Effects of Clostridium tyrobutyricum on Lipid Metabolism, Intestinal Barrier Function, and Gut Microbiota in Obese Mice Induced by High-Fat Diet
Abstract
:1. Introduction
2. Materials and Methods
2.1. Mice and the Design of Experiments
2.2. Bacterial Culturing
2.3. Serum Biochemical and Hepatic Lipid Analyses
2.4. Enzyme-Linked Immunosorbent Assay
2.5. Histological Investigation of Liver and Intestine
2.6. Real-Time Quantitative PCR
2.7. Short-Chain Fatty Acids in Colonic Content
2.8. Microbiome Sequencing and Analyses
2.9. Statistical Analysis
3. Results
3.1. Ct Inhibits HFD-Induced Body Weight Increase in Mice
3.2. Ct Inhibits HFD-Induced Hyperlipidemia in Mice
3.3. Effect of Ct on Liver Lipid Deposition in Obese Mice
3.4. Effect of Ct on Liver Lipid Deposition in Obese Mice
3.5. Ct Alleviates HFD-Induced Intestinal Mucosal Injury
3.6. Ct Intervention Attenuates Intestinal Inflammation
3.7. mRNA Expression of Colonic Tight Junction Proteins
3.8. Short-Chain Fatty Acid Concentrations
3.9. Ct Changes the Intestinal Microbiota Profile
3.10. Ct Improves HFD-Induced Gut Microbiota Disorder
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kanem, N.; Murray, C.J.L.; Horton, R. The Lancet Commission on 21st-Century Global Health Threats. Lancet 2023, 401, 10–11. [Google Scholar] [CrossRef]
- Collaboration, N.C.D.R.F. Worldwide trends in body-mass index, underweight, overweight, and obesity from 1975 to 2016: A pooled analysis of 2416 population-based measurement studies in 128.9 million children, adolescents, and adults. Lancet 2017, 390, 2627–2642. [Google Scholar] [CrossRef]
- Marcelin, G.; Silveira, A.L.M.; Martins, L.B.; Ferreira, A.V.; Clement, K. Deciphering the cellular interplays underlying obesity-induced adipose tissue fibrosis. J. Clin. Investig. 2019, 129, 4032–4040. [Google Scholar] [CrossRef]
- Mikhail, N.; Golub, M.S.; Tuck, M.L. Obesity and hypertension. Prog. Cardiovasc. Dis. 1999, 42, 39–58. [Google Scholar] [CrossRef] [PubMed]
- Golubic, R.; Barber, T.M.; Caleyachetty, R. Obesity definition for personalised treatment of type 2 diabetes. Lancet 2022, 399, 2189. [Google Scholar] [CrossRef]
- Piche, M.E.; Tchernof, A.; Despres, J.P. Obesity Phenotypes, Diabetes, and Cardiovascular Diseases. Circ. Res. 2020, 126, 1477–1500. [Google Scholar] [CrossRef]
- Seravalle, G.; Grassi, G. Obesity and hypertension. Pharmacol. Res. 2017, 122, 1–7. [Google Scholar] [CrossRef]
- Younossi, Z.M. Non-alcoholic fatty liver disease—A global public health perspective. J. Hepatol. 2019, 70, 531–544. [Google Scholar] [CrossRef]
- Swinburn, B.A.; Kraak, V.I.; Allender, S.; Atkins, V.J.; Baker, P.I.; Bogard, J.R.; Brinsden, H.; Calvillo, A.; De Schutter, O.; Devarajan, R.; et al. The Global Syndemic of Obesity, Undernutrition, and Climate Change: The Lancet Commission report. Lancet 2019, 393, 791–846. [Google Scholar] [CrossRef] [PubMed]
