Next Article in Journal
Appointment-Based CEO Connectedness and Employee Compensation: Empirical Evidence from China
Previous Article in Journal
A New Distribution for Modeling Data with Increasing Hazard Rate: A Case of COVID-19 Pandemic and Vinyl Chloride Data
Previous Article in Special Issue
Assessment of Eight Faba Bean (Vicia faba L.) Cultivars for Drought Stress Tolerance through Molecular, Morphological, and Physiochemical Parameters
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Sustainability
Volume 15
Issue 17
10.3390/su151712783
sustainability-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Assessment of Gus Expression Induced by Anti-Sense OsPPO Gene Promoter and Antioxidant Enzymatic Assays in Response to Drought and Heavy Metal Stress in Transgenic Arabidopsis thaliana

by
Zakir Ullah
1,
Javed Iqbal
2,*,
Banzeer Ahsan Abbasi
3,
Wasim Akhtar
4,
Sobia Kanwal
5,
Iftikhar Ali
6,7,
Wadie Chalgham
8,
Mohamed A. El-Sheikh
9 and
Tariq Mahmood
1,*
1
Department of Plant Sciences, Faculty of Biological Sciences, Quaid-i-Azam University, Islamabad 45320, Pakistan
2
Department of Botany, Bacha Khan University, Charsadda 24420, Pakistan
3
Department of Botany, Rawalpindi Women University, 6th Road, Satellite Town, Rawalpindi 46300, Pakistan
4
Department of Botany, University of Azad Jammu and Kashmir Muzaffarabad, Muzaffarabad 13100, Pakistan
5
Department of Biology and Environmental Sciences, Allama Iqbal Open University, Islamabad 44310, Pakistan
6
Center for Plant Sciences and Biodiversity, University of Swat, Charbagh 19120, Pakistan
7
School of Life Sciences & Center of Novel Biomaterials, The Chinese University of Hong Kong, Hong Kong 999077, China
8
Department of Mechanical and Aerospace Engineering, University of California, Los Angeles, CA 90095, USA
9
Botany and Microbiology Department, College of Science, King Saud University, Riyadh I1451, Saudi Arabia
*
Authors to whom correspondence should be addressed.
Sustainability 2023, 15(17), 12783; https://doi.org/10.3390/su151712783
Submission received: 24 March 2023 / Revised: 26 May 2023 / Accepted: 26 June 2023 / Published: 23 August 2023
(This article belongs to the Special Issue Mitigate Hunger through Enhancing Plant Resistance to Biotic and Abiotic Stresses)
Browse Figures
Review Reports Versions Notes

Abstract

:
Abiotic stresses, including drought and heavy metals, are detrimental to plant growth and development and enormously reduce agricultural yields. Plants may quickly change their transcriptome in response to various stressful conditions. Plants develop many defense mechanisms to respond to various stresses that can be classified into morphological, physiological, and biochemical responses. Polyphenol oxidases (PPOs) are one of the self-protective enzymes found in plants except for Arabidopsis. Currently, drought and heavy metals were applied exogenously to transgenic A. thaliana lines (transformed with Oryza sativa PPO promoter fused to the GUS reporter gene). The current study mainly focused on the systematic pathway by which plants respond to stressors. The aim of this study is to investigate the effect/expression of PPO and antioxidant defense system against abiotic stresses. A. thaliana was treated with different concentrations of polyethylene glycols. At 30% PEG, maximum fold induction (1.9) was seen after 12 h. Overall, various concentrations (5%, 20%, and 30%) induced PPO expression after 6, 12, and 24 h. Moreover, three different concentrations of Cu (50 µM, 100 µM, 200 µM) and Ni (50 µM, 100 µM, 200 µM) for 6, 12, and 24 h were also applied. It was observed that the expression profiling of the OsPPO promoter induced GUS gene expression in response to Cu and Ni treatments. The maximum fold induction (15.03) of GUS was observed in 100 µM of Cu after 24 h. In the case of Ni, maximum fold induction of (7.78) was observed at 100 µM after 24 h. So, both Cu and Ni showed a similar pattern of induction at 100 µM after 24 h. In conclusion, the efficiency of the PPOGUS promoter can be operated to assess the response of plants to various abiotic stimuli.

