Dihydro-Resveratrol Attenuates Oxidative Stress, Adipogenesis and Insulin Resistance in In Vitro Models and High-Fat Diet-Induced Mouse Model via AMPK Activation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Lines and Cell Culture
2.2. Cell Viability Assay
2.3. Protein Extraction and Western Blot Analysis
2.4. Real-Time Quantitative PCR (qPCR)
2.5. Cellular MDA Assay
2.6. Oil Red O Staining
2.7. 3T3-L1 Adipocyte Differentiation
2.8. H2O2-Induced Oxidative Stress HepG2 cells
2.9. Insulin-Resistant HepG2 Cells and C2C12 Cells
2.10. Animal Husbandry and Treatment
2.11. Intraperitoneal Glucose Tolerance Test (IPGTT)
2.12. Histological Examination
2.13. Statistical Analysis
3. Results
3.1. Effect of Dihydro-Resveratrol (DR2) on Lipogenesis and Adipogenesis in 3T3-L1 Adipocyte Differentiation Cell Model
DR2 Reduces Lipogenesis and Adipogenesis via Modulation of AMPK/SIRT1 and p38 Cell Signaling Pathway in 3T3-L1 Cells
3.2. In Vitro Effect of Dihydro-Resveratrol (DR2) on Oxidative Stress HepG2 Cell Model
3.2.1. DR2 Mediates Nrf2-Related Antioxidative Cascade by Activation of AMPK/SIRT1 Signaling Proteins in HepG2 Cells
3.2.2. DR2 Treatment Upregulates the Antioxidant Protein Levels of High-Glucose High-Insulin (HGHI)-Exposed HepG2 Cells to Reduce Oxidative Stress Aggravation via Activation of AMPK Protein
3.2.3. DR2 Treatment Reduces Intracellular Lipid Aggregation in Oleic Acid-Treated HepG2 Cells through Activation of AMPK Proteins
3.3. In Vitro Effect of Dihydro-Resveratrol (DR2) on Insulin Sensitivity in Insulin-Resistant Cell Model
DR2 Treatment Reverses the Reduced AKT Levels of High-Glucose High-Insulin (HGHI)-Treated HepG2 Cells to Ameliorate the Insulin Resistance
3.4. Effect of Dihydro-Resveratrol (DR2) on High-Fat Diet (HFD)-Induced Obesity Mice
3.4.1. DR2 Treatment Reduces Percentage Weight Gain and Reduces Glucose Intolerance in the Model Mice
3.4.2. DR2 Treatment Reduces Adipogenesis and Lipid Aggregation in the Model Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ma, Z.; Li, C.; Qiao, Y.; Lu, C.; Li, J.; Song, W.; Sun, J.; Zhai, X.; Niu, J.; Ren, Q.; et al. Safflower yellow B suppresses HepG2 cell injury induced by oxidative stress through the AKT/Nrf2 pathway. Int. J. Mol. Med. 2016, 37, 603–612. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Manna, P.; Jain, S.K. Obesity, Oxidative Stress, Adipose Tissue Dysfunction, and the Associated Health Risks: Causes and Therapeutic Strategies. Metab. Syndr. Relat. Disord. 2015, 13, 423–444. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jaiswal, N.; Maurya, C.K.; Pandey, J.; Rai, A.K.; Tamrakar, A.K. Fructose-induced ROS generation impairs glucose utilization in L6 skeletal muscle cells. Free Radic. Res. 2015, 49, 1055–1068. [Google Scholar] [CrossRef]
- Arroyave-Ospina, J.C.; Wu, Z.; Geng, Y.; Moshage, H. Role of Oxidative Stress in the Pathogenesis of Non-Alcoholic Fatty Liver Disease: Implications for Prevention and Therapy. Antioxidants 2021, 10, 174. [Google Scholar] [CrossRef]
- Matsuoka, T.; Kajimoto, Y.; Watada, H.; Kaneto, H.; Kishimoto, M.; Umayahara, Y.; Fujitani, Y.; Kamada, T.; Kawamori, R.; Yamasaki, Y. Glycation-dependent, reactive oxygen species-mediated suppression of the insulin gene promoter activity in HIT cells. J. Clin. Investig. 1997, 99, 144–150. [Google Scholar] [CrossRef] [Green Version]
