Limosilactobacillus reuteri Alleviates Anxiety-like Behavior and Intestinal Symptoms in Two Stressed Mouse Models
Abstract
:1. Introduction
2. Materials and Methods
2.1. Isolation, Identification, Genome-Sequencing, and Analysis of Bacterial Strains
2.2. Phenotypic Characterization of Lm. reuteri Strains
2.3. Animal and Treatment
2.4. Behavioral Test and Visceral Sensitivity Assessment
2.5. Collection of Feces, Blood, and Tissue Samples
2.6. Cytokine Concentration Analysis of the Serum and Histological Evaluation
2.7. Real-Time qPCR Analysis
2.8. Gut Microbiota Analysis
2.9. Statistical Analysis
3. Results
3.1. Genomic Diversity of Lm. reuteri at the Strain Level and Association with Phenotypes
3.2. Growth Rates, Tolerances to Bile Salt and Acidity/Alkalinity, and Production of Short-Chain Fatty Acids
3.3. Chronic Stresses Induce Extensive Behavioral and Physiological Responses and Gut Microbiota Changes in Mice
3.4. Lm. reuteri Alleviates Anxiety-like Behavior and Improves Physiological Indices in Stressed Mice
3.5. Lm. reuteri Functions via the NLRP3 Pathway, Improves Intestinal Mucosal Barrier Function, and Regulates HPA Axis in Chronic Stress-Induced Anxiety Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ataallahi, M.; Nejad, J.G.; Park, K.H. Selection of appropriate biomatrices for studies of chronic stress in animals: A review. J. Anim. Sci. Technol. 2022, 64, 621–639. [Google Scholar] [CrossRef] [PubMed]
- Madison, A.; Kiecolt-Glaser, J.K. Stress, depression, diet, and the gut microbiota: Human-bacteria interactions at the core of psychoneuroimmunology and nutrition. Curr. Opin. Behav. Sci. 2019, 28, 105–110. [Google Scholar] [CrossRef] [PubMed]
- Misiak, B.; Loniewski, I.; Marlicz, W.; Frydecka, D.; Szulc, A.; Rudzki, L.; Samochowiec, J. The HPA axis dysregulation in severe mental illness: Can we shift the blame to gut microbiota? Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2020, 102, 109951. [Google Scholar] [CrossRef] [PubMed]
- Ferrari, S.; Mule, S.; Parini, F.; Galla, R.; Ruga, S.; Rosso, G.; Brovero, A.; Molinari, C.; Uberti, F. The influence of the gut-brain axis on anxiety and depression: A review of the literature on the use of probiotics. J. Tradit. Complement. Med. 2024, 14, 237–255. [Google Scholar] [CrossRef]
- Jianguo, L.; Xueyang, J.; Cui, W.; Changxin, W.; Xuemei, Q. Altered gut metabolome contributes to depression-like behaviors in rats exposed to chronic unpredictable mild stress. Transl. Psychiatry 2019, 9, 40. [Google Scholar] [CrossRef]
- Remes, O.; Brayne, C.; van der Linde, R.; Lafortune, L. A systematic review of reviews on the prevalence of anxiety disorders in adult populations. Brain Behav. 2016, 6, e00497. [Google Scholar] [CrossRef]
- Hong, J.J. Anxiety disorders in Asians and Asian Americans. Asian J. Psychiatr. 2014, 7, 74–76. [Google Scholar] [CrossRef]
- Zuccotti, G.V.; Meneghin, F.; Raimondi, C.; Dilillo, D.; Agostoni, C.; Riva, E.; Giovannini, M. Probiotics in clinical practice: An overview. J. Int. Med. Res. 2008, 36, 1A–53A. [Google Scholar] [CrossRef]