- Perdomo, C.M.; Cohen, R.V.; Sumithran, P.; Clement, K.; Fruhbeck, G. Contemporary medical, device, and surgical therapies for obesity in adults. Lancet 2023, 401, 1116–1130. [Google Scholar] [CrossRef] [PubMed]
- Fallows, E.; Ells, L.; Anand, V. Semaglutide and the future of obesity care in the UK. Lancet 2023, 401, P2093–P2096. [Google Scholar] [CrossRef] [PubMed]
- Gaidhu, M.P.; Ceddia, R.B. The role of adenosine monophosphate kinase in remodeling white adipose tissue metabolism. Exerc. Sport Sci. Rev. 2011, 39, 102–108. [Google Scholar] [CrossRef] [PubMed]
- Ong, K.T.; Mashek, M.T.; Bu, S.Y.; Greenberg, A.S.; Mashek, D.G. Adipose triglyceride lipase is a major hepatic lipase that regulates triacylglycerol turnover and fatty acid signaling and partitioning. Hepatology 2011, 53, 116–126. [Google Scholar] [CrossRef] [PubMed]
- Althaher, A.R. An Overview of Hormone-Sensitive Lipase (HSL). Sci. World J. 2022, 2022, 1964684. [Google Scholar] [CrossRef]
- Montaigne, D.; Butruille, L.; Staels, B. PPAR control of metabolism and cardiovascular functions. Nat. Rev. Cardiol. 2021, 18, 809–823. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Tontonoz, P. Liver X receptors in lipid signalling and membrane homeostasis. Nat. Rev. Endocrinol. 2018, 14, 452–463. [Google Scholar] [CrossRef] [PubMed]
- Bijland, S.; Mancini, S.J.; Salt, I.P. Role of AMP-activated protein kinase in adipose tissue metabolism and inflammation. Clin. Sci. 2013, 124, 491–507. [Google Scholar] [CrossRef]
- Kirpich, I.A.; Marsano, L.S.; McClain, C.J. Gut-liver axis, nutrition, and non-alcoholic fatty liver disease. Clin. Biochem. 2015, 48, 923–930. [Google Scholar] [CrossRef]
- Everard, A.; Belzer, C.; Geurts, L.; Ouwerkerk, J.P.; Druart, C.; Bindels, L.B.; Guiot, Y.; Derrien, M.; Muccioli, G.G.; Delzenne, N.M.; et al. Cross-talk between Akkermansia muciniphila and intestinal epithelium controls diet-induced obesity. Proc. Natl. Acad. Sci. USA 2013, 110, 9066–9071. [Google Scholar] [CrossRef]
- Ji, Y.S.; Kim, H.N.; Park, H.J.; Lee, J.E.; Yeo, S.Y.; Yang, J.S.; Park, S.Y.; Yoon, H.S.; Cho, G.S.; Franz, C.M.; et al. Modulation of the murine microbiome with a concomitant anti-obesity effect by Lactobacillus rhamnosus GG and Lactobacillus sakei NR28. Benef. Microbes 2012, 3, 13–22. [Google Scholar] [CrossRef] [PubMed]
- Hudcovic, T.; Kolinska, J.; Klepetar, J.; Stepankova, R.; Rezanka, T.; Srutkova, D.; Schwarzer, M.; Erban, V.; Du, Z.; Wells, J.M.; et al. Protective effect of Clostridium tyrobutyricum in acute dextran sodium sulphate-induced colitis: Differential regulation of tumour necrosis factor-alpha and interleukin-18 in BALB/c and severe combined immunodeficiency mice. Clin. Exp. Immunol. 2012, 167, 356–365. [Google Scholar] [CrossRef]
- Hu, X.; Guo, J.; Xu, M.; Jiang, P.; Yuan, X.; Zhao, C.; Maimai, T.; Cao, Y.; Zhang, N.; Fu, Y. Clostridium tyrobutyricum alleviates Staphylococcus aureus-induced endometritis in mice by inhibiting endometrial barrier disruption and inflammatory response. Food Funct. 2019, 10, 6699–6710. [Google Scholar] [CrossRef]