- Rosen, E.D.; Spiegelman, B.M. Molecular Regulation of Adipogenesis. Annu. Rev. Cell Dev. Biol. 2000, 16, 145–171. [Google Scholar] [CrossRef] [PubMed]
- van Dam, A.D.; Boon, M.R.; Berbée, J.F.; Rensen, P.C.; van Harmelen, V. Targeting white, brown and perivascular adipose tissue in atherosclerosis development. Eur. J. Pharmacol. 2017, 816, 82–92. [Google Scholar] [CrossRef]
- Jo, J.; Gavrilova, O.; Pack, S.; Jou, W.; Mullen, S.; Sumner, A.E.; Cushman, S.W.; Periwal, V. Hypertrophy and/or Hyperplasia: Dynamics of Adipose Tissue Growth. PLoS Comput. Biol. 2009, 5, e1000324. [Google Scholar] [CrossRef]
- Zhang, J.; Tang, H.; Deng, R.; Wang, N.; Zhang, Y.; Wang, Y.; Liu, Y.; Li, F.; Wang, X.; Zhou, L. Berberine Suppresses Adipocyte Differentiation via Decreasing CREB Transcriptional Activity. PLoS ONE 2015, 10, e0125667. [Google Scholar] [CrossRef]
- Liu, F.; He, J.; Wang, H.; Zhu, D.; Bi, Y. Adipose Morphology: A Critical Factor in Regulation of Human Metabolic Diseases and Adipose Tissue Dysfunction. Obes. Surg. 2020, 30, 5086–5100. [Google Scholar] [CrossRef]
- Ahmad, B.; Serpell, C.J.; Fong, I.L.; Wong, E.H. Molecular Mechanisms of Adipogenesis: The Anti-adipogenic Role of AMP-Activated Protein Kinase. Front. Mol. Biosci. 2020, 7, 76. [Google Scholar] [CrossRef] [PubMed]
- Chung, Y.C.; Hyun, C.-G. Inhibitory Effects of Pinostilbene on Adipogenesis in 3T3-L1 Adipocytes: A Study of Possible Mechanisms. Int. J. Mol. Sci. 2021, 22, 13446. [Google Scholar] [CrossRef] [PubMed]
- Hu, W.; Li, M.; Sun, W.; Li, Q.; Xi, H.; Qiu, Y.; Wang, R.; Ding, Q.; Wang, Z.; Yu, Y.; et al. Hirsutine ameliorates hepatic and cardiac insulin resistance in high-fat diet-induced diabetic mice and in vitro models. Pharmacol. Res. 2021, 177, 105917. [Google Scholar] [CrossRef] [PubMed]
- Liang, H.; Cheng, R.; Wang, J.; Xie, H.; Li, R.; Shimizu, K.; Zhang, C. Mogrol, an aglycone of mogrosides, attenuates ulcerative colitis by promoting AMPK activation. Phytomedicine 2020, 81, 153427. [Google Scholar] [CrossRef] [PubMed]
- Entezari, M.; Hashemi, D.; Taheriazam, A.; Zabolian, A.; Mohammadi, S.; Fakhri, F.; Hashemi, M.; Hushmandi, K.; Ashrafizadeh, M.; Zarrabi, A.; et al. AMPK signaling in diabetes mellitus, insulin resistance and diabetic complications: A pre-clinical and clinical investigation. Biomed. Pharmacother. 2022, 146, 112563. [Google Scholar] [CrossRef] [PubMed]
- You, Y.; Liu, Y.-L.; Ai, Z.-Y.; Wang, Y.-S.; Liu, J.-M.; Piao, C.-H. Lactobacillus fermentum KP-3-fermented ginseng ameliorates alcohol-induced liver disease in C57BL/6N mice through the AMPK and MAPK pathways. Food Funct. 2020, 11, 9801–9809. [Google Scholar] [CrossRef]
- Guo, S.; Wang, G.; Yang, Z. Ligustilide alleviates the insulin resistance, lipid accumulation, and pathological injury with elevated phosphorylated AMPK level in rats with diabetes mellitus. J. Recept. Signal Transduct. 2020, 41, 85–92. [Google Scholar] [CrossRef]
- Wang, Y.; Rijal, B.; Xu, M.; Li, Z.; An, Y.; Zhang, F.; Lu, C. Renal denervation improves vascular endothelial dysfunction by inducing autophagy via AMPK/mTOR signaling activation in a rat model of type 2 diabetes mellitus with insulin resistance. Acta Diabetol. 2020, 57, 1227–1243. [Google Scholar] [CrossRef]