- Bambury, A.; Sandhu, K.; Cryan, J.F.; Dinan, T.G. Finding the needle in the haystack: Systematic identification of psychobiotics. Br. J. Pharmacol. 2018, 175, 4430–4438. [Google Scholar] [CrossRef]
- Wu, H.; Xie, S.; Miao, J.; Li, Y.; Wang, Z.; Wang, M.; Yu, Q. Lactobacillus reuteri maintains intestinal epithelial regeneration and repairs damaged intestinal mucosa. Gut Microbes 2020, 11, 997–1014. [Google Scholar] [CrossRef]
- Mu, Q.; Tavella, V.J.; Luo, X.M. Role of Lactobacillus reuteri in human health and diseases. Front. Microbiol. 2018, 9, 757. [Google Scholar] [CrossRef]
- Santos, F.; Vera, J.L.; Lamosa, P.; de Valdez, G.F.; de Vos, W.M.; Santos, H.; Sesma, F.; Hugenholtz, J. Pseudovitamin B(12) is the corrinoid produced by Lactobacillus reuteri CRL1098 under anaerobic conditions. FEBS Lett. 2007, 581, 4865–4870. [Google Scholar] [CrossRef] [PubMed]
- Jang, H.M.; Lee, K.E.; Kim, D.H. The preventive and curative effects of Lactobacillus reuteri NK33 and Bifidobacterium adolescentis NK98 on immobilization stress-induced anxiety/depression and colitis in mice. Nutrients 2019, 11, 819. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Su, Z.; Chen, Z.; Cao, J.; Liu, X.; Xu, F. Lactobacillus reuteri strain 8008 attenuated the aggravation of depressive-like behavior induced by CUMS in high-fat diet-fed mice through regulating the gut microbiota. Front. Pharmacol. 2023, 14, 1149185. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Zhang, C.; Yu, L.; Tian, F.; Chen, W.; Zhai, Q. Analysis of the key genes of Lactobacillus reuteri strains involved in the protection against alcohol-induced intestinal barrier damage. Food Funct. 2024, 15, 6629–6641. [Google Scholar] [CrossRef]
- Deng, X.; Liang, C.; Zhou, L.; Shang, X.; Hui, X.; Hou, L.; Wang, Y.; Liu, W.; Liang, S.; Yao, L.; et al. Network meta-analysis of probiotics, prebiotics, and synbiotics for the treatment of chronic constipation in adults. Eur. J. Nutr. 2024, 63, 1999–2010. [Google Scholar] [CrossRef]
- Liu, Y.; Zhong, X.; Lin, S.; Xu, H.; Liang, X.; Wang, Y.; Xu, J.; Wang, K.; Guo, X.; Wang, J.; et al. Limosilactobacillus reuteri and caffeoylquinic acid synergistically promote adipose browning and ameliorate obesity-associated disorders. Microbiome 2022, 10, 226. [Google Scholar] [CrossRef]
- Delcher, A.L.; Harmon, D.; Kasif, S.; White, O.; Salzberg, S.L. Improved microbial gene identification with GLIMMER. Nucleic Acids Res. 1999, 27, 4636–4641. [Google Scholar] [CrossRef]
- Page, A.J.; Cummins, C.A.; Hunt, M.; Wong, V.K.; Reuter, S.; Holden, M.T.G.; Fookes, M.; Falush, D.; Keane, J.A.; Parkhill, J. Roary: Rapid large-scale prokaryote pan genome analysis. Bioinformatics 2015, 31, 3691–3693. [Google Scholar] [CrossRef]
- Seemann, T. Prokka: Rapid prokaryotic genome annotation. Bioinformatics 2014, 30, 2068–2069. [Google Scholar] [CrossRef]