- Xiao, Z.; Liu, L.; Tao, W.; Pei, X.; Wang, G.; Wang, M. Clostridium tyrobutyricum Protect Intestinal Barrier Function from LPS-Induced Apoptosis via P38/JNK Signaling Pathway in IPEC-J2 Cells. Cell Physiol. Biochem. 2018, 46, 1779–1792. [Google Scholar] [CrossRef]
- Xiao, Z.; Liu, L.; Pei, X.; Sun, W.; Jin, Y.; Yang, S.-T.; Wang, M. A Potential Probiotic for Diarrhea: Clostridium tyrobutyricum Protects against LPS-Induced Epithelial Dysfunction via IL-22 Produced by Th17 Cells in the Ileum. Front. Immunol. 2021, 12, 758227. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Z.; Cheng, C.; Bao, T.; Liu, L.; Wang, B.; Tao, W.; Pei, X.; Yang, S.T.; Wang, M. Production of butyric acid from acid hydrolysate of corn husk in fermentation by Clostridium tyrobutyricum: Kinetics and process economic analysis. Biotechnol. Biofuels 2018, 11, 164. [Google Scholar] [CrossRef] [PubMed]
- Dieleman, L.A.; Palmen, M.J.; Akol, H.; Bloemena, E.; Pena, A.S.; Meuwissen, S.G.; Van Rees, E.P. Chronic experimental colitis induced by dextran sulphate sodium (DSS) is characterized by Th1 and Th2 cytokines. Clin. Exp. Immunol. 1998, 114, 385–391. [Google Scholar] [CrossRef] [PubMed]
- Hoving, L.R.; Heijink, M.; van Harmelen, V.; van Dijk, K.W.; Giera, M. GC-MS Analysis of Short-Chain Fatty Acids in Feces, Cecum Content, and Blood Samples. Methods Mol. Biol. 2018, 1730, 247–256. [Google Scholar] [CrossRef] [PubMed]
- Shulman, G.I. Ectopic Fat in Insulin Resistance, Dyslipidemia, and Cardiometabolic Disease. N. Engl. J. Med. 2014, 371, 1131–1141. [Google Scholar] [CrossRef] [PubMed]
- Reilly, S.M.; Saltiel, A.R. Adapting to obesity with adipose tissue inflammation. Nat. Rev. Endocrinol. 2017, 13, 633–643. [Google Scholar] [CrossRef] [PubMed]
- Klop, B.; Elte, J.; Cabezas, M. Dyslipidemia in Obesity: Mechanisms and Potential Targets. Nutrients 2013, 5, 1218–1240. [Google Scholar] [CrossRef] [PubMed]
- Duivenvoorden, R.; Tang, J.; Cormode, D.P.; Mieszawska, A.J.; Izquierdo-Garcia, D.; Ozcan, C.; Otten, M.J.; Zaidi, N.; Lobatto, M.E.; van Rijs, S.M.; et al. A statin-loaded reconstituted high-density lipoprotein nanoparticle inhibits atherosclerotic plaque inflammation. Nat. Commun. 2014, 5, 3065. [Google Scholar] [CrossRef]
- Slack, C.; Foley, A.; Partridge, L. Activation of AMPK by the putative dietary restriction mimetic metformin is insufficient to extend lifespan in Drosophila. PLoS ONE 2012, 7, e47699. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.J.; Yuan, H.D.; Chung, S.H. Ginsenoside Rg1 suppresses hepatic glucose production via AMP-activated protein kinase in HepG2 cells. Biol. Pharm. Bull. 2010, 33, 325–328. [Google Scholar] [CrossRef] [PubMed]
- Gaidhu, M.P.; Fediuc, S.; Anthony, N.M.; So, M.; Mirpourian, M.; Perry, R.L.; Ceddia, R.B. Prolonged AICAR-induced AMP-kinase activation promotes energy dissipation in white adipocytes: Novel mechanisms integrating HSL and ATGL. J. Lipid Res. 2009, 50, 704–715. [Google Scholar] [CrossRef] [PubMed]
