aldin, H.M.; Al-Sharabi, A.K.; Ghandour, I. Subgingival periodontal pathogens associated with chronic periodontitis in Yemenis. BMC Oral Health 2014, 14, 13. [Google Scholar] [CrossRef] [PubMed]
- Anna, P.C.P.S.C.A.; Nathalia, C.F.F.; Lucianne, C.M.; Rafael, R.L. Is there an Association Between Periodontitis and Atherosclerosis in Adults? A Systematic Review. Curr. Vasc. Pharmacol. 2018, 16, 569–582. [Google Scholar] [CrossRef]
- Jagust, W.J.; Landau, S.M.; Alzheimer’s Disease Neuroimaging Initiative. Temporal Dynamics of beta-Amyloid Accumulation in Aging and Alzheimer Disease. Neurology 2021, 96, E1347–E1357. [Google Scholar] [CrossRef]
- Sallum, E.A.; Ribeiro, F.V.; Ruiz, K.S.; Sallum, A.W. Experimental and clinical studies on regenerative periodontal therapy. Periodontology 2000 2019, 79, 22–55. [Google Scholar] [CrossRef]
- Sculean, A.; Nikolidakis, D.; Nikou, G.; Ivanovic, A.; Chapple, I.L.C.; Stavropoulos, A. Biomaterials for promoting periodontal regeneration in human intrabony defects: A systematic review. Periodontology 2000 2015, 68, 182–216. [Google Scholar] [CrossRef]
- Wei, X.; Guo, S.; Liu, Q.; Liu, L.; Huo, F.; Wu, Y.; Tian, W. Dental Follicle Stem Cells Promote Periodontal Regeneration through Periostin-Mediated Macrophage Infiltration and Reprogramming in an Inflammatory Microenvironment. Int. J. Mol. Sci. 2023, 24, 6353. [Google Scholar] [CrossRef] [PubMed]
- Hu, L.; Liu, Y.; Wang, S. Stem cell-based tooth and periodontal regeneration. Oral Dis. 2018, 24, 696–705. [Google Scholar] [CrossRef] [PubMed]
- Hiramatsu, N.; Chiang, K.; Aivati, C.; Rodvold, J.J.; Lee, J.-M.; Han, J.; Chea, L.; Zanetti, M.; Koo, E.H.; Lin, J.H. PERK-mediated induction of microRNA-483 disrupts cellular ATP homeostasis during the unfolded protein response. J. Biol. Chem. 2020, 295, 237–249. [Google Scholar] [CrossRef] [PubMed]
- Ranjitha, H.B.; Ammanathan, V.; Guleria, N.; Hosamani, M.; Sreenivasa, B.P.; Dhanesh, V.V.; Santhoshkumar, R.; Sagar, B.K.C.; Mishra, B.P.; Singh, R.K.; et al. Foot-and-mouth disease virus induces PERK-mediated autophagy to suppress the antiviral interferon response. J. Cell Sci. 2021, 134, jcs240622. [Google Scholar] [CrossRef] [PubMed]
- Read, A.; Schroeder, M. The Unfolded Protein Response: An Overview. Biol. Basel 2021, 10, 384. [Google Scholar] [CrossRef] [PubMed]
- Xue, P.; Li, B.; An, Y.; Sun, J.; He, X.; Hou, R.; Dong, G.; Fei, D.; Jin, F.; Wang, Q.; et al. Decreased MORF leads to prolonged endoplasmic reticulum stress in periodontitis-associated chronic inflammation. Cell Death Differ. 2016, 23, 1862–1872. [Google Scholar] [CrossRef] [PubMed]
- Moreno, J.A.; Halliday, M.; Molloy, C.; Radford, H.; Verity, N.; Axten, J.M.; Ortori, C.A.; Willis, A.E.; Fischer, P.M.; Barrett, D.A.; et al. Oral treatment targeting the unfolded protein response prevents neurodegeneration and clinical disease in prion-infected mice. Sci. Transl. Med. 2013, 5, 206ra138. [Google Scholar] [CrossRef] [PubMed]