- Price, M.N.; Dehal, P.S.; Arkin, A.P. FastTree: Computing large minimum evolution trees with profiles instead of a distance matrix. Mol. Biol. Evol. 2009, 26, 1641–1650. [Google Scholar] [CrossRef]
- Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef]
- Lee, I.; Ouk Kim, Y.; Park, S.-C.; Chun, J. OrthoANI: An improved algorithm and software for calculating average nucleotide identity. Int. J. Syst. Evol. Microbiol. 2016, 66, 1100–1103. [Google Scholar] [CrossRef]
- Lombard, V.; Golaconda Ramulu, H.; Drula, E.; Coutinho, P.M.; Henrissat, B. The carbohydrate-active enzymes database (CAZy) in 2013. Nucleic Acids Res. 2014, 42, D490–D495. [Google Scholar] [CrossRef]
- Alcock, B.P.; Raphenya, A.R.; Lau, T.T.Y.; Tsang, K.K.; Bouchard, M.; Edalatmand, A.; Huynh, W.; Nguyen, A.-L.V.; Cheng, A.A.; Liu, S.; et al. CARD 2020: Antibiotic resistome surveillance with the comprehensive antibiotic resistance database. Nucleic Acids Res. 2019, 48, D517–D525. [Google Scholar] [CrossRef]
- Liu, Y.; Sheng, Y.; Pan, Q.; Xue, Y.; Yu, L.; Tian, F.; Zhao, J.; Zhang, H.; Zhai, Q.; Chen, W. Identification of the key physiological characteristics of Lactobacillus plantarum strains for ulcerative colitis alleviation. Food Funct. 2020, 11, 1279–1291. [Google Scholar] [CrossRef]
- Cao, J.; Yu, L.; Zhao, J.; Zhang, H.; Chen, W.; Xue, Y.; Zhai, Q. Alleviative effects of Bacillus coagulans strains on irritable bowel syndrome-unraveling strain specificity through physiological and genomic analysis. Food Sci. Hum. Well. 2024, 13, 1845–1855. [Google Scholar] [CrossRef]
- Zhang, L.; Ni, X.; Jiang, M.; Du, M.; Zhang, S.; Jiang, H.; Liu, C.; Liu, S. Lacticaseibacillus rhamnosus strains for alleviation of irritable bowel disease and chronic fatigue syndrome. Microorganisms 2024, 12, 1081. [Google Scholar] [CrossRef]
- Kim, J.; Kang, H.; Lee, Y.-B.; Lee, B.; Lee, D. A quantitative analysis of spontaneous alternation behaviors on a Y-maze reveals adverse effects of acute social isolation on spatial working memory. Sci. Rep. 2023, 13, 14722. [Google Scholar] [CrossRef]
- Zhang, N.; Gao, X.; Li, D.; Xu, L.; Zhou, G.; Xu, M.; Peng, L.; Sun, G.; Pan, F.; Li, Y.; et al. Sleep deprivation-induced anxiety-like behaviors are associated with alterations in the gut microbiota and metabolites. Microbiol. Spectr. 2024, 12, e0143723. [Google Scholar] [CrossRef]
- Chen, Q.; Ren, Y.; Lu, J.; Bartlett, M.; Chen, L.; Zhang, Y.; Guo, X.; Liu, C. A novel prebiotic blend product prevents irritable bowel syndrome in mice by improving gut microbiota and modulating immune response. Nutrients 2017, 9, 1341. [Google Scholar] [CrossRef]
- Liu, C.; Du, M.X.; Xie, L.S.; Wang, W.Z.; Chen, B.S.; Yun, C.Y.; Sun, X.W.; Luo, X.; Jiang, Y.; Wang, K.; et al. Gut commensal Christensenella minuta modulates host metabolism via acylated secondary bile acids. Nat. Microbiol. 2024, 9, 434–450. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef]
- Segata, N.; Izard, J.; Waldron, L.; Gevers, D.; Miropolsky, L.; Garrett, W.S.; Huttenhower, C. Metagenomic biomarker discovery and explanation. Genome Biol. 2011, 12, R60. [Google Scholar] [CrossRef]