1. Introduction

Plants are sessile beings; they are subjected to a wide range of stresses, including drought, salinity, UVs, and heavy metal (HM) stresses [1,2]. Worldwide food security is being challenged by fast population growth and abrupt climate change [3]. Abiotic factors (such as drought, heavy metals, salt, etc.) have a significant impact on crop production [1]. Drought, heat, and heavy metal stresses have become the major limiting factors to agricultural growth and, eventually, food security threats due to climatic change [4]. As one of the most important abiotic stresses, drought limits plant growth, development, and productivity. Drought is becoming more common across the world as precipitation levels decline and rainfall patterns shift [5]. Drought is a severe danger to the viability of food production systems around the globe due to rapidly changing climate dynamics [6]. For instance, by 2050, spring-sown crops in southern Europe are predicted to have wide-spread losses in crop output (e.g., legumes −31 to +5.5%, sunflower −11 to +3.5%, and tuber crops) and increases in water requirement (e.g., maize +3 to +5%, potato +7 to +11%) [7]. The effects of drought stress on plant growth and output are significant [8]. The shortage of moisture and lack of water causes the seeds to suffer in arid regions, lowering their germination probability. Early on in water scarcity, plant cells are affected because the root system uses less water, and the leaves lose water through transpiration. Plant growth is influenced by the osmotic and ionic equilibrium [9]. The methods by which plants respond to drought, comprising morphological traits, biochemistry, and molecular regulation, have been thoroughly studied by scientists to adapt to the arid environment [1,2]. Plants are classified into three categories for resisting droughts: drought-avoidant, drought-tolerant, and drought-resistant varieties. To prevent water loss through transpiration, plants typically modify the structure of their roots and stomata, as well as their cellular metabolism, to better absorb water from the soil [10].
Plants primarily use their root systems to detect water level changes, and the root system’s length and surface area affect how well soil water may be absorbed. Severe scarcity reduces food production significantly by interfering with plant development, physiology, and reproduction [11,12]. The intensity of the drought’s effects is typically unexpected. It is influenced by a variety of factors, including rainfall patterns, soil holding capacity, and water losses through evapotranspiration. Drought disturbs growth, nutrient and water interactions, photosynthesis, and assimilation partitioning, resulting in a considerable drop in agricultural production [13]. Plant responses to drought stress vary by species and rely on the plant development stage and other environmental conditions [14]. Due to inadequate soil moisture, the key yield-producing elements are reduced. Similarly, absorption of photosynthetically active components, radiation use efficiency, and harvest index retard [15]. Plants adjust their growth patterns and physiological processes in response to the severe impacts of drought stress [16]. Drought stress could, at the cellular level, induce an excessive formation of reactive oxygen species (ROS), which affect cell homeostasis, resulting in oxidative stress and damage to plants in ways that primarily manifest as a decline in photosynthetic efficiency, peroxidation-related cell damage, and cell membrane stability [17]. Enzymatic antioxidants could scavenge ROS, decrease crop damage, and increase stress tolerance. Some common enzymatic antioxidants consist of peroxidase (POD), superoxide dismutase (SOD), catalase (CAT), guaiacol peroxidase (GPX), and ascorbate peroxidase (APX) [18].
Plants rely profoundly on soil solutions to obtain nutrients for their growth and developmental cycle. One of the main causes of crop production loss is the current rise in heavy metal (HM) pollution of arable areas [19]. Large-scale exposure to heavy metal contamination puts the viability of agricultural and environmental systems at risk. Due to inefficient irrigation techniques, excessive use of chemical fertilizers, and other synthetic nutrients, crops are frequently exposed to metal poisoning [20]. HMs are considered to hamper a protein’s biological activity by altering its natural shape by binding to it [21]. Like drought, heavy metal ions cause oxidative stress at the cellular level by producing reactive oxygen species (ROS) [22]. They damage DNA and block DNA repair pathways, alter the functional integrity of membranes and nutritional homeostasis, and affect protein function and activity [23]. Plants have a variety of mechanisms for coping with these challenges. Stress-inducible promoters control stress-related genes, which can be detected in transgenic model plants under stress [24]. Stress-inducible promoters play a pivotal role in the traumatic agent response [25]. Plants have been researched for abiotic stress-inducible promoters to better understand stress response mechanisms [26]. These promoters include cis-regulatory regions that bind stress-responsive factors, causing downstream expression to be activated. A phytoene synthase (DcPSY) promoter from carrots was recently discovered to be triggered by ABA and salt [27].
Likewise, polyphenol oxidases found in plants are highly diverse. They are ubiquitous and are copper-containing, nuclear-encoded enzymes [28]. Various potential compounds such as (flavonol, anthocyanin, flavone, iso-flavonoid, hydroxybenzoic acid, and hydroxycinnamic are substrates for PPO [29]. PPOs are essential in plant defense against biotic and abiotic stressors and can suppress the activity of pathogens by quinone product which is the antimicrobial activity of PPO. This quinone produces an oxidative form of oxygen [30]. An important factor of PPO in plants is the production of special metabolites, but this issue is now unexplored but still a vital compound against an external agent [31]. The phenolic content of osmotically stressed rice seedlings was found to be much higher than that of well-watered seedlings. Under osmotic stress, total phenolics were accumulated in larger quantities (93%) in a shoot [32]. The increased amount of phenolics in the shoot, along with decreased PPO activity, was made to withstand osmotic stress [33]. Furthermore, ultraviolet (UV) and salt (oxidative stressors) were found to promote PPO activity in plants [34]. Trigonella foenum-graecum calli grown on a substrate treated with sodium chloride (NaCl) displayed greater PPO activity. Meta QTL (MQTL) analysis identified genomic regions related to ionomic traits in Arabidopsis thaliana. It defines reliable genetic markers for breeding ionomic traits via marker-assisted selection. MQTL also indicates the physiological and genetic relationship between these traits [35]. On the physiology of PPOs, there are still many unanswered concerns. Although it is generally accepted that PPOs contribute to biotic and abiotic stress defense responses, the precise method by which they carry out this function is still up for debate. According to [36], they may act through the direct poisonousness of quinones, lowered bioavailability, and alkylation of cellular proteins to pathogens, drought, and heavy metal stressors [37]. Physical barriers are created by the crosslinking of quinones with proteins or other phenolics, as well as the generation of ROS, which is known to be crucial for defense signaling. Agronomically, four significant genes, namely cryIA105, cryIIIAa, CP4-epsps, and gox, were engineered in sugar beets to withstand biotic stresses, and improved regeneration of sugar beet plantlets was observed. Agrobacterium tumefaciens LBA4404 and GV3101 strains formed using recombinant plasmids were found to be efficient and suggested inserting new genes in sugar beets [38]. The use of the PPO expression system for the development of stress-tolerant plant species, particularly in crops that may experience harsh simultaneous environmental challenges such as drought, salt, and diseases, appears to be a promising tool for the future. Indeed, numerous transgenic plants have proven effective through PPO transformation, offering tolerance to diverse abiotic and biotic stressors. The goal of this study is to investigate the effect/expression of PPO and the antioxidant defense system against abiotic stresses.

2. Materials and Methods

2.1. Construct Preparation

The OsPPO promoter was found in NCBI, amplified by PCR, linked to the β-glucuronidase (GUS) reporter gene, and transformed into A. thaliana in a testing vector of p1391Z by [39,40]. The ligation mixture was electroporated into E. coli DH5 (α) and was confirmed by PCR and subsequently into A. tumefaciens strain (EHA101) [39]. OsPPOGUS were then studied against drought and heavy metal treatments.

2.2. Plant Growth

Transgenic T2 (Homozygous) A. thaliana seeds were sterilized with 70% ethanol and were cultivated on Murashige and Skoog (MS) medium at half strength (1/2) [41]. Seedlings were grown in a growth chamber at 25 °C, 60% humidity, and a 16:8 light cycle for 25 days, and plants were used for stresses of drought and metals (Ni and Cu) applications (Figure 1, Figure 2 and Figure 3).

2.3. Drought

In this case, 25-day-old transgenic T2 plants were treated with drought stress using polyethylene glycol gel (PEG-4000). In each plate, 36 mL of MS medium was solidified with 0.8 percent agar, overlaid by 36 mL MS broth media containing 0, 5, 20, and 30% of PEG. The dissolved PEG yielded −0.05, −0.09, −0.58, and −1.8 megapascals (MPa) water potential. T2 plants were grown on these drought stress media for 6, 12, and 24 h. For drought control, the same T2 transgenic plants were placed on media overlaid by liquid MS without PEG. Control samples remained on medium for 6, 12, and 24 h (Figure 4).

2.4. Heavy Metals

Cu and Ni Treatment

For Cu treatment, plants were sprayed with different concentrations (50 µM, 100 µM, and 200 µM) of copper and then analyzed after 6, 12, and 24 h. Similarly, (Ni) was applied to the second batch of transgenic A. thaliana by spraying with various concentrations of nickel (50 µM, 100 µM, and 200 µM) and then analyzed after 6, 12, and 24 h, respectively, shown in (Figure 4). Experimentation was repeated in triplicates.

2.5. GUS Staining

Gus staining is composed of 50 mM sodium dihydrogen phosphate, 10 mM disodium ethyl dimethyl tetra acetic acid (EDTA), and 0.01 percent Triton X 100 was used to make the GUS buffer (PH 7.0). To make an X-Gluc solution (0.1 M), 10 mg of X-Gluc was dissolved in 0.1 mL of DMSO. For GUS staining procedures, 1 mL of GUS buffer and 5 µL of 0.1 M X-Gluc solution were used. The plants were subjected to stress treatments (drought and heavy metals) before being submerged in GUS solution and incubated at 37 °C for the night. After the plants were discolored with methanol to remove any remaining chlorophyll, the relative GUS expression for each stress treatment was assessed based on the degree of GUS staining.