- Krishnamoorthy, J.; Rajesh, K.; Mirzajani, F.; Kesoglidou, P.; Papadakis, A.I.; Koromilas, A.E. Evidence for eIF2α phosphorylation-independent effects of GSK2656157, a novel catalytic inhibitor of PERK with clinical implications. Cell Cycle 2014, 13, 801–806. [Google Scholar] [CrossRef]
- Axten, J.M.; Romeril, S.P.; Shu, A.; Ralph, J.; Medina, J.R.; Feng, Y.; Li, W.H.; Grant, S.W.; Heerding, D.A.; Minthorn, E.; et al. Discovery of GSK2656157: An Optimized PERK Inhibitor Selected for Preclinical Development. ACS Med. Chem. Lett. 2013, 4, 964–968. [Google Scholar] [CrossRef]
- Tiwari, G.; Tiwari, R.; Sriwastawa, B.; Bhati, L.; Pandey, S.; Pandey, P.; Bannerjee, S.K. Drug delivery systems: An updated review. Int. J. Pharm. Investig. 2012, 2, 2–11. [Google Scholar] [CrossRef]
- Tibbitt, M.W.; Dahlman, J.E.; Langer, R. Emerging Frontiers in Drug Delivery. J. Am. Chem. Soc. 2016, 138, 704–717. [Google Scholar] [CrossRef] [PubMed]
- Ghezzi, M.; Pescina, S.; Padula, C.; Santi, P.; Del Favero, E.; Cantù, L.; Nicoli, S. Polymeric micelles in drug delivery: An insight of the techniques for their characterization and assessment in biorelevant conditions. J. Control. Release 2021, 332, 312–336. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Xue, P.; Tong, M.; Chen, R.; Yang, W.; ZhuGe, D.; Yuan, J.; Yao, Q.; Zhao, Y.; Xu, H. Injected laquinimod D-α-tocopheryl polyethylene glycol-1000 succinate polymeric micelles for the treatment of inflammatory bowel disease. Colloids Surf. B Biointerfaces 2020, 185, 110575. [Google Scholar] [CrossRef] [PubMed]
- Lavrador, P.; Esteves, M.R.; Gaspar, V.M.; Mano, J.F. Stimuli-Responsive Nanocomposite Hydrogels for Biomedical Applications. Adv. Funct. Mater. 2020, 31, 2005941. [Google Scholar] [CrossRef]
- Sharifzadeh, G.; Hosseinkhani, H. Biomolecule-Responsive Hydrogels in Medicine. Adv. Health Mater. 2017, 6, 1700801. [Google Scholar] [CrossRef] [PubMed]
- Quintero-Fabian, S.; Arreola, R.; Becerril-Villanueva, E.; Cesar Torres-Romero, J.; Arana-Argaez, V.; Lara-Riegos, J.; Alberto Ramirez-Camacho, M.; Elizbeth Alvarez-Sanchez, M. Role of Matrix Metalloproteinases in Angiogenesis and Cancer. Front. Oncol. 2019, 9, 1370. [Google Scholar] [CrossRef] [PubMed]
- Kimura, N.; Aikawa, M.; Etou, K.; Aso, Y.; Matsubara, E. Association between Matrix Metalloproteinases, Their Tissue Inhibitor and White Matter Lesions in Mild Cognitive Impairment. Curr. Alzheimer Res. 2020, 17, 547–555. [Google Scholar] [CrossRef]
- Lee, M.K. Liposomes for Enhanced Bioavailability of Water-Insoluble Drugs: In Vivo Evidence and Recent Approaches. Pharmaceutics 2020, 12, 264. [Google Scholar] [CrossRef]
- Cvjetinovic, D.; Prijovic, Z.; Jankovic, D.; Radovic, M.; Mirkovic, M.; Milanovic, Z.; Mojovic, M.; Skalamera, D.; Vranjes-Duric, S. Bioevaluation of glucose-modified liposomes as a potential drug delivery system for cancer treatment using 177-Lu radiotracking. J. Control. Release 2021, 332, 301–311. [Google Scholar] [CrossRef]
- Yu, L.; Li, C.; Le, Y.; Chen, J.-F.; Zou, H. Stabilized amorphous glibenclamide nanoparticles by high-gravity technique. Mater. Chem. Phys. 2011, 130, 361–366. [Google Scholar] [CrossRef]
