Increased 1,25(OH)2-Vitamin D Concentrations after Energy Restriction Are Associated with Changes in Skeletal Muscle Phenotype
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Diets
2.2. Experimental Design
2.3. Muscle Sampling
2.4. Histological Staining and Image Analysis
2.5. Blood Biochemistry
2.6. RNA Extraction and Real-Time RT-PCR
2.7. Statistics
3. Results
3.1. Energy Intake, Body Weight, Fat Mass, and Muscle Mass
3.2. Muscle Histomorphometry
3.2.1. Fiber-Type Composition
3.2.2. Muscle Fiber Size
3.2.3. Muscle Oxidative Profile
3.3. Studies on Vitamin D and Related Metabolites
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Omodei, D.; Fontana, L. Calorie restriction and prevention of age-associated chronic disease. FEBS Lett. 2011, 585, 1537–1542. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, D.; Goldberg, A.L. SIRT1 Protein, by Blocking the Activities of Transcription Factors FoxO1 and FoxO3, Inhibits Muscle Atrophy and Promotes Muscle Growth. J. Biol. Chem. 2013, 288, 30515–30526. [Google Scholar] [CrossRef] [Green Version]
- Park, B.-S.; Henning, P.C.; Grant, S.C.; Lee, W.J.; Lee, S.-R.; Arjmandi, B.H.; Kim, J.-S. HMB attenuates muscle loss during sustained energy deficit induced by calorie restriction and endurance exercise. Metabolism 2013, 62, 1718–1729. [Google Scholar] [CrossRef] [PubMed]
- Aspnes, L.E.; Lee, C.M.; Weindruch, R.; Chung, S.S.; Roecker, E.B.; Aiken, J.M. Caloric restriction reduces fiber loss and mitochondrial abnormalities in aged rat muscle. FASEB J. 1997, 11, 573–581. [Google Scholar] [CrossRef] [Green Version]
- Hepple, R.T.; Qin, M.; Nakamoto, H.; Goto, S. Caloric restriction optimizes the proteasome pathway with aging in rat plantaris muscle: Implications for sarcopenia. Am. J. Physiol. Integr. Comp. Physiol. 2008, 295, R1231–R1237. [Google Scholar] [CrossRef] [Green Version]
- McKiernan, S.H.; Colman, R.J.; Lopez, M.; Beasley, T.; Aiken, J.M.; Anderson, R.M.; Weindruch, R. Caloric restriction delays aging-induced cellular phenotypes in rhesus monkey skeletal muscle. Exp. Gerontol. 2011, 46, 23–29. [Google Scholar] [CrossRef] [Green Version]
- Phillips, T.; Leeuwenburgh, C. Muscle fiber-specific apoptosis and TNF-α signaling in sarcopenia are attenuated by life-long calorie restriction. FASEB J. 2005, 19, 1–33. [Google Scholar] [CrossRef] [PubMed]
- Stockinger, J.; Maxwell, N.; Shapiro, D.; Decabo, R.; Valdez, G. Caloric Restriction Mimetics Slow Aging of Neuromuscular Synapses and Muscle Fibers. J. Gerontol. Ser. A Boil. Sci. Med. Sci. 2017, 73, 21–28. [Google Scholar] [CrossRef] [Green Version]
- Yoshida, S.; Yamahara, K.; Kume, S.; Koya, D.; Yasuda-Yamahara, M.; Takeda, N.; Osawa, N.; Chin-Kanasaki, M.; Adachi, Y.; Nagao, K.; et al. Role of dietary amino acid balance in diet restriction-mediated lifespan extension, renoprotection, and muscle weakness in aged mice. Aging Cell 2018, 17, e12796. [Google Scholar] [CrossRef]
- Gutiérrez-Casado, E.; Khraiwesh, H.; López-Domínguez, J.A.; Montero-Guisado, J.; López-Lluch, G.; Navas, P.; De Cabo, R.; Ramsey, J.J.; González-Reyes, J.A.; Villalba, J.M. The Impact of Aging, Calorie Restriction and Dietary Fat on Autophagy Markers and Mitochondrial Ultrastructure and Dynamics in Mouse Skeletal Muscle. J. Gerontol. Ser. A Biol. Sci. Med. Sci. 2019, 74, 760–769. [Google Scholar] [CrossRef]
