Stachys sieboldii Miq. Root Attenuates Weight Gain and Dyslipidemia in Rats on a High-Fat and High-Cholesterol Diet
Abstract
:1. Introduction
2. Materials and Methods
2.1. Material Preparation
2.2. Animal Experiments and Diets
2.3. Biochemical Analysis of Serum Samples
2.4. Tissue and Fecal Lipid Contents
2.5. Reverse Transcription Polymerase Chain Reaction (RT-PCR)
2.6. Histological Analysis
2.7. Statistical Analysis
3. Results
3.1. SS Consumption Ameliorated HFC-Induced Weight Gain
3.2. Hepatic Function Tests and Fasting Glucose Levels
3.3. Serum Lipid Profiles
3.4. Liver and WAT Lipid Levels
3.5. Fecal Lipid Composition
3.6. Hepatic Lipid Metabolism-Related mRNA Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Centers for Disease Control and Prevention. Prevalence of Obesity and Severe Obesity Among Adults: United States, 2017–2018. Available online: https://www.cdc.gov/nchs/products/databriefs/db360.htm (accessed on 11 June 2020).
- Bays, H.E.; Toth, P.P.; Kris-Etherton, P.M.; Abate, N.; Aronne, L.J.; Brown, W.V.; Gonzalez-Campoy, J.M.; Jones, S.R.; Kumar, R.; La Forge, R.; et al. Obesity, adiposity, and dyslipidemia: A consensus statement from the National Lipid Association. J. Clin. Lipidol. 2013, 7, 304–383. [Google Scholar] [CrossRef] [Green Version]
- Seravalle, G.; Grassi, G. Obesity and hypertension. Pharmacol. Res. 2017, 122, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Grundy, S.M. Obesity, Metabolic Syndrome, and Cardiovascular Disease. J. Clin. Endocrinol. Metab. 2004, 89, 2595–2600. [Google Scholar] [CrossRef] [PubMed]
- Ke, C.; Zhu, X.; Zhang, Y.; Shen, Y. Metabolomic characterization of hypertension and dyslipidemia. Metabolomics 2018, 14, 117. [Google Scholar] [CrossRef]
- Feingold, K.R.; Grunfeld, C. Obesity and Dyslipidemia. In Endotext; Feingold, K.R., Anawalt, B., Boyce, A., Chrousos, G., Dungan, K., Grossman, A., Hershman, J.M., Kaltsas, G., Koch, C., Kopp, P., et al., Eds.; MDText.com, Inc.: South Dartmouth, MA, USA, 2000. [Google Scholar]
- Klop, B.; Castro Cabezas, M. Chylomicrons: A Key Biomarker and Risk Factor for Cardiovascular Disease and for the Understanding of Obesity. Curr. Cardiovasc. Risk Rep. 2012, 6, 27–34. [Google Scholar] [CrossRef]
- Cannon, C.P.; Kumar, A. Treatment of overweight and obesity: Lifestyle, pharmacologic, and surgical options. Clin. Cornerstone 2009, 9, 55–71. [Google Scholar] [CrossRef]
- Narayanaswami, V.; Dwoskin, L.P. Obesity: Current and potential pharmacotherapeutics and targets. Pharmacol. Ther. 2017, 170, 116–147. [Google Scholar] [CrossRef] [Green Version]
- Klop, B.; Elte, J.; Cabezas, M. Dyslipidemia in Obesity: Mechanisms and Potential Targets. Nutrients 2013, 5, 1218–1240. [Google Scholar] [CrossRef] [Green Version]
- Watts, G.F.; Karpe, F. Triglycerides and atherogenic dyslipidaemia: Extending treatment beyond statins in the high-risk cardiovascular patient. Heart 2011, 97, 350–356. [Google Scholar] [CrossRef]
- Ward, N.C.; Watts, G.F.; Eckel, R.H. Statin Toxicity. Circ. Res. 2019, 124, 328–350. [Google Scholar] [CrossRef]
- Adhyaru, B.B.; Jacobson, T.A. Safety and efficacy of statin therapy. Nat. Rev. Cardiol. 2018, 15, 757–769. [Google Scholar] [CrossRef] [PubMed]
- Taylor, B.A.; Thompson, P.D. Statin-Associated Muscle Disease: Advances in Diagnosis and Management. Neurotherapeutics 2018, 15, 1006–1017. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bouitbir, J.; Sanvee, G.M.; Panajatovic, M.V.; Singh, F.; Krähenbühl, S. Mechanisms of statin-associated skeletal muscle-associated symptoms. Pharmacol. Res. 2020, 154, 104201. [Google Scholar] [CrossRef] [PubMed]
- Stancu, C.; Sima, A. Statins: Mechanism of action and effects. J. Cell. Mol. Med. 2001, 5, 378–387. [Google Scholar] [CrossRef]
- Ravichandran, V.; Kim, M.; Han, S.; Cha, Y. Stachys sieboldii Extract Supplementation Attenuates Memory Deficits by Modulating BDNF-CREB and Its Downstream Molecules, in Animal Models of Memory Impairment. Nutrients 2018, 10, 917. [Google Scholar] [CrossRef] [Green Version]
- Feng, K.; Chen, W.; Sun, L.; Liu, J.; Zhao, Y.; Li, L.; Wang, Y.; Zhang, W. Optimization extraction, preliminary characterization and antioxidant activity in vitro of polysaccharides from Stachys sieboldii Miq. tubers. Carbohydr. Polym. 2015, 125, 45–52. [Google Scholar] [CrossRef]
- Abinaya, R.V.; Kim, M.; Lee, S.-J.; Jeong, E.-S.; Cha, Y.-S. Protective effects ofStachys sieboldiiMIQ extract in SK-N-SH cells and its memory ameliorative effect in mice. J. Food Biochem. 2017, 41, e12411. [Google Scholar] [CrossRef]
- Harada, S.; Tsujita, T.; Ono, A.; Miyagi, K.; Mori, T.; Tokuyama, S. Stachys sieboldii (Labiatae, Chorogi) Protects against Learning and Memory Dysfunction Associated with Ischemic Brain Injury. J. Nutr. Sci. Vitaminol. 2015, 61, 167–174. [Google Scholar] [CrossRef] [Green Version]
- Kim, Y.-K.; Son, H.-K.; Lee, J.-J. Nutritional Components and Antioxidant Activities of Various Stachys Sieboldii Miq Parts. Korean J. Community Living Sci. 2017, 28, 203–215. [Google Scholar] [CrossRef]
- Park, Y.-H.; Lee, J.-J.; Son, H.-K.; Kim, B.-H.; Byun, J.; Ha, J.-H. Antiobesity Effects of Extract from Spergularia marina Griseb in Adipocytes and High-Fat Diet-Induced Obese Rats. Nutrients 2020, 12, 336. [Google Scholar] [CrossRef] [Green Version]
- Rosenfeld, L. Lipoprotein analysis. Early methods in the diagnosis of atherosclerosis. Arch. Pathol. Lab. Med. 1989, 113, 1101–1110. [Google Scholar] [PubMed]
- Folch, J.; Lees, M.; Sloane Stanley, G.H. A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar]
- Biggs, H.G.; Erikson, J.M.; Moorehead, W.R. A manual colormetric assay of triglycerides in serum. Clin. Chem. 1975, 21, 437–441. [Google Scholar] [CrossRef] [PubMed]
- Zlatkis, A.; Zak, B. Study of a new cholesterol reagent. Anal. Biochem. 1969, 29, 143–148. [Google Scholar] [CrossRef]
- Son, H.K.; Shin, H.W.; Jang, E.S.; Moon, B.S.; Lee, C.H.; Lee, J.J. Comparison of Antiobesity Effects Between Gochujangs Produced Using Different Koji Products and Tabasco Hot Sauce in Rats Fed a High-Fat Diet. J. Med. Food 2018, 21, 233–243. [Google Scholar] [CrossRef] [PubMed]
- Francisco, V.; Ruiz-Fernández, C.; Pino, J.; Mera, A.; González-Gay, M.A.; Gómez, R.; Lago, F.; Mobasheri, A.; Gualillo, O. Adipokines: Linking metabolic syndrome, the immune system, and arthritic diseases. Biochem. Pharm. 2019, 165, 196–206. [Google Scholar] [CrossRef]
- Xu, H.; Li, X.; Adams, H.; Kubena, K.; Guo, S. Etiology of Metabolic Syndrome and Dietary Intervention. Int. J. Mol. Sci. 2018, 20, 128. [Google Scholar] [CrossRef] [Green Version]
- Feillet-Coudray, C.; Fouret, G.; Vigor, C.; Bonafos, B.; Jover, B.; Blachnio-Zabielska, A.; Rieusset, J.; Casas, F.; Gaillet, S.; Landrier, J.F.; et al. Long-Term Measures of Dyslipidemia, Inflammation, and Oxidative Stress in Rats Fed a High-Fat/High-Fructose Diet. Lipids 2019, 54, 81–97. [Google Scholar] [CrossRef] [Green Version]
- Martin, K.A.; Mani, M.V.; Mani, A. New targets to treat obesity and the metabolic syndrome. Eur. J. Pharm. 2015, 763, 64–74. [Google Scholar] [CrossRef] [Green Version]
- Burgess, E.; Hassmén, P.; Pumpa, K.L. Determinants of adherence to lifestyle intervention in adults with obesity: A systematic review. Clin. Obes. 2017, 7, 123–135. [Google Scholar] [CrossRef]
- Krentz, A.J.; Fujioka, K.; Hompesch, M. Evolution of pharmacological obesity treatments: Focus on adverse side-effect profiles. Diabetes Obes. Metab. 2016, 18, 558–570. [Google Scholar] [CrossRef] [PubMed]
- Van Gaal, L.; Dirinck, E. Pharmacological Approaches in the Treatment and Maintenance of Weight Loss. Diabetes Care 2016, 39, S260–S267. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zodda, D.; Giammona, R.; Schifilliti, S. Treatment Strategy for Dyslipidemia in Cardiovascular Disease Prevention: Focus on Old and New Drugs. Pharmacy 2018, 6, 10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sirtori, C.R. The pharmacology of statins. Pharm. Res. 2014, 88, 3–11. [Google Scholar] [CrossRef] [PubMed]
- Remick, J.; Weintraub, H.; Setton, R.; Offenbacher, J.; Fisher, E.; Schwartzbard, A. Fibrate Therapy. Cardiol. Rev. 2008, 16, 129–141. [Google Scholar] [CrossRef]
- McKenney, J. Niacin for dyslipidemia: Considerations in product selection. Am. J. Health Syst. Pharm. 2003, 60, 995–1005. [Google Scholar] [CrossRef] [PubMed]
- Cho, H.K.; Kim, C.S.; Woo, K.W.; Lee, K.R. A New Triterpene Saponin from the Tubers of Stachys sieboldii. Bull. Korean Chem. Soc. 2014, 35, 1553–1555. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.W.; Wu, W.; Lim, S.Y. Effect of extracts from Stachys sieboldii Miq. on cellular reactive oxygen species and glutathione production and genomic DNA oxidation. Asian Pac. J. Trop. Biomed. 2018, 8, 485. [Google Scholar] [CrossRef]
- Wang, Z.; Nakayama, T. Inflammation, a Link between Obesity and Cardiovascular Disease. Med. Inflamm. 2010, 2010, 1–17. [Google Scholar] [CrossRef] [Green Version]
- Adenan, D.M.; Jaafar, Z.; Jayapalan, J.J.; Abdul Aziz, A. Plasma antioxidants and oxidative stress status in obese women: Correlation with cardiopulmonary response. PeerJ 2020, 8, e9230. [Google Scholar] [CrossRef]
- McMurray, F.; Patten, D.A.; Harper, M.-E. Reactive Oxygen Species and Oxidative Stress in Obesity-Recent Findings and Empirical Approaches. Obesity 2016, 24, 2301–2310. [Google Scholar] [CrossRef] [PubMed]
- Gilgun-Sherki, Y.; Melamed, E.; Offen, D. Oxidative stress induced-neurodegenerative diseases: The need for antioxidants that penetrate the blood brain barrier. Neuropharmacology 2001, 40, 959–975. [Google Scholar] [CrossRef]
- Swallah, M.S.; Sun, H.; Affoh, R.; Fu, H.; Yu, H. Antioxidant Potential Overviews of Secondary Metabolites (Polyphenols) in Fruits. Int. J. Food Sci. 2020, 2020, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Fan, W.; Zhang, M.; Zhang, Q.; Li, L.; Wang, J.; Zhu, L.; Wei, D.; Peng, W.; Wu, C. Antiobesity, Regulation of Lipid Metabolism, and Attenuation of Liver Oxidative Stress Effects of Hydroxy-α-sanshool Isolated from Zanthoxylum bungeanum on High-Fat Diet-Induced Hyperlipidemic Rats. Oxidative Med. Cell. Longev. 2019, 2019, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Gao, M.; Ma, Y.; Liu, D. High-Fat Diet-Induced Adiposity, Adipose Inflammation, Hepatic Steatosis and Hyperinsulinemia in Outbred CD-1 Mice. PLoS ONE 2015, 10, e0119784. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Toita, R.; Kawano, T.; Fujita, S.; Murata, M.; Kang, J.-H. Increased hepatic inflammation in a normal-weight mouse after long-term high-fat diet feeding. J. Toxicol. Pathol. 2017, 31, 43–47. [Google Scholar] [CrossRef] [Green Version]
- Bhattacharjee, A.; Giri, S.; Roy, M.; Chakraborty, A. Correlation of serum lactate dehydrogenase and alkaline phosphatase in different histological grades of head and neck squamous cell carcinoma and premalignant lesions. J. Cancer Res. Ther. 2018, 14, 934–940. [Google Scholar] [CrossRef]
- Wen, J.; Huang, Y.; Lu, Y.; Yuan, H. Associations of non-high-density lipoprotein cholesterol, triglycerides and the total cholesterol/HDL-c ratio with arterial stiffness independent of low-density lipoprotein cholesterol in a Chinese population. Hypertens. Res. 2019, 42, 1223–1230. [Google Scholar] [CrossRef] [Green Version]
- Park, Y.J.; Choe, S.S.; Sohn, J.H.; Kim, J.B. The role of glucose-6-phosphate dehydrogenase in adipose tissue inflammation in obesity. Adipocyte 2017, 6, 147–153. [Google Scholar] [CrossRef] [Green Version]
- Pullinger, C.R.; Eng, C.; Salen, G.; Shefer, S.; Batta, A.K.; Erickson, S.K.; Verhagen, A.; Rivera, C.R.; Mulvihill, S.J.; Malloy, M.J.; et al. Human cholesterol 7α-hydroxylase (CYP7A1) deficiency has a hypercholesterolemic phenotype. J. Clin. Investig. 2002, 110, 109–117. [Google Scholar] [CrossRef]
- Tu, L.; Sun, H.; Tang, M.; Zhao, J.; Zhang, Z.; Sun, X.; He, S. Red raspberry extract (Rubus idaeus L shrub) intake ameliorates hyperlipidemia in HFD-induced mice through PPAR signaling pathway. Food Chem. Toxicol. 2019, 133, 110796. [Google Scholar] [CrossRef] [PubMed]
- Van De Sluis, B.; Wijers, M.; Herz, J. News on the molecular regulation and function of hepatic low-density lipoprotein receptor and LDLR-related protein 1. Curr. Opin. Lipidol. 2017, 28, 241–247. [Google Scholar] [CrossRef] [PubMed]
- Sud, R.K.; Kumar, S. Herbs: Culinary, Medicinal, Aromatic (Secrets and Human Happiness); Scientific Publishers (India): Jodhpur, India, 2004; p. 176. [Google Scholar]
- Venditti, A.; Frezza, C.; Celona, D.; Bianco, A.; Serafini, M.; Cianfaglione, K.; Fiorini, D.; Ferraro, S.; Maggi, F.; Lizzi, A.R.; et al. Polar constituents, protection against reactive oxygen species, and nutritional value of Chinese artichoke (Stachys affinis Bunge). Food Chem. 2017, 221, 473–481. [Google Scholar] [CrossRef] [PubMed]
Groups | RD (1) | HFC (2) | HFC + 3SS | HFC + 5SS | |
---|---|---|---|---|---|
Diet Composition (g) | |||||
Casein | 200 | 200 | 200 | 200 | |
L-cystine | 3 | 3 | 3 | 3 | |
Corn starch | 397.486 | 287.486 | 257.486 | 237.486 | |
Dextrose | 132 | 132 | 132 | 132 | |
Sucrose | 10 | 10 | 10 | 10 | |
Cellulose | 50 | 50 | 50 | 50 | |
Lard | 100 | 100 | 100 | ||
Soybean oil | 70 | 70 | 70 | 70 | |
Cholesterol | 10 | 10 | 10 | ||
Mineral mix (3) | 35 | 35 | 35 | 35 | |
Vitamin mix (4) | 10 | 10 | 10 | 10 | |
Choline chloride | 2.5 | 2.5 | 2.5 | 2.5 | |
tert-Butylhydroquinone | 0.014 | 0.056 | 0.056 | 0.056 | |
Stachys sieboldii Miq. root powder | 0.0 | 0.0 | 30 | 50 | |
Total (g) | 1000.0 | 1000.0 | 1000.0 | 1000.0 | |
Total energy (kcal) | 3999.9 | 4549.9 | 4429.9 | 4349.9 | |
Fat (kcal%) | 15.8 | 35.6 | 36.6 | 37.2 |
Transcript | Forward Primer | Reverse Primer |
---|---|---|
Acc | CAACGCCTTCACACCACCTT | AGCCCATTACTTCATCAAAGATCCT |
Fas | GGAACTGAACGGCATTACTCG | CATGCCGTTATCAACTTGTCC |
G6pdh | GTTTGGCAGCGGCAACTAA | GGCATCACCCTGGTACAACTC |
Cyp7a1 | GCCGTCCAAGAAATCAAGCAGT | TGTGGGCAGCGAGAACAAAGT |
Hmgcr | GTGATTACCCTGAGCTTAGC | TGGGATGTGCTTAGCATTGA |
Ldlr | ATTTTGGAGGATGAGAAGCAG | CAGGGCGGGGAGGTGTGAGAA |
β-actin | GTGGGGCGCCCCAGGCACCAGGGC | CTCCTTAATGTCACGCACGATTTC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, J.K.; Lee, J.-J.; Kim, Y.-K.; Lee, Y.; Ha, J.-H. Stachys sieboldii Miq. Root Attenuates Weight Gain and Dyslipidemia in Rats on a High-Fat and High-Cholesterol Diet. Nutrients 2020, 12, 2063. https://doi.org/10.3390/nu12072063
Lee JK, Lee J-J, Kim Y-K, Lee Y, Ha J-H. Stachys sieboldii Miq. Root Attenuates Weight Gain and Dyslipidemia in Rats on a High-Fat and High-Cholesterol Diet. Nutrients. 2020; 12(7):2063. https://doi.org/10.3390/nu12072063
Chicago/Turabian StyleLee, Jennifer K., Jae-Joon Lee, Yeon-Kyoung Kim, Youngseung Lee, and Jung-Heun Ha. 2020. "Stachys sieboldii Miq. Root Attenuates Weight Gain and Dyslipidemia in Rats on a High-Fat and High-Cholesterol Diet" Nutrients 12, no. 7: 2063. https://doi.org/10.3390/nu12072063