2.6. Enzymatic Assay

Currently, three activities were performed in each treatment, e.g., catalase (CAT), ascorbate peroxidase (APX), and peroxidase (POD).

2.6.1. Extract Preparations

The leaf tissue of plants was milled to a fine powder in liquid nitrogen with a tissue grinder in an extraction buffer [42]. Fresh tissues of the plants were homogenized in 4 mL of extraction buffer (Table 1). The homogenized mixture was centrifuged at 15,000 rpm for 22 min at 4 °C two times. The filtrate was used as an enzyme extract.

2.6.2. Catalase (CAT)

The activity of CAT was measured according to the [43] method. The absorbance reading was taken every 20 s at 240 nm at a minute interval to observe the trend of activity. Buffer solution pH 7.0 was used as a blank. The reaction mixture was used as a chemical constituent for the assay.

2.6.3. Ascorbate Peroxidase

The activity of APX was measured according to [44]. Absorbance readings were taken every 20 s at 290 nm at 2 min intervals. Buffer solution pH 7.0 was used as a blank. Chemicals for APX are prementioned in (Table 2).

2.6.4. The Reaction Mixture for Peroxidase

An enzyme extract of 50 µL was mixed in the reaction mixture. Solutions of H2SO4 with a concentration of 5 N were prepared by adding 138.8 mL in 1 L of water. The absorbance value was measured at 485 nm (Table 3).

2.7. RNA Isolation and cDNA Synthesis

After treatments, samples from both control and stressed transgenic A. thaliana seedlings were harvested. Next, seedlings were crushed in liquid nitrogen, after which the ground sample was used for the extraction of total RNA. The RNA extraction was carried out manually using the method suggested by Oñate-Sánchez and Vicente-Carbajosa [45]. For quality and quantity confirmation, the Nano-drop technique (Nano-drop 1000 spectrophotometer, Thermo Scientific, Waltham, MA, USA) was used. After quantification, cDNA was synthesized using 1 µg of total RNA (Supplementary File).

2.8. Expression Analysis of OsPPO Promoter via Real-Time PCR (RT-PCR)

In the present study, primers housekeeping (actin) and reporter gene (GUS) was used to perform RT-PCR. For RT-PCR, the required reagent was supplemented in PCR tubes to make the total volume of the reaction mixture 11.16 µL. In an RT-PCR reaction, an increase in the fluorescence of “SYBR green” was seen, which corresponded to an increase in the expression level of GUS and actin genes (Table 4). Actin was used as a standard control for Arabidopsis [46]. This whole scenario is displayed in Figure 5.

2.9. Statistical Analysis

The statistical analysis was carried out using the Statistics software version 10 (StatSoft, Inc., 1999, Analytical Software 2105 Miller Landing Rd, Tallahassee, FL 32312, USA). One-way ANOVA was performed on the data, with various tests used to determine significant differences between means (p ≤ 0.05) (Table 5).

3. Results

3.1. GUS Staining

3.1.1. Expression of OsPPOGUS in Response to PEG

Drought stress was applied to T2 plants while keeping control of T2 plants on basic MS media. Pictures with stains on them showed the relative GUS expression. In control plants, there was no sign of GUS activity. For 5% PEG, the OsPPO promoter’s GUS activity first appeared, and it grew as the amount of drought stress increased. At 20%, it increases, becomes stronger, and stays that way until 30% PEG (Figure 6). Higher PEG concentrations resulted in an increasing pattern for OsPPOGUS activity.

3.1.2. Expression of OsPPOGUS in Response to Heavy Metal Stress

In response to stress from heavy metals (Cu and Ni), PPO displayed essentially the same pattern of induction as was seen in response to drought stress. With higher heavy metal concentrations, GUS expression and intensity increase. It was noted in (Figure 7 and Figure 8) that the control plant showed no pattern of induction. It was observed that the GUS expression increased up to 50 μM and 100 μM of Cu and Ni, then remained constant at 200 M. Therefore, it can be concluded that rising heavy metal concentrations cause the PPO promoter to respond.

3.2. OsPPOGUS Response to Drought Treatment

Drought (PEG 4000) stress was applied to transgenic Arabidopsis T2 lines. Based on RT-PCR results, T2 lines of transgenic Arabidopsis showed an expression level of OsPPOGUS in response to drought treatment. Upon 5% PEG stress, maximum fold induction of 0.09 was observed after 24 h, while after 6 and 12 h, it showed lower fold induction (0.07 and 0.03, respectively). The maximum fold induction (0.43) was observed after 12 h for 20% PEG after 12 h of treatment, and lower induction (0.19- and 0.14-fold) was revealed after 24 and 6 h drought stress. Similarly, for 30% PEG, maximum fold induction (1.9) was seen after 12 h, while reduced fold induction (0.1) was observed after 24 and 6 h of drought stress, respectively. Overall, various concentrations (5%, 20%, and 30%) induced PPO expression after 6, 12, and 24 h are shown in Figure 9.

3.3. Induction of OsPPOGUS in Response to Ni Treatment

Based on RT-PCR results, it was observed that the OsPPOGUS expression level was enhanced in transgenic Arabidopsis in response to heavy metal (Ni) stress. Maximum fold induction (1.197) with 50 μM Ni stress was found after 24 h, while after 12 and 6 h, it showed lower fold induction (1.14 and 0.19), respectively. Similarly, for 200 μM Ni treatment, maximum fold induction was observed (4.33) after 12 h, and a lower fold induction (1.12 and 1.17) was noted in the time intervals of 24 h and 6 h, respectively. Moreover, the maximum fold induction (7.78) for 100 μM Ni stress treatment was found again after 24 h and lower expression was found after 12 h (1.17) and 6 h (1.14). Overall, OsPPO responded to various concentrations (50 μM, 100 μM, and 200 μM) of Ni after their respective time of 6, 12, and 24 h, collectively displayed in Figure 10. In general, it was observed that OsPPOGUS showed the best response to Ni treatment.

3.4. OsPPOGUS Response to Cu Treatment

Copper stress was applied to transgenic Arabidopsis T2 lines. The expression level of reporter gene GUS was analyzed via RT-PCR. Based on RT-PCR results, T2 lines of transgenic Arabidopsis showed an enhanced expression level of OsPPOGUS in response to Cu treatment. For 50 μM Cu, maximum fold induction of 6.61 was observed after 24 h, while after 12 and 6 h, it showed lower fold induction (0.96 and 1.11, respectively). The maximum fold induction (15.03) was observed after 24 h of 100 μM Cu treatment, and lower induction (3.38- and 4.42-fold) was observed after 12 and 6 h of Cu stress, respectively. Similarly, for 200 μM Cu, the maximum fold induction (5.43) was seen after 24 h, while reduced fold induction (1.04 and 0.49) was observed after 12 and 6 h of Cu stress, correspondingly. Overall, results elucidated OsPPO response to various concentrations (50, 100, and 200 μM) of Cu after 6, 12, and 24 h are shown collectively in Figure 11.