- Tateno, C.; Yamamoto, T.; Utoh, R.; Yamasaki, C.; Ishida, Y.; Myoken, Y.; Oofusa, K.; Okada, M.; Tsutsui, N.; Yoshizato, K. Chimeric mice with hepatocyte-humanized liver as an appropriate model to study human peroxisome proliferator-activated receptor-alpha. Toxicol. Pathol. 2015, 43, 233–248. [Google Scholar] [CrossRef] [PubMed]
- Kershaw, E.E.; Schupp, M.; Guan, H.P.; Gardner, N.P.; Lazar, M.A.; Flier, J.S. PPARgamma regulates adipose triglyceride lipase in adipocytes in vitro and in vivo. Am. J. Physiol. Endocrinol. Metab. 2007, 293, E1736–E1745. [Google Scholar] [CrossRef] [PubMed]
- Qiang, G.; Kong, H.W.; Fang, D.; McCann, M.; Yang, X.; Du, G.; Bluher, M.; Zhu, J.; Liew, C.W. The obesity-induced transcriptional regulator TRIP-Br2 mediates visceral fat endoplasmic reticulum stress-induced inflammation. Nat. Commun. 2016, 7, 11378. [Google Scholar] [CrossRef] [PubMed]
- Ding, S.; Chi, M.M.; Scull, B.P.; Rigby, R.; Schwerbrock, N.M.; Magness, S.; Jobin, C.; Lund, P.K. High-fat diet: Bacteria interactions promote intestinal inflammation which precedes and correlates with obesity and insulin resistance in mouse. PLoS ONE 2010, 5, e12191. [Google Scholar] [CrossRef]
- Chen, G.; Ran, X.; Li, B.; Li, Y.; He, D.; Huang, B.; Fu, S.; Liu, J.; Wang, W. Sodium Butyrate Inhibits Inflammation and Maintains Epithelium Barrier Integrity in a TNBS-induced Inflammatory Bowel Disease Mice Model. EBioMedicine 2018, 30, 317–325. [Google Scholar] [CrossRef]
- Fu, J.; Li, G.; Wu, X.; Zang, B. Sodium Butyrate Ameliorates Intestinal Injury and Improves Survival in a Rat Model of Cecal Ligation and Puncture-Induced Sepsis. Inflammation 2019, 42, 1276–1286. [Google Scholar] [CrossRef]
- Tilg, H.; Kaser, A. Gut microbiome, obesity, and metabolic dysfunction. J. Clin. Investig. 2011, 121, 2126–2132. [Google Scholar] [CrossRef]
- Liu, S.; Yu, H.; Li, P.; Wang, C.; Liu, G.; Zhang, X.; Zhang, C.; Qi, M.; Ji, H. Dietary nano-selenium alleviated intestinal damage of juvenile grass carp (Ctenopharyngodon idella) induced by high-fat diet: Insight from intestinal morphology, tight junction, inflammation, anti-oxidization and intestinal microbiota. Anim. Nutr. 2022, 8, 235–248. [Google Scholar] [CrossRef]
- Ulluwishewa, D.; Anderson, R.C.; McNabb, W.C.; Moughan, P.J.; Wells, J.M.; Roy, N.C. Regulation of tight junction permeability by intestinal bacteria and dietary components. J. Nutr. 2011, 141, 769–776. [Google Scholar] [CrossRef] [PubMed]
- Stoeva, M.K.; Garcia-So, J.; Justice, N.; Myers, J.; Tyagi, S.; Nemchek, M.; McMurdie, P.J.; Kolterman, O.; Eid, J. Butyrate-producing human gut symbiont, Clostridium butyricum, and its role in health and disease. Gut Microbes 2021, 13, 1907272. [Google Scholar] [CrossRef]