- Jorgensen, J.H.; Ferraro, M.J. Antimicrobial susceptibility testing: A review of general principles and contemporary practices. Clin. Infect. Dis. 2009, 49, 1749–1755. [Google Scholar] [CrossRef]
- Tabouy, L.; Getselter, D.; Ziv, O.; Karpuj, M.; Tabouy, T.; Lukic, I.; Maayouf, R.; Werbner, N.; Ben-Amram, H.; Nuriel-Ohayon, M.; et al. Dysbiosis of microbiome and probiotic treatment in a genetic model of autism spectrum disorders. Brain Behav. Immun. 2018, 73, 310–319. [Google Scholar] [CrossRef]
- Tenorio-Jimenez, C.; Martinez-Ramirez, M.J.; Del Castillo-Codes, I.; Arraiza-Irigoyen, C.; Tercero-Lozano, M.; Camacho, J.; Chueca, N.; Garcia, F.; Olza, J.; Plaza-Diaz, J.; et al. Lactobacillus reuteri V3401 reduces inflammatory biomarkers and modifies the gastrointestinal microbiome in adults with metabolic syndrome: The PROSIR study. Nutrients 2019, 11, 1761. [Google Scholar] [CrossRef]
- Wu, J.; Lin, Z.; Wang, X.; Zhao, Y.; Zhao, J.; Liu, H.; Johnston, L.J.; Lu, L.; Ma, X. Limosilactobacillus reuteri SLZX19-12 protects the colon from infection by enhancing stability of the gut microbiota and barrier integrity and reducing inflammation. Microbiol. Spectr. 2022, 10, e0212421. [Google Scholar] [CrossRef]
- Mazzone, L.; Dooling, S.W.; Volpe, E.; Uljarevic, M.; Waters, J.L.; Sabatini, A.; Arturi, L.; Abate, R.; Riccioni, A.; Siracusano, M.; et al. Precision microbial intervention improves social behavior but not autism severity: A pilot double-blind randomized placebo-controlled trial. Cell Host Microbe 2024, 32, 106–116. [Google Scholar] [CrossRef]
- Laroute, V.; Tormo, H.; Couderc, C.; Mercier-Bonin, M.; Le Bourgeois, P.; Cocaign-Bousquet, M.; Daveran-Mingot, M.L. From genome to phenotype: An integrative approach to evaluate the biodiversity of Lactococcus lactis. Microorganisms 2017, 5, 27. [Google Scholar] [CrossRef]
- Yu, J.; Zhao, J.; Song, Y.; Zhang, J.; Yu, Z.; Zhang, H.; Sun, Z. Comparative genomics of the herbivore gut symbiont Lactobacillus reuteri reveals genetic diversity and lifestyle adaptation. Front. Microbiol. 2018, 9, 1151. [Google Scholar] [CrossRef]
- Byman, E.; Martinsson, I.; Haukedal, H.; Gouras, G.; Freude, K.K.; Wennström, M. Neuronal α-amylase is important for neuronal activity and glycogenolysis and reduces in presence of amyloid beta pathology. Aging Cell 2021, 20, e13433. [Google Scholar] [CrossRef]
- Sebastián, V.P.; Salazar, G.A.; Coronado-Arrázola, I.; Schultz, B.M.; Vallejos, O.P.; Berkowitz, L.; Álvarez-Lobos, M.M.; Riedel, C.A.; Kalergis, A.M.; Bueno, S.M. Heme oxygenase-1 as a modulator of intestinal inflammation development and progression. Front. Immunol. 2018, 9, 1956. [Google Scholar] [CrossRef]
- Zuo, F.; Yu, R.; Feng, X.; Chen, L.; Zeng, Z.; Khaskheli, G.B.; Ma, H.; Chen, S. Characterization and in vitro properties of potential probiotic Bifidobacterium strains isolated from breast-fed infant feces. Ann. Microbiol. 2015, 66, 1027–1037. [Google Scholar] [CrossRef]