- Gakh, A.A.; Anisimova, N.Y.; Kiselevsky, M.V.; Sadovnikov, S.V.; Stankov, I.N.; Yudin, M.V.; Rufanov, K.A.; Krasavin, M.Y.; Sosnov, A.V. Dihydro-resveratrol—A potent dietary polyphenol. Bioorg. Med. Chem. Lett. 2010, 20, 6149–6151. [Google Scholar] [CrossRef]
- Li, S.; Eguchi, N.; Lau, H.; Ichii, H. The Role of the Nrf2 Signaling in Obesity and Insulin Resistance. Int. J. Mol. Sci. 2020, 21, 6973. [Google Scholar] [CrossRef]
- Tossetta, G.; Fantone, S.; Marzioni, D.; Mazzucchelli, R. Role of Natural and Synthetic Compounds in Modulating NRF2/KEAP1 Signaling Pathway in Prostate Cancer. Cancers 2023, 15, 3037. [Google Scholar] [CrossRef]
- Ghareghomi, S.; Habibi-Rezaei, M.; Arese, M.; Saso, L.; Moosavi-Movahedi, A.A. Nrf2 Modulation in Breast Cancer. Biomedicines 2022, 10, 2668. [Google Scholar] [CrossRef]
- Xia, Y.; Zhai, X.; Qiu, Y.; Lu, X.; Jiao, Y. The Nrf2 in Obesity: A Friend or Foe? Antioxidants 2022, 11, 2067. [Google Scholar] [CrossRef] [PubMed]
- Fritzemeier, K.-H.; Kindl, H. 9,10-Dihydrophenanthrenes as phytoalexins of Orchidaceae. Biosynthetic studies in vitro and in vivo proving the route from L-phenylalanine to dihydro-m-coumaric acid, dihydrostilbene and dihydrophenanthrenes. Eur. J. Biochem. 1983, 133, 545–550. [Google Scholar] [CrossRef] [PubMed]
- El-Feraly, F.S. Isolation, characterization, and synthesis of 3,5,4′ -trihydrozybibenzyl from Cannabis sativa. J. Nat. Prod. 1984, 47, 89–92. [Google Scholar] [CrossRef]
- Juan, M.E.; Alfaras, I.; Planas, J.M. Determination of dihydroresveratrol in rat plasma by HPLC. J. Agric. Food Chem. 2010, 58, 7472–7475. [Google Scholar] [CrossRef] [PubMed]
- Tsang, S.W.; Guan, Y.-F.; Wang, J.; Bian, Z.-X.; Zhang, H.-J. Inhibition of pancreatic oxidative damage by stilbene derivative dihydro-resveratrol: Implication for treatment of acute pancreatitis. Sci. Rep. 2016, 6, 22859. [Google Scholar] [CrossRef] [Green Version]
- Hassan, W.; Noreen, H.; Rehman, S.; Gul, S.; Amjad Kamal, M.; Paul Kamdem, J.; Zaman, B.; da Rocha, J.B.T. Oxidative Stress and Antioxidant Potential of One Hundred Medicinal Plants. Curr. Top. Med. Chem. 2017, 17, 1336–1370. [Google Scholar] [CrossRef]
- Ayala, A.; Muñoz, M.F.; Argüelles, S. Lipid peroxidation: Production, metabolism, and signaling mechanisms of malondialdehyde and 4-hydroxy-2-nonenal. Oxidative Med. Cell. Longev. 2014, 2014, 360438. [Google Scholar] [CrossRef] [Green Version]
- Xu, W.; Zhao, T.; Xiao, H. The Implication of Oxidative Stress and AMPK-Nrf2 Antioxidative Signaling in Pneumonia Pathogenesis. Front. Endocrinol. 2020, 11, 400. [Google Scholar] [CrossRef]
- Loboda, A.; Damulewicz, M.; Pyza, E.; Jozkowicz, A.; Dulak, J. Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: An evolutionarily conserved mechanism. Cell. Mol. Life Sci. 2016, 73, 3221–3247. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, F.-J.; Long, H.-Z.; Zhou, Z.-W.; Luo, H.-Y.; Xu, S.-G.; Gao, L.-C. System Xc–/GSH/GPX4 axis: An important antioxidant system for the ferroptosis in drug-resistant solid tumor therapy. Front. Pharmacol. 2022, 13, 910292. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.D.; Ilavenil, S.; Karnan, M.; Yang, C.-J.; Kim, D.; Choi, K.C. Novel Bacillus ginsengihumi CMRO6 Inhibits Adipogenesis via p38MAPK/Erk44/42 and Stimulates Glucose Uptake in 3T3-L1 Pre-Adipocytes through Akt/AS160 Signaling. Int. J. Mol. Sci. 2022, 23, 4727. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi, J.; Tanaka, T.; Saito, H.; Nomura, S.; Aburatani, H.; Waki, H.; Kadowaki, T.; Nangaku, M. Echinomycin inhibits adipogenesis in 3T3-L1 cells in a HIF-independent manner. Sci. Rep. 2017, 7, 6516. [Google Scholar] [CrossRef] [Green Version]