- Peng, L.; Li, Z.R.; Green, R.S.; Holzman, I.R.; Lin, J. Butyrate enhances the intestinal barrier by facilitating tight junction assembly via activation of AMP-activated protein kinase in Caco-2 cell monolayers. J. Nutr. 2009, 139, 1619–1625. [Google Scholar] [CrossRef] [PubMed]
- Million, M.; Maraninchi, M.; Henry, M.; Armougom, F.; Richet, H.; Carrieri, P.; Valero, R.; Raccah, D.; Vialettes, B.; Raoult, D. Obesity-associated gut microbiota is enriched in Lactobacillus reuteri and depleted in Bifidobacterium animalis and Methanobrevibacter smithii. Int. J. Obes. 2012, 36, 817–825. [Google Scholar] [CrossRef] [PubMed]
- Ley, R.E.; Turnbaugh, P.J.; Klein, S.; Gordon, J.I. Microbial ecology: Human gut microbes associated with obesity. Nature 2006, 444, 1022–1023. [Google Scholar] [CrossRef] [PubMed]
- Tomas, J.; Mulet, C.; Saffarian, A.; Cavin, J.B.; Ducroc, R.; Regnault, B.; Kun Tan, C.; Duszka, K.; Burcelin, R.; Wahli, W.; et al. High-fat diet modifies the PPAR-gamma pathway leading to disruption of microbial and physiological ecosystem in murine small intestine. Proc. Natl. Acad. Sci. USA 2016, 113, E5934–E5943. [Google Scholar] [CrossRef]
- Turnbaugh, P.J.; Backhed, F.; Fulton, L.; Gordon, J.I. Diet-induced obesity is linked to marked but reversible alterations in the mouse distal gut microbiome. Cell Host Microbe 2008, 3, 213–223. [Google Scholar] [CrossRef]
- Backhed, F.; Ding, H.; Wang, T.; Hooper, L.V.; Koh, G.Y.; Nagy, A.; Semenkovich, C.F.; Gordon, J.I. The gut microbiota as an environmental factor that regulates fat storage. Proc. Natl. Acad. Sci. USA 2004, 101, 15718–15723. [Google Scholar] [CrossRef]
- Ley, R.E.; Backhed, F.; Turnbaugh, P.; Lozupone, C.A.; Knight, R.D.; Gordon, J.I. Obesity alters gut microbial ecology. Proc. Natl. Acad. Sci. USA 2005, 102, 11070–11075. [Google Scholar] [CrossRef] [PubMed]
- Indiani, C.; Rizzardi, K.F.; Castelo, P.M.; Ferraz, L.F.C.; Darrieux, M.; Parisotto, T.M. Childhood Obesity and Firmicutes/Bacteroidetes Ratio in the Gut Microbiota: A Systematic Review. Child. Obes. 2018, 14, 501–509. [Google Scholar] [CrossRef] [PubMed]
- Gurung, M.; Li, Z.; You, H.; Rodrigues, R.; Jump, D.B.; Morgun, A.; Shulzhenko, N. Role of gut microbiota in type 2 diabetes pathophysiology. EBioMedicine 2020, 51, 102590. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Q.; Li, D.; He, Y.; Li, Y.; Yang, Z.; Zhao, X.; Liu, Y.; Wang, Y.; Sun, J.; Feng, X.; et al. Discrepant gut microbiota markers for the classification of obesity-related metabolic abnormalities. Sci. Rep. 2019, 9, 13424. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Coker, O.O.; Chu, E.S.; Fu, K.; Lau, H.C.H.; Wang, Y.X.; Chan, A.W.H.; Wei, H.; Yang, X.; Sung, J.J.Y.; et al. Dietary cholesterol drives fatty liver-associated liver cancer by modulating gut microbiota and metabolites. Gut 2021, 70, 761–774. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.; Fan, J.; Li, T.; Yan, X.; Jiang, Y. Nuciferine Protects Against High-Fat Diet-Induced Hepatic Steatosis via Modulation of Gut Microbiota and Bile Acid Metabolism in Rats. J. Agric. Food Chem. 2022, 70, 12014–12028. [Google Scholar] [CrossRef]