- Gude, S.; Pince, E.; Taute, K.M.; Seinen, A.B.; Shimizu, T.S.; Tans, S.J. Bacterial coexistence driven by motility and spatial competition. Nature 2020, 578, 588–592. [Google Scholar] [CrossRef]
- Succi, M.; Tremonte, P.; Reale, A.; Sorrentino, E.; Grazia, L.; Pacifico, S.; Coppola, R. Bile salt and acid tolerance of Lactobacillus rhamnosus strains isolated from Parmigiano Reggiano cheese. FEMS Microbiol. Lett. 2005, 244, 129–137. [Google Scholar] [CrossRef]
- Yan, F.; Li, N.; Yue, Y.; Wang, C.; Zhao, L.; Evivie, S.E.; Li, B.; Huo, G. Screening for potential novel probiotics with dipeptidyl peptidase IV-inhibiting activity for type 2 diabetes attenuation in vitro and in vivo. Front. Microbiol. 2019, 10, 2855. [Google Scholar] [CrossRef]
- Dinan, T.G.; Stanton, C.; Cryan, J.F. Psychobiotics: A novel class of psychotropic. Biol. Psychiatry 2013, 74, 720–726. [Google Scholar] [CrossRef]
- Freedman, S.B.; Williamson-Urquhart, S.; Farion, K.J.; Gouin, S.; Willan, A.R.; Poonai, N.; Hurley, K.; Sherman, P.M.; Finkelstein, Y.; Lee, B.E.; et al. Multicenter trial of a combination probiotic for children with gastroenteritis. N. Engl. J. Med. 2018, 379, 2015–2026. [Google Scholar] [CrossRef]
- Song, J.G.; Mun, D.; Lee, B.; Song, M.; Oh, S.; Kim, J.M.; Yang, J.; Kim, Y.; Kim, H.W. Protective effects of Lacticaseibacillus rhamnosus IDCC3201 on motor functions and anxiety levels in a chronic stress mouse model. Food Sci. Anim. Resour. 2023, 43, 1044–1054. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.; Liu, T.; Li, X.; Kong, A.; Xiao, R.; Xie, R.; Gao, J.; Wang, Z.; Cai, Y.; Zou, J.; et al. Estrogen receptor beta deficiency impairs gut microbiota: A possible mechanism of IBD-induced anxiety-like behavior. Microbiome 2022, 10, 160. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Song, L.; Wang, Y.; Liu, C.; Zhang, L.; Zhu, S.; Liu, S.; Duan, L. Beneficial effect of butyrate-producing Lachnospiraceae on stress-induced visceral hypersensitivity in rats. J. Gastroenterol. Hepatol. 2019, 34, 1368–1376. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.; Khan, I.; Li, Y.; Yang, Y.; Lu, X.; Wang, Y.; Li, J.; Zhang, C. Overcoming anxiety disorder by probiotic Lactiplantibacillus plantarum LZU-J-TSL6 through pegulating intestinal homeostasis. Foods 2022, 11, 3596. [Google Scholar] [CrossRef]
- Wang, X.; Wang, Z.; Cao, J.; Dong, Y.; Chen, Y. Gut microbiota-derived metabolites mediate the neuroprotective effect of melatonin in cognitive impairment induced by sleep deprivation. Microbiome 2023, 11, 17. [Google Scholar] [CrossRef]
- Kerr, J.R.; Christian, P.; Hodgetts, A.; Langford, P.R.; Devanur, L.D.; Petty, R.; Burke, B.; Sinclair, L.I.; Richards, S.C.; Montgomery, J.; et al. Current research priorities in chronic fatigue syndrome/myalgic encephalomyelitis: Disease mechanisms, a diagnostic test and specific treatments. J. Clin. Pathol. 2007, 60, 113–116. [Google Scholar] [CrossRef]