- Zhang, Z.-B.; Xie, M.-L.; Kuang, Y.-Y.; Wang, J.-X.; Le, Y.; Zeng, X.-F.; Chen, J.-F. Preparation of amorphous drug nanoparticles by high-gravity reactive precipitation technique. Chem. Eng. Process. Process Intensif. 2016, 104, 253–261. [Google Scholar] [CrossRef]
- Almoshari, Y.; Ren, R.; Zhang, H.; Jia, Z.; Wei, X.; Chen, N.; Li, G.; Ryu, S.; Lele, S.M.; Reinhardt, R.A.; et al. GSK3 inhibitor-loaded osteotropic Pluronic hydrogel effectively mitigates periodontal tissue damage associated with experimental periodontitis. Biomaterials 2020, 261, 120293. [Google Scholar] [CrossRef] [PubMed]
- He, X.T.; Li, X.; Xia, Y.; Yin, Y.; Wu, R.X.; Sun, H.H.; Chen, F.M. Building capacity for macrophage modulation and stem cell recruitment in high-stiffness hydrogels for complex periodontal regeneration: Experimental studies in vitro and in rats. Acta Biomater. 2019, 88, 162–180. [Google Scholar] [CrossRef]
- Soory, M. A role for non-antimicrobial actions of tetracyclines in combating oxidative stress in periodontal and metabolic diseases: A literature review. Open Dent. J. 2008, 2, 5–12. [Google Scholar] [CrossRef]
- Ren, B.; Chen, X.; Du, S.; Ma, Y.; Chen, H.; Yuan, G.; Li, J.; Xiong, D.; Tan, H.; Ling, Z.; et al. Injectable polysaccharide hydrogel embedded with hydroxyapatite and calcium carbonate for drug delivery and bone tissue engineering. Int. J. Biol. Macromol. 2018, 118, 1257–1266. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Wang, Y.N.; Ma, B.; Shao, J.; Liu, H.; Ge, S. Gingipain-Responsive Thermosensitive Hydrogel Loaded with SDF-1 Facilitates In Situ Periodontal Tissue Regeneration. ACS Appl. Mater. Interfaces 2021, 13, 36880–36893. [Google Scholar] [CrossRef] [PubMed]
- Qureshi, D.; Nayak, S.K.; Maji, S.; Anis, A.; Kim, D.; Pal, K. Environment sensitive hydrogels for drug delivery applications. Eur. Polym. J. 2019, 120, 109220. [Google Scholar] [CrossRef]
Gene | Prime Sequence (5′~3′) (F: Forward, R: Reverse) |
---|---|
Runx2 | F: CCACCACTCACTACCACACCTAC R: CCTCACACTCCTCGCCCTATTG |
OCN | F: CCTCACACTCCTCGCCCTATTG R: TCAGCCAACTCGTCACAGTCC |
GAPDH | F: GAGAAGGCTGGGGCTCATTT R: AGTGATGGCATGGACTGTGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, Y.; Liu, J.; Xue, P.; Zhang, J. Collagenase-Responsive Hydrogel Loaded with GSK2606414 Nanoparticles for Periodontitis Treatment through Inhibiting Inflammation-Induced Expression of PERK of Periodontal Ligament Stem Cells. Pharmaceutics 2023, 15, 2503. https://doi.org/10.3390/pharmaceutics15102503
Zhou Y, Liu J, Xue P, Zhang J. Collagenase-Responsive Hydrogel Loaded with GSK2606414 Nanoparticles for Periodontitis Treatment through Inhibiting Inflammation-Induced Expression of PERK of Periodontal Ligament Stem Cells. Pharmaceutics. 2023; 15(10):2503. https://doi.org/10.3390/pharmaceutics15102503
Chicago/Turabian StyleZhou, Yuchen, Jie Liu, Peng Xue, and Jianjun Zhang. 2023. "Collagenase-Responsive Hydrogel Loaded with GSK2606414 Nanoparticles for Periodontitis Treatment through Inhibiting Inflammation-Induced Expression of PERK of Periodontal Ligament Stem Cells" Pharmaceutics 15, no. 10: 2503. https://doi.org/10.3390/pharmaceutics15102503