- Siersbaek, R.; Nielsen, R.; Mandrup, S. PPARgamma in adipocyte differentiation and metabolism—Novel insights from genome-wide studies. FEBS Lett. 2010, 584, 3242–3249. [Google Scholar] [CrossRef] [Green Version]
- Saben, J.; Thakali, K.M.; Lindsey, F.E.; Zhong, Y.; Badger, T.M.; Andres, A.; Shankar, K. Distinct adipogenic differentiation phenotypes of human umbilical cord mesenchymal cells dependent on adipogenic conditions. Exp. Biol. Med. 2014, 239, 1340–1351. [Google Scholar] [CrossRef] [Green Version]
- Hui, X.; Zhang, M.; Gu, P.; Li, K.; Gao, Y.; Wu, D.; Wang, Y.; Xu, A. Adipocyte SIRT1 controls systemic insulin sensitivity by modulating macrophages in adipose tissue. EMBO Rep. 2017, 18, 645–657. [Google Scholar] [CrossRef] [Green Version]
- Jiang, J.; Yu, S.; Jiang, Z.; Liang, C.; Yu, W.; Li, J.; Du, X.; Wang, H.; Gao, X.; Wang, X. N-acetyl-serotonin protects HepG2 cells from oxidative stress injury induced by hydrogen peroxide. Oxidative Med. Cell. Longev. 2014, 2014, 310504. [Google Scholar] [CrossRef] [Green Version]
- Ahmed-Farid, O.A.; Rizk, H.A.; Shehata, A.M. Hydrogen peroxide modulates redox status, energy metabolism, and gene expression in a dose- and time-dependent manner in rat liver. J. Biochem. Mol. Toxicol. 2018, 32, e22199. [Google Scholar] [CrossRef]
- Zhang, J.; Wang, X.; Vikash, V.; Ye, Q.; Wu, D.; Liu, Y.; Dong, W. ROS and ROS-Mediated Cellular Signaling. Oxidative Med. Cell. Longev. 2016, 2016, 4350965. [Google Scholar] [CrossRef] [Green Version]
- Hurrle, S.; Hsu, W.H. The etiology of oxidative stress in insulin resistance. Biomed. J. 2017, 40, 257–262. [Google Scholar] [CrossRef] [PubMed]
- Abdul-Ghani, M.A.; DeFronzo, R.A. Pathogenesis of insulin resistance in skeletal muscle. J. Biomed. Biotechnol. 2010, 2010, 476279. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yudhani, R.D.; Sari, Y.; Nugrahaningsih, D.A.A.; Sholikhah, E.N.; Rochmanti, M.; Purba, A.K.R.; Khotimah, H.; Nugrahenny, D.; Mustofa, M. In Vitro Insulin Resistance Model: A Recent Update. J. Obes. 2023, 2023, 1964732. [Google Scholar] [CrossRef] [PubMed]
- Nielsen, F.; Mikkelsen, B.B.; Nielsen, J.B.; Andersen, H.R.; Grandjean, P. Plasma malondialdehyde as biomarker for oxidative stress: Reference interval and effects of life-style factors. Clin. Chem. 1997, 43, 1209–1214. [Google Scholar] [CrossRef] [Green Version]
- Wong, C.Y.; Al-Salami, H.; Dass, C.R. C2C12 cell model: Its role in understanding of insulin resistance at the molecular level and pharmaceutical development at the preclinical stage. J. Pharm. Pharmacol. 2020, 72, 1667–1693. [Google Scholar] [CrossRef]
- Kahn, S.E.; Hull, R.L.; Utzschneider, K.M. Mechanisms linking obesity to insulin resistance and type 2 diabetes. Nature 2006, 444, 840–846. [Google Scholar] [CrossRef]