3.5. Quantification of ROS and Antioxidant Assay in A. thaliana

Antioxidant enzymes such as SOD, POD, and APX all protect Arabidopsis plants from environmental stress, including drought and heavy metal stress. Specifically, (superoxide dismutase) helps the plant reduce the impact of oxidative stress caused by reactive oxygen species, POD (peroxidase) helps remove hydrogen peroxide, and APX (ascorbate peroxidase) helps reduce levels of hydroperoxides. In the current study, three activities were performed in each treatment, e.g., catalase (CAT), ascorbate peroxidase (APX), and peroxidase (POD) against drought and heavy metal stress. All three enzymes have been found to be upregulated in Arabidopsis plants under drought and heavy metal stress, indicating that they play an important role in protecting the plant from stress (Figure 12A–C, respectively).

4. Discussion

Abiotic stressors are widely acknowledged to be key limiting factors affecting plant growth and development worldwide. Numerous stresses have a negative impact on plant development and agricultural production. As a result, it is important to investigate how plants adapt to various compressions [47,48]. The phenylpropanoid route is most likely the best-researched secondary metabolic pathway in plants. As ubiquitous copper metalloenzymes, PPOs have a significant role in plant growth, development, and stress tolerance [49,50]. This enzyme might function by either direct toxicity of quinones created by its catalytic activity or by cross-linking them with proteins, producing physical barriers to external pressure. The increase in plant resistance is connected to the numerous roles of polyphenols in plants, which are collections of compounds that protect plants from excessive light, such as UV (flavonoids) and visible light (anthocyanins). The role of PPO in plants, response to heavy metals, or abiotic stresses has been demonstrated.
Currently, the level of OsPPO fused with GUS against drought and heavy metal (Cu and Ni) stress in transgenic A. thaliana was investigated. In the case of drought, maximum fold induction (1.9) was observed after 12 h, and minimum (0.07) fold induction was noted after 12 h. In the case of heavy metals, both (Cu and Ni) displayed the maximum fold induction (15.03-fold) and (7.78-fold), respectively, for 100 µM after 24 h. This expression data revealed that PPO is highly functional under these stresses. A study was conducted to examine the effect of triadimefon (TDM) on drought stress in sunflower (Helianthus annuus) plants, and it was found that PPO activity increased when compared to the control [51]. The action of the PPO effect by water stress (drought) has earlier been evidenced in tomatoes [52]. In addition to the foregoing findings, it was shown that R. serbica dried leaves induced some fold greater PPO induction when plants were subjected to near-complete drought conditions [53]. Furthermore, water stress was observed to increase PPO induction in coconut and wheat [54]. Ref. [55] Correlating these findings with OsPPO promoter drought responsiveness is similar to GUS expression of potato PPO in transgenic tomatoes in response to drought, with the maximum extent in adult leaves and abscission zones of the plant to manage drought.
Apart from drought, PPO is being affected by applying heavy metal stress. This observation supports preceding findings of Annona muricata leaves revealed higher induction of PPO against Cu [56]. Present results match seamlessly with that of [57], who confirmed the antioxidative properties of nickel in soybean cell cultures under heavy metal stress. The study in [58] shows the action efficiency and bid of Hydrilla verticillata and may provide a reference for heavy metal phytoremediation and boost the activity of PPO. Abiotic stressors also stimulate cell signaling, which upregulates the phenylpropanoid pathway transcription [59]. The capability of various polyphenol classes to shield the plant from too much light, such as UV (flavonoids) and visible light, as well as their ability to scavenge ROS, are two of the multiple roles of polyphenols in plants that are associated with an increase in plant resistance (anthocyanins). Under abiotic stress, polyphenols may also perform important ecological roles, such as acting as signaling molecules for other plants.

5. Conclusions

Currently, the higher expression of OsPPOGUS in transgenic Arabidopsis in response to drought and heavy metal (Cu and Ni) stress shows the suitability of the plant species. The expression data of OsPPOGUS revealed that PPO has the potential to be expressed under drought and heavy metal (Cu and Ni) stress. PPO enhances the production of phenolic compounds, which trigger ROS in plants and consequently improve plant tolerance to abiotic stress. In the future, a holistic strategy that considers many management choices for dealing with heat and drought stress at the same time might be a win–win situation.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/su151712783/s1, Figure S1: RNA confirmation via gel electrophoresis; Table S1: Reaction components for isolation of RNA; Table S2: Constituents of the reaction mixture for RT-PCR.

Author Contributions

Z.U. designed and conceived the study. Z.U. and J.I. completed the experiments. B.A.A., W.A., S.K. and I.A. analyzed the data. Z.U. and W.C. performed the visualizations and statistical data analysis. Z.U. and J.I. wrote the original draft. Z.U., J.I., B.A.A., W.A., I.A. and M.A.E.-S. reviewed and edited the manuscript. M.A.E.-S. also provided funds. T.M. provided the resources. Z.U. and W.C. made valuable revisions and edited the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by King Saud University, Riyadh, Saudi Arabia, grant number RSP2023R182.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All the raw data of this research can be obtained from the corresponding authors upon reasonable request.