- Qin, Z.; Shi, D.D.; Li, W.; Cheng, D.; Zhang, Y.D.; Zhang, S.; Tsoi, B.; Zhao, J.; Wang, Z.; Zhang, Z.J. Berberine ameliorates depression-like behaviors in mice via inhibiting NLRP3 inflammasome-mediated neuroinflammation and preventing neuroplasticity disruption. J. Neuroinflamm. 2023, 20, 54. [Google Scholar] [CrossRef] [PubMed]
- Romano, G.F.; Tomassi, S.; Russell, A.; Mondelli, V.; Pariante, C.M. Fibromyalgia and Chronic Fatigue: The Underlying Biology and Related Theoretical Issues. In Clinical Challenges in the Biopsychosocial Interface; Advances in Psychosomatic Medicine: Basel, Switzerland, 2015; Volume 34, pp. 61–77. [Google Scholar]
- Zhang, Z.T.; Du, X.M.; Ma, X.J.; Zong, Y.; Chen, J.K.; Yu, C.L.; Liu, Y.G.; Chen, Y.C.; Zhao, L.J.; Lu, G.C. Activation of the NLRP3 inflammasome in lipopolysaccharide-induced mouse fatigue and its relevance to chronic fatigue syndrome. J. Neuroinflamm. 2016, 13, 71. [Google Scholar] [CrossRef]
- Francino, M.P. The gut microbiome and metabolic health. Curr. Nutr. Rep. 2017, 6, 16–23. [Google Scholar] [CrossRef]
- Smith, P.M.; Howitt, M.R.; Panikov, N.; Michaud, M.; Gallini, C.A.; Bohlooly, Y.M.; Glickman, J.N.; Garrett, W.S. The microbial metabolites, short-chain fatty acids, regulate colonic Treg cell homeostasis. Science 2013, 341, 569–573. [Google Scholar] [CrossRef]
- Liu, D.; Wang, Q.; Li, Y.; Yuan, Z.; Liu, Z.; Guo, J.; Li, X.; Zhang, W.; Tao, Y.; Mei, J. Fructus gardeniae ameliorates anxiety-like behaviors induced by sleep deprivation via regulating hippocampal metabolomics and gut microbiota. Front. Cell. Infect. Microbiol. 2023, 13, 1167312. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Xie, H.; Lin, N.; Yang, Y. Penthorum chinense pursh improves type 2 diabetes mellitus via modulating gut microbiota in db/db mice. BMC Complement. Med. 2023, 23, 314. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer (5′→3′) | Reverse Primer (5′→3′) |
---|---|---|
GAPDH | CATCACTGCCACCCAGAAGACTG | ATGCCAGTGAGCTTCCCGTTCAG |
ZO-1 | GTTGGTACGGTGCCCTGAAAGA | GCTGACAGGTAGGACAGACGAT |
Occludin | TGGCAAGCGATCATACCCAGAG | CTGCCTGAAGTCATCCACACTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, L.; Zhang, S.; Jiang, M.; Ni, X.; Du, M.; Jiang, H.; Bi, M.; Wang, Y.; Liu, C.; Liu, S. Limosilactobacillus reuteri Alleviates Anxiety-like Behavior and Intestinal Symptoms in Two Stressed Mouse Models. Nutrients 2024, 16, 3209. https://doi.org/10.3390/nu16183209
Zhang L, Zhang S, Jiang M, Ni X, Du M, Jiang H, Bi M, Wang Y, Liu C, Liu S. Limosilactobacillus reuteri Alleviates Anxiety-like Behavior and Intestinal Symptoms in Two Stressed Mouse Models. Nutrients. 2024; 16(18):3209. https://doi.org/10.3390/nu16183209
Chicago/Turabian StyleZhang, Liang, Shuwen Zhang, Minzhi Jiang, Xue Ni, Mengxuan Du, He Jiang, Mingxia Bi, Yulin Wang, Chang Liu, and Shuangjiang Liu. 2024. "Limosilactobacillus reuteri Alleviates Anxiety-like Behavior and Intestinal Symptoms in Two Stressed Mouse Models" Nutrients 16, no. 18: 3209. https://doi.org/10.3390/nu16183209