- Kamei, N.; Tobe, K.; Suzuki, R.; Ohsugi, M.; Watanabe, T.; Kubota, N.; Ohtsuka-Kowatari, N.; Kumagai, K.; Sakamoto, K.; Kobayashi, M.; et al. Overexpression of monocyte chemoattractant protein-1 in adipose tissues causes macrophage recruitment and insulin resistance. J. Biol. Chem. 2006, 281, 26602–26614. [Google Scholar] [CrossRef] [Green Version]
- Shimobayashi, M.; Albert, V.; Wölnerhanssen, B.; Frei, I.C.; Weissenberger, D.; Meyer-Gerspach, A.C.; Clement, N.; Moes, S.; Colombi, M.; Meier, J.A.; et al. Insulin resistance causes inflammation in adipose tissue. J. Clin. Investig. 2018, 128, 1538–1550. [Google Scholar] [CrossRef]
- Matschinsky, F.M.; Wilson, D.F. The Central Role of Glucokinase in Glucose Homeostasis: A Perspective 50 Years After Demonstrating the Presence of the Enzyme in Islets of Langerhans. Front. Physiol. 2019, 10, 148. [Google Scholar] [CrossRef] [Green Version]
Protein Name | Dilutions | Product Number, Lot Number and Manufacturer |
---|---|---|
C/EBPα | 1:1000 | 8178, 3, Cell Signaling Technology, Danvers, MA, USA |
PPARγ | 1:1000 | 2443, 4, Cell Signaling Technology, Danvers, MA, USA |
FASN | 1:1000 | 3180, 7, Cell Signaling Technology, Danvers, MA, USA |
Phosphor ACC (Ser79) | 1:1000 | 3661, 10, Cell Signaling Technology, Danvers, MA, USA |
ACCA | 1:1000 | 269273, GR3340965-1, Abcam, Cambridge, UK |
AMPKα1/AMPKα2 | 1:1000 | A17290, 5500004207, Abclonal, Woburn, MA, USA |
Phosphor AMPKα (Thr172) | 1:1000 | 2535, 21, Cell Signaling Technology, Danvers, MA, USA |
Total p38∝β | 1:500 | sc-7972, B2117, Santa Cruz Biotechnology, Dallas, TX, USA |
Phosphor p38∝β | 1:500 | sc-166182, E0117, Santa Cruz Biotechnology, Dallas, TX, USA |
Sirtuin 1 | 1:1000 | ab189494, GR3250046-9, Abcam, Cambridge, UK |
Nrf2 | 1:1000 | ab62352, YI110703CS, Abcam, Cambridge, UK |
HO-1 | 1:1000 | 43966, 2, Cell Signaling Technology, Danvers, MA, USA |
GPX4 | 1:1000 | ab125066, GR3369574-4, Abcam, Cambridge, UK |
Total Akt 1/2/3 antibody | 1:1000 | 44-609G, 2049101, Invitrogen, Waltham, MA, USA |
Phospho Akt 1/2/3 (Ser 473) | 1:1000 | 4060, 19, Cell Signaling Technology, Danvers, MA, USA |
GAPDH | 1:3000 | AHP-1628, 155201, Bio-rad, Hercules, CA, USA |
Gene | Forward and Reserve Primer (5′→3′) | |
---|---|---|
Mouse | Gck | F: CCCTGAGTGGCTTACAGTTCR: ACTGATGTGAGTGTTGAAGC |
Mcp1 | F: AGCCAACTCTCACTGAAGCCR: AGCTTGGTGACAAAAACTACAGC | |
Gapdh | F: CATCACTGCCACCCAGAAGACTGR: ATGCCAGTGAGCTTCCCGTTCAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lam, C.-S.; Xia, Y.-X.; Chen, B.-S.; Du, Y.-X.; Liu, K.-L.; Zhang, H.-J. Dihydro-Resveratrol Attenuates Oxidative Stress, Adipogenesis and Insulin Resistance in In Vitro Models and High-Fat Diet-Induced Mouse Model via AMPK Activation. Nutrients 2023, 15, 3006. https://doi.org/10.3390/nu15133006
Lam C-S, Xia Y-X, Chen B-S, Du Y-X, Liu K-L, Zhang H-J. Dihydro-Resveratrol Attenuates Oxidative Stress, Adipogenesis and Insulin Resistance in In Vitro Models and High-Fat Diet-Induced Mouse Model via AMPK Activation. Nutrients. 2023; 15(13):3006. https://doi.org/10.3390/nu15133006
Chicago/Turabian StyleLam, Chu-Shing, Yi-Xuan Xia, Bai-Sen Chen, Yin-Xiao Du, Kang-Lun Liu, and Hong-Jie Zhang. 2023. "Dihydro-Resveratrol Attenuates Oxidative Stress, Adipogenesis and Insulin Resistance in In Vitro Models and High-Fat Diet-Induced Mouse Model via AMPK Activation" Nutrients 15, no. 13: 3006. https://doi.org/10.3390/nu15133006