Acknowledgments

The authors would like to extend their sincere appreciation to the Researchers Support Project Number (RSP2023R182), King Saud University, Riyadh, Saudi Arabia.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Guo, Z.; Yuan, X.; Li, L.; Zeng, M.; Yang, J.; Tang, H.; Duan, C. Genome-wide analysis of the ATP-binding cassette (ABC) transporter family in Zea mays L. and its response to heavy metal stresses. Int. J. Mol. Sci. 2022, 23, 2109. [Google Scholar] [CrossRef]
  2. Haider, S.; Raza, A.; Iqbal, J.; Shaukat, M.; Mahmood, T. Analyzing the regulatory role of heat shock transcription factors in plant heat stress tolerance: A brief appraisal. Mol. Biol. Rep. 2022, 49, 5771–5785. [Google Scholar] [CrossRef]
  3. Lesk, C.; Rowhani, P.; Ramankutty, N. Influence of extreme weather disasters on global crop production. Nature 2016, 529, 84–87. [Google Scholar] [CrossRef] [PubMed]
  4. Dos Santos, C.L.; Reis, A.F.D.B.; Mazzafera, P.; Favarin, J.L. Determination of the Water Potential Threshold at Which Rice Growth Is Impacted. Plants 2018, 7, 48. [Google Scholar] [CrossRef]
  5. Lobell, D.B.; Schlenker, W.; Costa-Roberts, J. Climate Trends and Global Crop Production Since 1980. Science 2011, 333, 616–620. [Google Scholar] [CrossRef] [PubMed]
  6. Mosa, K.A.; El-Naggar, M.; Ramamoorthy, K.; Alawadhi, H.; Elnaggar, A.; Wartanian, S.; Ibrahim, E.; Hani, H. Copper Na-noparticles Induced Genotoxicity, Oxidative Stress, and Changes in Superoxide Dismutase (SOD) Gene Expression in Cu-cumber (Cucumis sativus) Plants. Front. Plant Sci. 2018, 9, 872. [Google Scholar] [CrossRef]
  7. Kogan, F.; Guo, W.; Yang, W. Drought and food security prediction from NOAA new generation of operational satellites. Geomat. Nat. Hazards Risk 2019, 10, 651–666. [Google Scholar] [CrossRef]
  8. Skuras, D.; Psaltopoulos, D. A broad overview of the main problems derived from climate change that will affect agricultural production in the Mediterranean area. Build. Resil. Adapt. Clim. Chang. Agric. Sect. 2012, 23, 217. [Google Scholar]
  9. Sperry, J.S.; Hacke, U.; Oren, R.; Comstock, J.P. Water deficits and hydraulic limits to leaf water supply. Plant Cell Environ. 2002, 25, 251–263. [Google Scholar] [CrossRef]
  10. Northup, A.P.; Keitt, T.H.; Farrior, C.E. Cavitation-resistant junipers cease transpiration earlier than cavitation-vulnerable oaks under summer dry conditions. Ecohydrology 2022, 15, e2337. [Google Scholar] [CrossRef]
  11. Chaturvedi, R.; Tripathi, A.; Raghubanshi, A.; Singh, J. Functional traits indicate a continuum of tree drought strategies across a soil water availability gradient in a tropical dry forest. For. Ecol. Manag. 2020, 482, 118740. [Google Scholar] [CrossRef]
  12. Bartlett, M.K.; Detto, M.; Pacala, S.W. Predicting shifts in the functional composition of tropical forests under increased drought and CO2 from trade-offs among plant hydraulic traits. Ecol. Lett. 2018, 22, 67–77. [Google Scholar] [CrossRef] [PubMed]
  13. Zhang, W.; Shen, Y.; Li, Z.; Xie, X.; Gong, E.S.; Tian, J.; Si, X.; Wang, Y.; Gao, N.; Shu, C.; et al. Effects of high hydrostatic pressure and thermal processing on anthocyanin content, polyphenol oxidase and β-glucosidase activities, color, and antioxidant activities of blueberry (Vaccinium spp.) puree. Food Chem. 2020, 342, 128564. [Google Scholar] [CrossRef] [PubMed]
  14. Ullah, Z.; Gul, F.; Iqbal, J.; Abbasi, B.A.; Kanwal, S.; Chalgham, W.; Mahmood, T. Biogenic Synthesis of Multifunctional Silver Oxide Nanoparticles (Ag2ONPs) Using Parieteria alsinaefolia Delile Aqueous Extract and Assessment of Their Di-verse Biological Applications. Microorganisms 2023, 11, 1069. [Google Scholar] [CrossRef] [PubMed]
  15. Fahad, S.; Bajwa, A.A.; Nazir, U.; Anjum, S.A.; Farooq, A.; Zohaib, A.; Sadia, S.; Nasim, W.; Adkins, S.; Saud, S.; et al. Crop Production under Drought and Heat Stress: Plant Responses and Management Options. Front. Plant Sci. 2017, 8, 1147. [Google Scholar] [CrossRef] [PubMed]
  16. Hassan, F.A.S.; Ali, E.F.; Mahfouz, S.A. Comparison between different fertilization sources, irrigation frequency and their combinations on the growth and yield of the coriander plant. Aust. J. Basic Appl. Sci. 2012, 6, 600–615. [Google Scholar]
  17. Kuromori, T.; Fujita, M.; Takahashi, F.; Yamaguchi-Shinozaki, K.; Shinozaki, K. Inter-tissue and inter-organ signaling in drought stress response and phenotyping of drought tolerance. Plant J. 2022, 109, 342–358. [Google Scholar] [CrossRef]
  18. Zahedi, S.M.; Hosseini, M.S.; Hoveizeh, N.F.; Kadkhodaei, S.; Vaculík, M. Comparative morphological, physiological and molecular analyses of drought-stressed strawberry plants affected by SiO2 and SiO2-NPs foliar spray. Sci. Horti-Cult. 2023, 309, 111686. [Google Scholar] [CrossRef]
  19. Hessini, K.; Wasli, H.; Al-Yasi, H.M.; Ali, E.F.; Issa, A.A.; Hassan, F.A.; Siddique, K.H. Graded moisture deficit effect on secondary metabolites, antioxidant, and inhibitory enzyme activities in leaf extracts of Rosa damascena Mill. var. trigentipetala. Horticulturae 2022, 8, 177. [Google Scholar] [CrossRef]
  20. Tighe-Neira, R.; Gonzalez-Villagra, J.; Nunes-Nesi, A.; Inostroza-Blancheteau, C. Impact of nanoparticles and their ionic counterparts derived from heavy metals on the physiology of food crops. Plant Physiol. Biochem. 2022, 172, 14–23. [Google Scholar] [CrossRef]
  21. Elsheery, N.I.; Helaly, M.N.; El-Hoseiny, H.M.; Alam-Eldein, S.M. Zinc Oxide and Silicone Nanoparticles to Improve the Re-sistance Mechanism and Annual Productivity of Salt-Stressed Mango Trees. Agronomy 2020, 10, 558. [Google Scholar] [CrossRef]
  22. Farooq, M.; Wahid, A.; Kobayashi, N.; Fujita, D.; Basra, S.M.A. Plant drought stress: Effects, mechanisms and management. Agron. Sustain. Dev. 2009, 29, 185–212. [Google Scholar] [CrossRef]
  23. Sun, L.; Song, F.; Guo, J.; Zhu, X.; Liu, S.; Liu, F.; Li, X. Nano-ZnO-Induced Drought Tolerance is Associated with Melatonin Synthesis and Metabolism in Maize. Int. J. Mol. Sci. 2020, 21, 782. [Google Scholar] [CrossRef]