- Liu, Y.; Xie, C.; Zhai, Z.; Deng, Z.Y.; De Jonge, H.R.; Wu, X.; Ruan, Z. Uridine attenuates obesity, ameliorates hepatic lipid accumulation and modifies the gut microbiota composition in mice fed with a high-fat diet. Food Funct. 2021, 12, 1829–1840. [Google Scholar] [CrossRef]
- Ma, L.; Ni, Y.; Wang, Z.; Tu, W.; Ni, L.; Zhuge, F.; Zheng, A.; Hu, L.; Zhao, Y.; Zheng, L.; et al. Spermidine improves gut barrier integrity and gut microbiota function in diet-induced obese mice. Gut Microbes 2020, 12, 1832857. [Google Scholar] [CrossRef]
- den Besten, G.; Lange, K.; Havinga, R.; van Dijk, T.H.; Gerding, A.; van Eunen, K.; Muller, M.; Groen, A.K.; Hooiveld, G.J.; Bakker, B.M.; et al. Gut-derived short-chain fatty acids are vividly assimilated into host carbohydrates and lipids. Am. J. Physiol. Gastrointest. Liver Physiol. 2013, 305, G900–G910. [Google Scholar] [CrossRef]
- Duncan, S.H. Roseburia intestinalis sp. nov., a novel saccharolytic, butyrate-producing bacterium from human faeces. Int. J. Syst. Evol. Microbiol. 2002, 52, 1615–1620. [Google Scholar] [CrossRef] [PubMed]
- Pryde, S.E.; Duncan, S.H.; Hold, G.L.; Stewart, C.S.; Flint, H.J. The microbiology of butyrate formation in the human colon. FEMS Microbiol. Lett. 2002, 217, 133–139. [Google Scholar] [CrossRef] [PubMed]
- Barcenilla, A.; Pryde, S.E.; Martin, J.C.; Duncan, S.H.; Stewart, C.S.; Henderson, C.; Flint, H.J. Phylogenetic relationships of butyrate-producing bacteria from the human gut. Appl. Environ. Microbiol. 2000, 66, 1654–1661. [Google Scholar] [CrossRef] [PubMed]
- Sun, M.; Wu, W.; Liu, Z.; Cong, Y. Microbiota metabolite short chain fatty acids, GPCR, and inflammatory bowel diseases. J. Gastroenterol. 2017, 52, 1–8. [Google Scholar] [CrossRef]
- Nishitsuji, K.; Watanabe, S.; Xiao, J.; Nagatomo, R.; Ogawa, H.; Tsunematsu, T.; Umemoto, H.; Morimoto, Y.; Akatsu, H.; Inoue, K.; et al. Effect of coffee or coffee components on gut microbiome and short-chain fatty acids in a mouse model of metabolic syndrome. Sci. Rep. 2018, 8, 16173. [Google Scholar] [CrossRef]
- Xu, T.T.; Chen, P.; Zhang, C.D.; Shaukat, A.; Lin, L.X.; Yue, K.; Ding, W.L.; Tong, X.; Liu, K.L.; He, Y.F.; et al. Gut microbiome dysregulation drives bone damage in broiler tibial dyschondroplasia by disrupting glucose homeostasis. NPJ Biofilms Microbiomes 2023, 9, 1. [Google Scholar] [CrossRef]
- Berger, K.; Burleigh, S.; Lindahl, M.; Bhattacharya, A.; Patil, P.; Stalbrand, H.; Nordberg Karlsson, E.; Hallenius, F.; Nyman, M.; Adlercreutz, P. Xylooligosaccharides Increase Bifidobacteria and Lachnospiraceae in Mice on a High-Fat Diet, with a Concomitant Increase in Short-Chain Fatty Acids, Especially Butyric Acid. J. Agric. Food Chem. 2021, 69, 3617–3625. [Google Scholar] [CrossRef]
- Rahat-Rozenbloom, S.; Fernandes, J.; Gloor, G.B.; Wolever, T.M. Evidence for greater production of colonic short-chain fatty acids in overweight than lean humans. Int. J. Obes. 2014, 38, 1525–1531. [Google Scholar] [CrossRef] [PubMed]
- Teixeira, T.F.; Grzeskowiak, L.; Franceschini, S.C.; Bressan, J.; Ferreira, C.L.; Peluzio, M.C. Higher level of faecal SCFA in women correlates with metabolic syndrome risk factors. Br. J. Nutr. 2013, 109, 914–919. [Google Scholar] [CrossRef] [PubMed]
Nutrient Class | Ingredient | General Diet (gm) | High-Fat Diet (gm) |
---|---|---|---|
Protein | Casein | 200 | 200 |
L-Cystine | 3 | 3 | |
Carbohydrate | Corn Starch | 506.2 | 0 |
Maltodextrin 10 | 125 | 125 | |
Sucrose | 72.8 | 72.8 | |
Fiber | Cellulose | 50 | 50 |
Fat | Soybean oil | 25 | 25 |
Lard | 20 | 245 | |
Mineral | Mineral Mix S10026B | 50 | 50 |
Vitamin | Vitamin Mix V10001C | 1 | 1 |
Choline Bitartrate | 2 | 2 |
Feature Graded | Description | Grade |
---|---|---|
Normal tissue | None | 0 |
Degree of epithelial surface damage | Local and slight | 1 |
Degree of Crypt damage | Local and moderate | 2 |
Degree of inflammatory factor infiltration | Local and severe | 3 |
Extensive and moderate | 4 | |
Extensive and severe | 5 |
Genes | Forward Primer | Reverse Primer |
---|---|---|
ACC | TGTCCGCACTGACTGTAACCA | TGCTCCGCACAGATTCTTCA |
Srebp-1c | GCCATCGACTACATCCGCTTCTTG | TGCCTCCTCCACTGCCACAAG |
AMPK | TGAAGATCGGCC ACTACATCCT | CTTGCCCACCTTCACTTTCC |
PPARα | CAGGAGAGCAGGGATTTGCA | CCTACGCTCAGCCCTCTTCAT |
PPARγ | AGGGCGATCTTGACAGGAAAGAC | AAATTCGGATGGCCACCTCTTTGC |
HSL | CAGGAGAGCAGGGATTTGCA | CCTACGCTCAGCCCTCTTCAT |
ATGL | CGCGCTCTTGGCTCATG | CCAACCTTTGTGCCCCTTAA |
β-actin | CGTTGACATCCGTAAAGACC | AACAGTCCGCCTAGAAGCAC |
Genes | Forward Primer | Reverse Primer |
---|---|---|
TNF-α | GCGACGTGGAACTGGCAGAAG | GAATGAGAAGAGGCTGAGACATAGGC |
IL-1β | TGCCACCTTTTGACAGTGATG | ATGTGCTGCTGCGAGATTTG |
IL-6 | AGACTTCCATCCAGTTGCCTTCTTG | CATGTGTAATTAAGCCTCCGACTTGTG |
IL-10 | CCAAGCCTTATCGGAAATGA | TCCTGAGGGTCTTCAGCTTC |
ZO-1 | AGGACACCAAAGCATGTGAG | GGAGATTCCTCTGACCTTGAGTGT |
Occludin | GGAGATTCCTCTGACCTTGAGTGT | TTCCTGCTTTCCCCTTCGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Luo, Y.; Jin, Y.; Wang, H.; Wang, G.; Lin, Y.; Chen, H.; Li, X.; Wang, M. Effects of Clostridium tyrobutyricum on Lipid Metabolism, Intestinal Barrier Function, and Gut Microbiota in Obese Mice Induced by High-Fat Diet. Nutrients 2024, 16, 493. https://doi.org/10.3390/nu16040493
Luo Y, Jin Y, Wang H, Wang G, Lin Y, Chen H, Li X, Wang M. Effects of Clostridium tyrobutyricum on Lipid Metabolism, Intestinal Barrier Function, and Gut Microbiota in Obese Mice Induced by High-Fat Diet. Nutrients. 2024; 16(4):493. https://doi.org/10.3390/nu16040493
Chicago/Turabian StyleLuo, Yanqiu, Yuyue Jin, Haidong Wang, Geng Wang, Yueying Lin, Haohan Chen, Xinyu Li, and Minqi Wang. 2024. "Effects of Clostridium tyrobutyricum on Lipid Metabolism, Intestinal Barrier Function, and Gut Microbiota in Obese Mice Induced by High-Fat Diet" Nutrients 16, no. 4: 493. https://doi.org/10.3390/nu16040493