- Chen, Y.; Hagopian, K.; Bibus, D.; Villalba, J.M.; López-Lluch, G.; Navas, P.; Kim, K.; Ramsey, J.J. The Influence of Dietary Lipid Composition on Skeletal Muscle Mitochondria From Mice Following Eight Months of Calorie Restriction. Physiol. Res. 2014, 63, 57–71. [Google Scholar] [CrossRef] [PubMed]
- Martins, V.F.; Tahvilian, S.; Kang, J.H.; Svensson, K.; Hetrick, B.; Chick, W.S.; Schenk, S.; McCurdy, C.E. Calorie Restriction-Induced Increase in Skeletal Muscle Insulin Sensitivity Is Not Prevented by Overexpression of the p55α Subunit of Phosphoinositide 3-Kinase. Front. Physiol. 2018, 9, 789. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Naughton, D.P. Vitamin D in health and disease: Current perspectives. Nutr. J. 2010, 9, 65. [Google Scholar] [CrossRef] [Green Version]
- Arima, K.; Mizukami, S.; Nishimura, T.; Tomita, Y.; Nakashima, H.; Abe, Y.; Aoyagi, K. Epidemiology of the association between serum 25-hydroxyvitamin D levels and musculoskeletal conditions among elderly individuals: A literature review. J. Physiol. Anthr. 2020, 39, 1–6. [Google Scholar] [CrossRef]
- Ceglia, L. Vitamin D and its role in skeletal muscle. Curr. Opin. Clin. Nutr. Metab. Care 2009, 12, 628–633. [Google Scholar] [CrossRef] [Green Version]
- Chiang, C.-M.; Ismaeel, A.; Griffis, R.B.; Weems, S. Effects of Vitamin D Supplementation on Muscle Strength in Athletes. J. Strength Cond. Res. 2017, 31, 566–574. [Google Scholar] [CrossRef]
- Yagüe, M.D.L.P.; Yurrita, L.C.; Cabañas, M.J.C.; Cenzual, M.A.C. Role of Vitamin D in Athletes and Their Performance: Current Concepts and New Trends. Nutrients 2020, 12, 579. [Google Scholar] [CrossRef] [Green Version]
- Holick, M.F. The vitamin D deficiency pandemic: Approaches for diagnosis, treatment and prevention. Rev. Endocr. Metab. Disord. 2017, 18, 153–165. [Google Scholar] [CrossRef]
- Wimalawansa, S.J. Associations of vitamin D with insulin resistance, obesity, type 2 diabetes, and metabolic syndrome. J. Steroid Biochem. Mol. Biol. 2018, 175, 177–189. [Google Scholar] [CrossRef]
- Bruyère, O.; Cavalier, E.; Reginster, J.-Y. Vitamin D and osteosarcopenia. Curr. Opin. Clin. Nutr. Metab. Care 2017, 20, 498–503. [Google Scholar] [CrossRef] [Green Version]
- Chang, W.-T.; Wu, C.-H.; Hsu, L.-W.; Chen, P.-W.; Yu, J.-R.; Chang, C.-S.; Tsai, W.-C.; Liu, P.-Y. Serum vitamin D, intact parathyroid hormone, and Fetuin A concentrations were associated with geriatric sarcopenia and cardiac hypertrophy. Sci. Rep. 2017, 7, 40996. [Google Scholar] [CrossRef] [Green Version]
- Hasegawa, H.; Nagano, N.; Urakawa, I.; Yamazaki, Y.; Iijima, K.; Fujita, T.; Yamashita, T.; Fukumoto, S.; Shimada, T. Direct evidence for a causative role of FGF23 in the abnormal renal phosphate handling and vitamin D metabolism in rats with early-stage chronic kidney disease. Kidney Int. 2010, 78, 975–980. [Google Scholar] [CrossRef] [Green Version]
- Vidal, A.; Rios, R.; Pineda, C.; Lopez, I.; Muñoz-Castañeda, J.R.; Rodriguez, M.; Aguilera-Tejero, E.; Raya, A.I. Direct regulation of fibroblast growth factor 23 by energy intake through mTOR. Sci. Rep. 2020, 10, 1795. [Google Scholar] [CrossRef] [PubMed]
- Acevedo, L.M.; López, I.; Peralta-Ramírez, A.; Pineda, C.; Chamizo, V.E.; Rodríguez, M.; Aguilera-Tejero, E.; Rivero, J.-L.L. High-phosphorus diet maximizes and low-dose calcitriol attenuates skeletal muscle changes in long-term uremic rats. J. Appl. Physiol. 2016, 120, 1059–1069. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rivero, J.-L.L.; Talmadge, R.J.; Edgerton, V.R. Interrelationships of myofibrillar ATPase activity and metabolic properties of myosin heavy chain-based fibre types in rat skeletal muscle. Histochem. Cell Biol. 1999, 111, 277–287. [Google Scholar] [CrossRef] [PubMed]
- Ingram, D.K.; De Cabo, R. Calorie restriction in rodents: Caveats to consider. Ageing Res. Rev. 2017, 39, 15–28. [Google Scholar] [CrossRef]
- Xie, K.; Neff, F.; Markert, A.; Rozman, J.; Aguilar-Pimentel, J.A.; Amarie, O.V.; Becker, L.; Brommage, R.; Garrett, L.; Henzel, K.S.; et al. Every-other-day feeding extends lifespan but fails to delay many symptoms of aging in mice. Nat. Commun. 2017, 8, 1–19. [Google Scholar] [CrossRef] [Green Version]
- Agarwal, E.; Miller, M.W.; Yaxley, A.; Isenring, E. Malnutrition in the elderly: A narrative review. Maturitas 2013, 76, 296–302. [Google Scholar] [CrossRef] [Green Version]
- Prescod, A.L.V.; Halliday, W.C.; Taylor, C.G. Protein deficiency, but not zinc deficiency, reduces recovery of type 1 and type 2 muscle fibre diameters in the gastrocnemius muscle of growing rats. Br. J. Nutr. 2011, 106, 675–682. [Google Scholar] [CrossRef] [Green Version]
- Walrand, S.; Zangarelli, A.; Guillet, C.; Salles, J.; Soulier, K.; Giraudet, C.; Patrac, V.; Boirie, Y. Effect of fast dietary proteins on muscle protein synthesis rate and muscle strength in ad libitum-fed and energy-restricted old rats. Br. J. Nutr. 2011, 106, 1683–1690. [Google Scholar] [CrossRef] [Green Version]
- Chomentowski, P.; Dubé, J.J.; Amati, F.; Stefanovic-Racic, M.; Zhu, S.; Toledo, F.G.; Goodpaster, B.H. Moderate Exercise Attenuates the Loss of Skeletal Muscle Mass That Occurs With Intentional Caloric Restriction-Induced Weight Loss in Older, Overweight to Obese Adults. J. Gerontol. Ser. A Boil. Sci. Med Sci. 2009, 64, 575–580. [Google Scholar] [CrossRef] [Green Version]
- Lu, Y.; Bradley, J.S.; McCoski, S.R.; Gonzalez, J.M.; Ealy, A.D.; Johnson, S.E. Reduced skeletal muscle fiber size following caloric restriction is associated with calpain-mediated proteolysis and attenuation of IGF-1 signaling. Am. J. Physiol. Integr. Comp. Physiol. 2017, 312, R806–R815. [Google Scholar] [CrossRef] [PubMed]
- McKiernan, S.H.; Bua, E.; McGorray, J.; Aiken, J. Early-onset calorie restriction conserves fiber number in aging rat skeletal muscle. FASEB J. 2004, 18, 580–581. [Google Scholar] [CrossRef]
- Hoek, A.M.V.D.; Zondag, G.C.; Verschuren, L.; De Ruiter, C.; Attema, J.; De Wit, E.C.; Schwerk, A.M.; Guigas, B.; Lek, S.; Rietman, A.; et al. A novel nutritional supplement prevents muscle loss and accelerates muscle mass recovery in caloric-restricted mice. Metabolism 2019, 97, 57–67. [Google Scholar] [CrossRef] [Green Version]
- Boldrin, L.; Ross, J.A.; Whitmore, C.; Doreste, B.; Beaver, C.; Eddaoudi, A.; Pearce, D.J.; Morgan, J.E. The effect of calorie restriction on mouse skeletal muscle is sex, strain and time-dependent. Sci. Rep. 2017, 7, 5160. [Google Scholar] [CrossRef] [Green Version]
- Baldwin, K.M.; Haddad, F.; Pandorf, C.E.; Roy, R.R.; Edgerton, V.R. Alterations in muscle mass and contractile phenotype in response to unloading models: Role of transcriptional/pretranslational mechanisms. Front. Physiol. 2013, 4, 284. [Google Scholar] [CrossRef] [Green Version]
- Galusca, B.; Verney, J.; Meugnier, E.; Ling, Y.; Edouard, P.; Feasson, L.; Ravelojaona, M.; Vidal, H.; Estour, B.; Germain, N. Reduced fibre size, capillary supply and mitochondrial activity in constitutional thinness’ skeletal muscle. Acta Physiol. 2018, 224, e13097. [Google Scholar] [CrossRef] [PubMed]
- Hoppeler, H.; Flück, M. Normal mammalian skeletal muscle and its phenotypic plasticity. J. Exp. Biol. 2002, 205, 2143–2152. [Google Scholar]
- Faitg, J.; Leduc-Gaudet, J.-P.; Reynaud, O.; Ferland, G.; Gaudreau, P.; Gouspillou, G. Effects of Aging and Caloric Restriction on Fiber Type Composition, Mitochondrial Morphology and Dynamics in Rat Oxidative and Glycolytic Muscles. Front. Physiol. 2019, 10, 420. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Granic, A.; Sayer, A.A.; Robinson, S.M. Dietary Patterns, Skeletal Muscle Health, and Sarcopenia in Older Adults. Nutrients 2019, 11, 745. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Larsson, L.; Degens, H.; Li, M.; Salviati, L.; Lee, Y.I.; Thompson, W.; Kirkland, J.L.; Sandri, M. Sarcopenia: Aging-Related Loss of Muscle Mass and Function. Physiol. Rev. 2019, 99, 427–511. [Google Scholar] [CrossRef]
- Collino, M.; Mastrocola, R.; Nigro, D.; Chiazza, F.; Aragno, M.; D’Antona, G.; Minetto, M.A. Variability in Myosteatosis and Insulin Resistance Induced by High-Fat Diet in Mouse Skeletal Muscles. BioMed Res. Int. 2014, 2014, 1–10. [Google Scholar] [CrossRef]
- Hearris, M.A.; Hammond, K.M.; Fell, J.M.; Morton, J.P. Regulation of Muscle Glycogen Metabolism during Exercise: Implications for Endurance Performance and Training Adaptations. Nutrients 2018, 10, 298. [Google Scholar] [CrossRef] [Green Version]
- Puthucheary, Z.A.; Astin, R.; McPhail, M.J.W.; Saeed, S.; Pasha, Y.; Bear, D.E.; Constantin, D.; Velloso, C.; Manning, S.; Calvert, L.; et al. Metabolic phenotype of skeletal muscle in early critical illness. Thorax 2018, 73, 926–935. [Google Scholar] [CrossRef]
- Mujika, I.; Rønnestad, B.R.; Martin, D.T. Effects of Increased Muscle Strength and Muscle Mass on Endurance-Cycling Performance. Int. J. Sports Physiol. Perform. 2016, 11, 283–289. [Google Scholar] [CrossRef] [PubMed]
- Pons, V.; Riera, J.; Capó, X.; Martorell, M.; Sureda, A.; Tur, J.A.; Drobnic, F.; Pons, A. Calorie restriction regime enhances physical performance of trained athletes. J. Int. Soc. Sports Nutr. 2018, 15, 12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- St-Jean-Pelletier, F.; Pion, C.H.; Leduc-Gaudet, J.-P.; Sgarioto, N.; Zovilé, I.; Barbat-Artigas, S.; Reynaud, O.; Alkaterji, F.; Lemieux, F.C.; Grenon, A.; et al. The impact of ageing, physical activity, and pre-frailty on skeletal muscle phenotype, mitochondrial content, and intramyocellular lipids in men. J. Cachex Sarcopenia Muscle 2017, 8, 213–228. [Google Scholar] [CrossRef]
- Zierath, J.R.; Hawley, J.A. Skeletal Muscle Fiber Type: Influence on Contractile and Metabolic Properties. PLoS Biol. 2004, 2, e348. [Google Scholar] [CrossRef] [PubMed]
- Dawson-Hughes, B. Vitamin D and muscle function. J. Steroid Biochem. Mol. Biol. 2017, 173, 313–316. [Google Scholar] [CrossRef] [PubMed]
- Książek, A.; Zagrodna, A.; Słowińska-Lisowska, M. Vitamin D, Skeletal Muscle Function and Athletic Performance in Athletes—A Narrative Review. Nutrients 2019, 11, 1800. [Google Scholar] [CrossRef] [Green Version]
- Montenegro, K.R.; Cruzat, V.; Carlessi, R.; Newsholme, P. Mechanisms of vitamin D action in skeletal muscle. Nutr. Res. Rev. 2019, 32, 192–204. [Google Scholar] [CrossRef] [Green Version]
- Garcia, M.; Seelaender, M.; Sotiropoulos, A.; Coletti, D.; Lancha, A.H. Vitamin D, muscle recovery, sarcopenia, cachexia, and muscle atrophy. Nutrients 2019, 60, 66–69. [Google Scholar] [CrossRef] [PubMed]
- Bass, J.J.; Nakhuda, A.; Deane, C.S.; Brook, M.S.; Wilkinson, D.J.; Phillips, B.E.; Philp, A.; Tarum, J.; Kadi, F.; Andersen, D.; et al. Overexpression of the vitamin D receptor (VDR) induces skeletal muscle hypertrophy. Mol. Metab. 2020, 42, 101059. [Google Scholar] [CrossRef] [PubMed]
- Bass, J.J.; Kazi, A.A.; Deane, C.S.; Nakhuda, A.; Ashcroft, S.P.; Brook, M.S.; Wilkinson, D.J.; Phillips, B.E.; Philp, A.; Tarum, J.; et al. The mechanisms of skeletal muscle atrophy in response to transient knockdown of the vitamin D receptor in vivo. J. Physiol. 2021, 599, 963–979. [Google Scholar] [CrossRef] [PubMed]
- Bollen, S.E.; Atherton, P.J. Myogenic, genomic and non-genomic influences of the vitamin D axis in skeletal muscle. Cell Biochem. Funct. 2021, 39, 48–59. [Google Scholar] [CrossRef]
- Raya, A.I.; Rios, R.; Pineda, C.; Rodriguez-Ortiz, M.E.; Diez, E.; Almaden, Y.; Muñoz-Castañeda, J.R.; Rodriguez, M.; Aguilera-Tejero, E.; Lopez, I. Energy-dense diets increase FGF23, lead to phosphorus retention and promote vascular calcifications in rats. Sci. Rep. 2016, 6, 36881. [Google Scholar] [CrossRef] [Green Version]
- Murayama, A.; Takeyama, K.-I.; Kitanaka, S.; Kodera, Y.; Kawaguchi, Y.; Hosoya, T.; Kato, S. Positive and Negative Regulations of the Renal 25-Hydroxyvitamin D3 1α-Hydroxylase Gene by Parathyroid Hormone, Calcitonin, and 1α,25(OH)2D3 in Intact Animals*. Endocrinology 1999, 140, 2224–2231. [Google Scholar] [CrossRef]
- Wortsman, J.; Matsuoka, L.Y.; Chen, T.C.; Lu, Z.; Holick, M.F. Decreased bioavailability of vitamin D in obesity. Am. J. Clin. Nutr. 2000, 72, 690–693. [Google Scholar] [CrossRef] [PubMed]
- Vranić, L.; Mikolašević, I.; Milić, S. Vitamin D Deficiency: Consequence or Cause of Obesity? Medicina 2019, 55, 541. [Google Scholar] [CrossRef] [Green Version]
Control | Energy Restriction | |
---|---|---|
Crude Nutrients (%) | ||
Nitrogen free extractives | 60 | 24.3 |
Crude protein | 20.7 | 17.1 |
Crude fat | 4 | 2 |
Crude fiber | 3.1 | 44 |
Crude ash | 4.3 | 5.5 |
Moisture | 7.9 | 7.1 |
Metabolized Energy (%) | ||
Carbohydrates | 66 | 34 |
Protein | 24 | 52 |
Fat | 10 | 14 |
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
GAPDH | AGGGCTGCCTTCTCTTGTGAC | TGGGTAGAATCATACTGGAACATGTAG |
CYP27b1 | AAGAGTGATGACTACTGGG | ATAGTATCAAATAGCCGGGG |
CYP24a1 | AAGTGTGCCATTTACAACTC | GTTAACACTGTTCCTTTGGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vidal, A.; Rios, R.; Pineda, C.; Lopez, I.; Raya, A.I.; Aguilera-Tejero, E.; Rivero, J.-L.L. Increased 1,25(OH)2-Vitamin D Concentrations after Energy Restriction Are Associated with Changes in Skeletal Muscle Phenotype. Nutrients 2021, 13, 607. https://doi.org/10.3390/nu13020607
Vidal A, Rios R, Pineda C, Lopez I, Raya AI, Aguilera-Tejero E, Rivero J-LL. Increased 1,25(OH)2-Vitamin D Concentrations after Energy Restriction Are Associated with Changes in Skeletal Muscle Phenotype. Nutrients. 2021; 13(2):607. https://doi.org/10.3390/nu13020607
Chicago/Turabian StyleVidal, Angela, Rafael Rios, Carmen Pineda, Ignacio Lopez, Ana I. Raya, Escolastico Aguilera-Tejero, and Jose-Luis L. Rivero. 2021. "Increased 1,25(OH)2-Vitamin D Concentrations after Energy Restriction Are Associated with Changes in Skeletal Muscle Phenotype" Nutrients 13, no. 2: 607. https://doi.org/10.3390/nu13020607
APA StyleVidal, A., Rios, R., Pineda, C., Lopez, I., Raya, A. I., Aguilera-Tejero, E., & Rivero, J.-L. L. (2021). Increased 1,25(OH)2-Vitamin D Concentrations after Energy Restriction Are Associated with Changes in Skeletal Muscle Phenotype. Nutrients, 13(2), 607. https://doi.org/10.3390/nu13020607