  24. Demirevska, K.; Zasheva, D.; Dimitrov, R.; Simova-Stoilova, L.; Stamenova, M.; Feller, U. Drought stress effects on Rubisco in wheat: Changes in the Rubisco large subunit. Acta Physiol. Plant. 2009, 31, 1129–1138. [Google Scholar] [CrossRef]
  25. Semida, W.M.; Abdelkhalik, A.; Mohamed, G.F.; El-Mageed, T.A.A.; El-Mageed, S.A.A.; Rady, M.M.; Ali, E.F. Foliar Application of Zinc Oxide Nanoparticles Promotes Drought Stress Tolerance in Eggplant (Solanum melongena L.). Plants 2021, 10, 421. [Google Scholar] [CrossRef] [PubMed]
  26. Wang, M.; Gao, L.; Dong, S.; Sun, Y.; Shen, Q.; Guo, S. Role of Silicon on Plant–Pathogen Interactions. Front. Plant Sci. 2017, 8, 701. [Google Scholar] [CrossRef]
  27. Choudhury, F.K.; Rivero, R.M.; Blumwald, E.; Mittler, R. Reactive oxygen species, abiotic stress, and stress combination. Plant J. 2017, 90, 856–867. [Google Scholar] [CrossRef]
  28. Abeed, A.H.A.; Salama, F.M. Attenuating Effect of an Extract of Cd-Hyperaccumulator Solanum nigrum on the Growth and Physio-chemical Changes of Datura innoxia under Cd Stress. J. Soil Sci. Plant Nutr. 2022, 22, 4868–4882. [Google Scholar] [CrossRef]
  29. Wei, L.; Zhang, R.; Zhang, M.; Xia, G.; Liu, S. Functional analysis of long non-coding RNAs involved in alkaline stress responses in wheat. J. Exp. Bot. 2022, 73, 5698–5714. [Google Scholar] [CrossRef]
  30. Gong, Y.; Liu, J.Q.; Xu, M.J.; Zhang, C.M.; Gao, J.; Li, C.G.; Xing, K.; Qin, S. Antifungal volatile organic compounds from Strep-tomyces setonii WY228 control black spot disease of sweet potato. Appl. Environ. Microbiol. 2022, 88, e02317-21. [Google Scholar] [CrossRef]
  31. Miao, S.; Li, F.; Han, Y.; Yao, Z.; Xu, Z.; Chen, X.; Liu, J.; Zhang, Y.; Wang, A. Identification of OSCA gene family in Solanum habrochaites and its function analysis under stress. BMC Genom. 2022, 23, 547. [Google Scholar] [CrossRef] [PubMed]
  32. Gozari, M.; Hafezieh, M.; Tamadoni Jahromi, S.; Pourmozaffar, S.; Moradi, Y. Evaluation of inhibitory effect of secondary metabolites of Streptomyces sp. Strain SC 190 on polyphenoloxidase activity to prevent melanosis in Pacific white shrimp (Litopenaeus vannamei). J. Aquat. Ecol. 2020, 10, 22–32. [Google Scholar]
  33. Zhang, J.; Sun, X. Recent advances in polyphenol oxidase-mediated plant stress responses. Phytochemistry 2020, 181, 112588. [Google Scholar] [CrossRef] [PubMed]
  34. Escobar-Bravo, R.; Nederpel, C.; Naranjo, S.; Kim, H.K.; Rodríguez-López, M.J.; Chen, G.; Glauser, G.; Leiss, K.A.; Klinkhamer, P.G. Ultravio-let radiation modulates both constitutive and inducible plant defenses against thrips but is dose and plant genotype de-pendent. J. Pest Sci. 2021, 94, 69–81. [Google Scholar] [CrossRef]
  35. Shariatipour, N.; Heidari, B.; Ravi, S.; Stevanato, P. Genomic analysis of ionome-related QTLs in Arabidopsis thaliana. Sci. Rep. 2021, 11, 19194. [Google Scholar] [CrossRef] [PubMed]
  36. El-Flaah, R.F.; El-Said, R.A.; Nassar, M.A.; Hassan, M.; Abdelaal KA, A. Effect of rhizobium, nano silica and ascorbic acid on morpho-physiological characters and gene expression of POX and PPO in faba bean (Vicia faba L.) Under salinity stress conditions. Fresenius Environ. Bull. 2021, 30, 5751–5764. [Google Scholar]
  37. Alzandi, A.A.; Naguib, D.M. Effect of hydropriming on Trigonella foenum callus growth, biochemical traits and phyto-chemical components under PEG treatment. Plant Cell Tissue Organ Cult. (PCTOC) 2020, 141, 179–190. [Google Scholar] [CrossRef]
  38. Moazami-Goodarzi, K.; Mortazavi, S.; Heidari, B.; Norouzi, P. Optimization of agrobacterium-mediated transformation of sugar beet: Glyphosate and insect pests resistance associated genes. Agron. J. 2020, 112, 4558–4567. [Google Scholar] [CrossRef]
  39. Akhtar, W.; Aziz, E.; Koiwa, H.; Mahmood, T. Characterization of rice polyphenol oxidase promoter in transgenic Arabidopsis thaliana. Turk. J. Bot. 2017, 41, 223–233. [Google Scholar] [CrossRef]
  40. Akhtar, W. Expression Profiling of Reporter Genes Induced by Rice Polyphenol Oxidase Promoter in Transgenic Model Plant. Ph.D. Thesis, Quaid-i-Azam University, Islamabad, Pakistan, 2016. [Google Scholar]
  41. Murashige, T.; Skoog, F. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef]
  42. Jha, Y.; Mohamed, H.I. Plant secondary metabolites as a tool to investigate biotic stress tolerance in plants: A review. Gesunde Pflanz. 2022, 74, 771–790. [Google Scholar] [CrossRef]
  43. Sharma, A.; Shahzad, B.; Rehman, A.; Bhardwaj, R.; Landi, M.; Zheng, B. Response of Phenylpropanoid Pathway and the Role of Polyphenols in Plants under Abiotic Stress. Molecules 2019, 24, 2452. [Google Scholar] [CrossRef] [PubMed]
  44. Zhao, Y.-W.; Wang, C.-K.; Huang, X.-Y.; Hu, D.-G. Anthocyanin stability and degradation in plants. Plant Signal. Behav. 2021, 16, 1987767. [Google Scholar] [CrossRef] [PubMed]
  45. Oñate-Sánchez, L.; Vicente-Carbajosa, J. DNA-free RNA isolation protocols for Arabidopsis thaliana, including seeds and siliques. BMC Res. Notes 2008, 1, 93. [Google Scholar] [CrossRef]
  46. Hakiman, M.; Maziah, M. Non enzymatic and enzymatic antioxidant activities in aqueous extract of different Ficus del-toidea accessions. J. Med. Plants Res. 2009, 3, 120–131. [Google Scholar]
  47. Grilo, L.F.; Martins, J.D.; Cavallaro, C.H.; Nathanielsz, P.W.; Oliveira, P.J.; Pereira, S.P. Development of a 96-well based assay for kinetic determination of catalase enzymatic-activity in biological samples. Toxicol. In Vitro 2020, 69, 104996. [Google Scholar] [CrossRef]
  48. Gomes, M.P.; Kitamura, R.S.A.; Marques, R.Z.; Barbato, M.L.; Zámocký, M. The Role of H2O2-Scavenging Enzymes (Ascorbate Peroxidase and Catalase) in the Tolerance of Lemna minor to Antibiotics: Implications for Phytoremediation. Antioxidants 2022, 11, 151. [Google Scholar] [CrossRef]
  49. Gao, K.; Khan, W.U.; Li, J.; Huang, S.; Yang, X.; Guo, T.; Guo, B.; Wu, R.; An, X. Identification and Validation of Reliable Reference Genes for Gene Expression Studies in Koelreuteria paniculata. Genes 2022, 13, 714. [Google Scholar] [CrossRef] [PubMed]
  50. Hosseinifard, M.; Stefaniak, S.; Javid, M.G.; Soltani, E.; Wojtyla, L.; Garnczarska, M. Contribution of Exogenous Proline to Abiotic Stresses Tolerance in Plants: A Review. Int. J. Mol. Sci. 2022, 23, 5186. [Google Scholar] [CrossRef]
  51. Peng, J.; Dong, B.; Wang, D.; Zhao, Y.; Meng, H.; Zhou, H. Analysis of differential metabolites of sunflower induced by virulent Verticillium dahlia V33 and hypovirulent Gibellulopsis nigrescens Vn-1. J. Phytopathol. 2022, 170, 349–358. [Google Scholar] [CrossRef]
  52. Attia, M.S.; Abdelaziz, A.M.; Al-Askar, A.A.; Arishi, A.A.; Abdelhakim, A.M.; Hashem, A.H. Plant Growth-Promoting Fungi as Biocontrol Tool against Fusarium Wilt Disease of Tomato Plant. J. Fungi 2022, 8, 775. [Google Scholar] [CrossRef]
  53. Vidović, M.; Battisti, I.; Pantelić, A.; Morina, F.; Arrigoni, G.; Masi, A.; Jovanović, S.V. Desiccation Tolerance in Ramonda serbica Panc.: An Integrative Transcriptomic, Proteomic, Metabolite and Photosynthetic Study. Plants 2022, 11, 1199. [Google Scholar] [CrossRef]
  54. Vásquez, C.; Dávila, M.; Méndez, N.; Jiménez, M.A.; Sandoval, M.F.; Alcalá, F.J. Oxidative Enzymes in Coconut cultivars in response to Raoiella indica feeding. Afr. J. Biotechnol. 2016, 15, 1755–1762. [Google Scholar]
  55. Muhammad, F.; Raza, M.A.S.; Iqbal, R.; Zulfiqar, F.; Aslam, M.U.; Yong, J.W.H.; Altaf, M.A.; Zulfiqar, B.; Amin, J.; Ibrahim, M.A. Ameliorating Drought Effects in Wheat Using an Exclusive or Co-Applied Rhizobacteria and ZnO Nanoparticles. Biology 2022, 11, 1564. [Google Scholar] [CrossRef]
  56. Berumen-Varela, G.; Martínez-González, M.E.; Palomino-Hermosillo, Y.A.; Jiménez-Zurita, J.O.; Peña-Sandoval, G.R.; Balois-Morales, R. Expression profile of EXP, Succ-CoA and ALDH genes in soursop (Annona muricata L.) fruits during ripening in response to refrigeration conditions. Indian J. Biotechnol. 2020, 19, 254–262. [Google Scholar]
  57. Kumari, S.; Khanna, R.R.; Nazir, F.; Albaqami, M.; Chhillar, H.; Wahid, I.; Khan, M.I.R. Bio-Synthesized Nanoparticles in Developing Plant Abiotic Stress Resilience: A New Boon for Sustainable Approach. Int. J. Mol. Sci. 2022, 23, 4452. [Google Scholar] [CrossRef] [PubMed]
  58. Einhardt, A.M.; Ferreira, S.; Hawerroth, C.; Valadares, S.V.; Rodrigues, F. Nickel potentiates soybean resistance against infection by Phakopsora pachyrhizi. Plant Pathol. 2020, 69, 849–859. [Google Scholar] [CrossRef]
  59. Zhang, H.; Zhang, L.-L.; Li, J.; Chen, M.; An, R.-D. Comparative study on the bioaccumulation of lead, cadmium and nickel and their toxic effects on the growth and enzyme defence strategies of a heavy metal accumulator, Hydrilla verticillata (L.f.) Royle. Environ. Sci. Pollut. Res. 2020, 27, 9853–9865. [Google Scholar] [CrossRef]
Sustainability 15 12783 g001
Figure 1. Small 4-day-old seedlings of T2 transgenic A. thaliana, grown on MS media.
Figure 1. Small 4-day-old seedlings of T2 transgenic A. thaliana, grown on MS media.
Sustainability 15 12783 g001
Sustainability 15 12783 g002
Figure 2. Seedlings of T2 transgenic A. thaliana, (A) 11-day-old, (B) 20-day-old, and (C) 24-day-old seedlings, were respectively grown on MS media.
Figure 2. Seedlings of T2 transgenic A. thaliana, (A) 11-day-old, (B) 20-day-old, and (C) 24-day-old seedlings, were respectively grown on MS media.
Sustainability 15 12783 g002
Sustainability 15 12783 g003
Figure 3. Flowering in multiple jars of T2 transgenic A. thaliana grown on MS media.
Figure 3. Flowering in multiple jars of T2 transgenic A. thaliana grown on MS media.
Sustainability 15 12783 g003
Sustainability 15 12783 g004
Figure 4. Polyethylene glycol, Cu, and Ni stress treatment at different concentrations (50 μM, 100 μM, and 200 μM) for 6 (A), 12 (B), and 24 (C) h, respectively, on T2 transgenic A. thaliana seedlings.
Figure 4. Polyethylene glycol, Cu, and Ni stress treatment at different concentrations (50 μM, 100 μM, and 200 μM) for 6 (A), 12 (B), and 24 (C) h, respectively, on T2 transgenic A. thaliana seedlings.
Sustainability 15 12783 g004
Sustainability 15 12783 g005
Figure 5. Detailed schematic summary of plant abiotic stresses and gene expression profiling in A. thaliana.
Figure 5. Detailed schematic summary of plant abiotic stresses and gene expression profiling in A. thaliana.
Sustainability 15 12783 g005
Sustainability 15 12783 g006
Figure 6. In response to various PEG concentrations, (A) control, (B) 5%, (C) 20%, and (D) 30% on MS for 24 h, OsPPOGUS expression was found in transgenic A. thaliana T2 plants.
Figure 6. In response to various PEG concentrations, (A) control, (B) 5%, (C) 20%, and (D) 30% on MS for 24 h, OsPPOGUS expression was found in transgenic A. thaliana T2 plants.
Sustainability 15 12783 g006
Sustainability 15 12783 g007
Figure 7. In response to various Cu concentrations, (A) control, (B) 50 μM, (C) 100 μM, and (D) 200 μM on MS for 24 h, OsPPOGUS expression was found in transgenic A. thaliana T2 plants.
Figure 7. In response to various Cu concentrations, (A) control, (B) 50 μM, (C) 100 μM, and (D) 200 μM on MS for 24 h, OsPPOGUS expression was found in transgenic A. thaliana T2 plants.
Sustainability 15 12783 g007
Sustainability 15 12783 g008
Figure 8. In response to various Ni concentrations, (A) control, (B) 50 μM, (C)100 μM, and (D) 200 μM on MS for 24 h, OsPPOGUS expression was found in transgenic A. thaliana T2 plants.
Figure 8. In response to various Ni concentrations, (A) control, (B) 50 μM, (C)100 μM, and (D) 200 μM on MS for 24 h, OsPPOGUS expression was found in transgenic A. thaliana T2 plants.
Sustainability 15 12783 g008
Sustainability 15 12783 g009
Figure 9. RT-PCR study of OsPPOGUS activity with different concentrations of PEG. qRT-PCR was used to detect GUS gene transcript levels in 25-day-old, transformed Arabidopsis plants growing on MS media by spraying various concentrations of PEG (5%, 20%, and 30%) solutions. The data revealed mean ± standard deviation (SD). Various letters (a, b, c, and d) specify significantly different results from ANOVA post hoc Tukey-adjusted comparisons of three independent tests (p ≤ 0.05, n = 3).
Figure 9. RT-PCR study of OsPPOGUS activity with different concentrations of PEG. qRT-PCR was used to detect GUS gene transcript levels in 25-day-old, transformed Arabidopsis plants growing on MS media by spraying various concentrations of PEG (5%, 20%, and 30%) solutions. The data revealed mean ± standard deviation (SD). Various letters (a, b, c, and d) specify significantly different results from ANOVA post hoc Tukey-adjusted comparisons of three independent tests (p ≤ 0.05, n = 3).
Sustainability 15 12783 g009
Sustainability 15 12783 g010
Figure 10. RT-PCR study of OsPPOGUS activity with different concentrations of Ni. qRT-PCR was used to detect GUS gene transcript levels in 25-day-old, transformed Arabidopsis plants growing on MS media by spraying various concentrations of Ni (50, 100, 200 μM) solutions. The data revealed mean ± standard deviation (SD). Different letters (a, b, c, and d) specify significantly different results from ANOVA post hoc Tukey-adjusted comparisons of three independent tests (p ≤ 0.05, n = 3).
Figure 10. RT-PCR study of OsPPOGUS activity with different concentrations of Ni. qRT-PCR was used to detect GUS gene transcript levels in 25-day-old, transformed Arabidopsis plants growing on MS media by spraying various concentrations of Ni (50, 100, 200 μM) solutions. The data revealed mean ± standard deviation (SD). Different letters (a, b, c, and d) specify significantly different results from ANOVA post hoc Tukey-adjusted comparisons of three independent tests (p ≤ 0.05, n = 3).
Sustainability 15 12783 g010
Sustainability 15 12783 g011
Figure 11. The activity of OsPPOGUS through RT-PCR study with different Cu concentrations. Quantitative RT-PCR was used to detect GUS gene transcript levels in 25-day-old, transformed Arabidopsis T2 lines plants growing on MS media by spraying Cu (50, 100, 200 μM) solutions. The data revealed mean ± standard error (SE). Various letters (a, b, c, d, and e) specify significantly different results from ANOVA post hoc Tukey-adjusted comparisons of three independent tests (p ≤ 0.05, n = 3).
Figure 11. The activity of OsPPOGUS through RT-PCR study with different Cu concentrations. Quantitative RT-PCR was used to detect GUS gene transcript levels in 25-day-old, transformed Arabidopsis T2 lines plants growing on MS media by spraying Cu (50, 100, 200 μM) solutions. The data revealed mean ± standard error (SE). Various letters (a, b, c, d, and e) specify significantly different results from ANOVA post hoc Tukey-adjusted comparisons of three independent tests (p ≤ 0.05, n = 3).
Sustainability 15 12783 g011
Sustainability 15 12783 g012
Figure 12. Estimation of antioxidant enzyme assay, e.g., CAT, APX, and POD in transgenic Arabidopsis stressed with different concentrations of PEG (A), Ni (B), and Cu (C) stresses. The data are presented as the mean ± SD. Various letters (a, b, c, d, e, and f) specify significantly different results from ANOVA post hoc Tukey-adjusted comparisons of three independent tests (p < 0.05, n = 3).
Figure 12. Estimation of antioxidant enzyme assay, e.g., CAT, APX, and POD in transgenic Arabidopsis stressed with different concentrations of PEG (A), Ni (B), and Cu (C) stresses. The data are presented as the mean ± SD. Various letters (a, b, c, d, e, and f) specify significantly different results from ANOVA post hoc Tukey-adjusted comparisons of three independent tests (p < 0.05, n = 3).
Sustainability 15 12783 g012
Table 1. Chemicals for extraction buffers.
Table 1. Chemicals for extraction buffers.
Chemical NameConcentrationVolume
Potassium phosphate buffer25 mM (pH 7.8)1.4 mL
EDTA 100 mM0.4 mM16 µL
Ascorbic Acid 200 mM1 mM20 µL
Polyvinyl pyrmildone2%0.08 gm
Water 2.5 mL
Total 4 mL
Table 2. Chemicals for ascorbate peroxidase assay.
Table 2. Chemicals for ascorbate peroxidase assay.
Chemical NameConcentrationVolume
Potassium phosphate buffer25 mM (pH 7.0)357 µL
Ascorbic acid (50 mM)0.25 mM6 µL
EDTA (100 mM)0.1 mM1.5 µL
H2O2 (100 mM)10 mM110 µL
Enzyme extract0.05 mL52 µL
Water 487 µL
Total 1 mL
Table 3. Chemicals for peroxidase assay.
Table 3. Chemicals for peroxidase assay.
Chemical NameConcentrationVolume
Sodium phosphate buffer100 mM (pH 7.8)1.5 mL
Poly phenylenediamine4%1 mL
H2O21%1 mL
Enzyme extract 50 µL
Water 450 µL
H2SO45 N1 mL
Total 5 mL
Table 4. Sequences of actin and GUS primers.
Table 4. Sequences of actin and GUS primers.
PrimerPrimer Sequence
GUS F:5′ CGGCAGAGAAGGTACTGGAA 3′
GUS R:5′ ATATCCAGCCATGCACACTG 3′
Actintac F:5′ GATGAAGATACTCACAGAAAGA 3′
Actintac R:5′ GTGGTTTCATGAATGCCAGCA 3′
Table 5. ANOVA table of OsPPOGUS mediated A. thaliana against abiotic stress.
Table 5. ANOVA table of OsPPOGUS mediated A. thaliana against abiotic stress.
VariableMinimumMaximumMeanStd. DeviationMean Squares of ErrorSignificance
Ni0.1007.7801.6282.2474.9050.46129
Cu0.10015.0303.3234.2856.5020.03743
PEG0.0301.9000.2790.5200.2550.43417
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ullah, Z.; Iqbal, J.; Abbasi, B.A.; Akhtar, W.; Kanwal, S.; Ali, I.; Chalgham, W.; El-Sheikh, M.A.; Mahmood, T. Assessment of Gus Expression Induced by Anti-Sense OsPPO Gene Promoter and Antioxidant Enzymatic Assays in Response to Drought and Heavy Metal Stress in Transgenic Arabidopsis thaliana. Sustainability 2023, 15, 12783. https://doi.org/10.3390/su151712783

AMA Style

Ullah Z, Iqbal J, Abbasi BA, Akhtar W, Kanwal S, Ali I, Chalgham W, El-Sheikh MA, Mahmood T. Assessment of Gus Expression Induced by Anti-Sense OsPPO Gene Promoter and Antioxidant Enzymatic Assays in Response to Drought and Heavy Metal Stress in Transgenic Arabidopsis thaliana. Sustainability. 2023; 15(17):12783. https://doi.org/10.3390/su151712783

Chicago/Turabian Style

Ullah, Zakir, Javed Iqbal, Banzeer Ahsan Abbasi, Wasim Akhtar, Sobia Kanwal, Iftikhar Ali, Wadie Chalgham, Mohamed A. El-Sheikh, and Tariq Mahmood. 2023. "Assessment of Gus Expression Induced by Anti-Sense OsPPO Gene Promoter and Antioxidant Enzymatic Assays in Response to Drought and Heavy Metal Stress in Transgenic Arabidopsis thaliana" Sustainability 15, no. 17: 12783. https://doi.org/10.3390/su151712783

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop