Effects of 3-(4-Hydroxy-3-methoxyphenyl)propionic Acid on Regulating Oxidative Stress and Muscle Fiber Composition
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Design
2.2. Assessment of Antioxidant Capacity and Oxidative Stress Biomarkers in Plasma
2.2.1. d-ROMs Test
2.2.2. BAP Test
2.2.3. OXY-Adsorbent Test
2.2.4. Griess Reagent System
2.3. Assessment of Lipid Peroxidation in Soleus and Gastrocnemius
2.4. RNA Extraction and Quantitative PCR (qPCR) Analysis
2.5. Western Blot Analysis
2.6. Statistical Analysis
3. Results
3.1. Effects of HMPA Administration on Oxidative Stress and Antioxidant Capacity in Plasma
3.2. Effects of HMPA Administration on Malondialdehyde Content in Soleus and Gastrocnemius
3.3. Effects of HMPA Administration on Antioxidant Enzyme Gene Expression in Soleus and Gastrocnemius
3.4. Effects of HMPA Administration on Nitric Oxide Synthase Gene Expression in Soleus and Gastrocnemius
3.5. Effects of HMPA Administration on Myosin Heavy Chain Isoform Gene Expression in Soleus and Gastrocnemius
3.6. Effects of HMPA Administration on Myosin Heavy Chain Isoform Expression in Soleus and Gastrocnemius
3.7. Effects of HMPA Administration on Insulin-Like Growth Factor 1 Gene Expression in Soleus and Gastrocnemius
3.8. Effects of HMPA Administration on Mitochondrial Biogenesis-Related Gene Expression in Soleus
3.9. Effects of HMPA Administration on mTOR/AMPK Phosphorylation in Soleus and Gastrocnemius
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
MHC | myosin heavy chain |
ROS | reactive oxygen species |
RNS | reactive nitrogen species |
NO | nitric oxide |
SOD | superoxide dismutase |
CAT | catalase |
GPx | glutathione peroxidase |
HMPA | 3-(4-Hydroxy-3-methoxyphenyl)propionic acid |
HMCA | 4-Hydroxy-3-methoxycinnamic acid |
CGA | chlorogenic acid |
d-ROMs | diacron-reactive oxygen metabolites |
BAP | biological antioxidant potential |
NOS | nitric oxide synthase |
NQO1 | NAD(P)H dehydrogenase |
IGF-1 | insulin-like growth factor 1 |
SIRT1 | sirtuin 1 |
NRF1 | nuclear respiratory factor 1 |
TFAM | mitochondrial transcription factor a |
PGC-1α | peroxisome proliferator-activated receptor gamma coactivator 1-alpha |
AMPK | AMP-activated protein kinase α |
mTOR | mechanistic target of rapamycin |
NRF2 | nuclear factor erythroid 2-related factor 2 |
References
- Frontera, W.R.; Ochala, J. Skeletal muscle: A brief review of structure and function. Calcif. Tissue Int. 2015, 96, 183–195. [Google Scholar] [CrossRef] [PubMed]
- Pant, M.; Bal, N.C.; Periasamy, M. Sarcolipin: A Key Thermogenic and Metabolic Regulator in Skeletal Muscle. Trends Endocrinol. Metab. 2016, 27, 881–892. [Google Scholar] [CrossRef]
- Zierath, J.R.; Hawley, J.A. Skeletal muscle fiber type: Influence on contractile and metabolic properties. PLoS Biol. 2004, 2, e348. [Google Scholar] [CrossRef] [PubMed]
- Scott, W.; Stevens, J.; Binder-Macleod, S.A. Human skeletal muscle fiber type classifications. Phys. Ther. 2001, 81, 1810–1816. [Google Scholar] [CrossRef] [PubMed]
- Schiaffino, S.; Reggiani, C. Fiber types in mammalian skeletal muscles. Physiol. Rev. 2011, 91, 1447–1531. [Google Scholar] [CrossRef]
- Chakkalakal, J.V.; Kuang, S.; Buffelli, M.; Lichtman, J.W.; Sanes, J.R. Mouse transgenic lines that selectively label Type I, Type IIA, and Types IIX+B skeletal muscle fibers. Genesis 2012, 50, 50–58. [Google Scholar] [CrossRef] [PubMed]
- Choi, Y.M.; Kim, B.C. Muscle fiber characteristics, myofibrillar protein isoforms, and meat quality. Livest. Sci. 2009, 122, 105. [Google Scholar] [CrossRef]
- Hockey, B.L.; Baranowski, R.W. Do you have the guts to adapt to exercise. J. Physiol. 2022, 600, 9–10. [Google Scholar] [CrossRef] [PubMed]
- Giacomello, E.; Toniolo, L. Editorial: The fiber profile of skeletal muscles as a fingerprint of muscle quality. Front. Physiol. 2022, 13, 1105252. [Google Scholar] [CrossRef]
- Moro, T.; Brightwell, C.R.; Phalen, D.E.; McKenna, C.F.; Lane, S.J.; Porter, C.; Volpi, E.; Rasmussen, B.B.; Fry, C.S. Low skeletal muscle capillarization limits muscle adaptation to resistance exercise training in older adults. Exp. Gerontol. 2019, 127, 110723. [Google Scholar] [CrossRef]
- Margaritelis, N.V.; Paschalis, V.; Theodorou, A.A.; Kyparos, A.; Nikolaidis, M.G. Redox basis of exercise physiology. Redox Biol. 2020, 35, 101499. [Google Scholar] [CrossRef] [PubMed]
- Jackson, M.J. On the mechanisms underlying attenuated redox responses to exercise in older individuals: A hypothesis. Free Radic. Biol. Med. 2020, 161, 326–338. [Google Scholar] [CrossRef] [PubMed]
- Cheeseman, K.H.; Slater, T.F. An introduction to free radical biochemistry. Br. Med. Bull. 1993, 49, 481. [Google Scholar] [CrossRef]
- Morales-Alamo, D.; Calbet, J. AMPK signaling in skeletal muscle during exercise: Role of reactive oxygen and nitrogen species. Free Radic. Biol. Med. 2016, 98, 68–77. [Google Scholar] [CrossRef] [PubMed]
- Jordan, A.C.; Perry, C.; Cheng, A.J. Promoting a pro-oxidant state in skeletal muscle: Potential dietary, environmental, and exercise interventions for enhancing endurance-training adaptations. Free Radic. Biol. Med. 2021, 176, 189–202. [Google Scholar] [CrossRef] [PubMed]
- Hirabayashi, T.; Nakanishi, R.; Tanaka, M.; Nisa, B.U.; Maeshige, N.; Kondo, H.; Fujino, H. Reduced metabolic capacity in fast and slow skeletal muscle via oxidative stress and the energy-sensing of AMPK/SIRT1 in malnutrition. Physiol. Rep. 2021, 9, e14763. [Google Scholar] [CrossRef] [PubMed]
- Murgia, M.; Toniolo, L.; Nagaraj, N.; Ciciliot, S.; Vindigni, V.; Schiaffino, S.; Reggiani, C.; Mann, M. Single Muscle Fiber Proteomics Reveals Fiber-Type-Specific Features of Human Muscle Aging. Cell Rep. 2017, 19, 2396. [Google Scholar] [CrossRef]
- Liu, X.; Liu, M. Anti-fatigue effect of ferulic acid in exercise trained mice. Acta Pol. Pharm.-Drug Res. 2023, 80, 473. [Google Scholar] [CrossRef] [PubMed]
- Wang, O.; Zhang, N.; Han, C.; Huang, J. Regular exercise combined with ferulic acid exhibits antiobesity effect and regulates metabolic profiles in high-fat diet-induced mice. Front. Nutr. 2022, 9, 957321. [Google Scholar] [CrossRef]
- Pisoschi, A.M.; Pop, A. The role of antioxidants in the chemistry of oxidative stress: A review. Eur. J. Med. Chem. 2015, 97, 55–74. [Google Scholar] [CrossRef]
- Chen, X.; Guo, Y.; Jia, G.; Zhao, H.; Liu, G.; Huang, Z. Ferulic acid regulates muscle fiber type formation through the Sirt1/AMPK signaling pathway. Food Funct. 2019, 10, 259–265. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Chen, X.; Huang, Z.; Chen, D.; Yu, B.; Chen, H.; Yu, J.; Luo, Y.; Zheng, P.; He, J. Effects of dietary ferulic acid supplementation on growth performance and skeletal muscle fiber type conversion in weaned piglets. J. Sci. Food Agric. 2021, 101, 5116–5123. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Wen, C.; Guo, Q.; Li, J.; He, S.; Yin, Y. Dietary Supplementation with Chlorogenic Acid Derived from Lonicera macranthoides Hand-Mazz Improves Meat Quality and Muscle Fiber Characteristics of Finishing Pigs via Enhancement of Antioxidant Capacity. Front. Physiol. 2021, 12, 650084. [Google Scholar] [CrossRef] [PubMed]
- Kwon, C.; Ediriweera, M.K.; Kim Cho, S. Interplay between Phytochemicals and the Colonic Microbiota. Nutrients 2023, 15, 1989. [Google Scholar] [CrossRef]
- Ohue-Kitano, R.; Taira, S.; Watanabe, K.; Masujima, Y.; Kuboshima, T.; Miyamoto, J.; Nishitani, Y.; Kawakami, H.; Kuwahara, H.; Kimura, I. 3-(4-Hydroxy-3-methoxyphenyl)propionic Acid Produced from 4-Hydroxy-3-methoxycinnamic Acid by Gut Microbiota Improves Host Metabolic Condition in Diet-Induced Obese Mice. Nutrients 2019, 11, 1036. [Google Scholar] [CrossRef] [PubMed]
- Tan, S.; Calani, L.; Bresciani, L.; Dall’asta, M.; Faccini, A.; Augustin, M.A.; Gras, S.L.; Del Rio, D. The degradation of curcuminoids in a human faecal fermentation model. Int. J. Food Sci. Nutr. 2015, 66, 790–796. [Google Scholar] [CrossRef] [PubMed]
- Mills, C.E.; Tzounis, X.; Oruna-Concha, M.J.; Mottram, D.S.; Gibson, G.R.; Spencer, J.P. In vitro colonic metabolism of coffee and chlorogenic acid results in selective changes in human faecal microbiota growth. Br. J. Nutr. 2015, 113, 1220–1227. [Google Scholar] [CrossRef]
- Vitaglione, P.; Mennella, I.; Ferracane, R.; Rivellese, A.A.; Giacco, R.; Ercolini, D.; Gibbons, S.M.; La Storia, A.; Gilbert, J.A.; Jonnalagadda, S.; et al. Whole-grain wheat consumption reduces inflammation in a randomized controlled trial on overweight and obese subjects with unhealthy dietary and lifestyle behaviors: Role of polyphenols bound to cereal dietary fiber. Am. J. Clin. Nutr. 2015, 101, 251–261. [Google Scholar] [CrossRef] [PubMed]
- Renouf, M.; Guy, P.; Marmet, C.; Longet, K.; Fraering, A.L.; Moulin, J.; Barron, D.; Dionisi, F.; Cavin, C.; Steiling, H.; et al. Plasma appearance and correlation between coffee and green tea metabolites in human subjects. Br. J. Nutr. 2010, 104, 1635–1640. [Google Scholar] [CrossRef] [PubMed]
- Renouf, M.; Marmet, C.; Giuffrida, F.; Lepage, M.; Barron, D.; Beaumont, M.; Williamson, G.; Dionisi, F. Dose-response plasma appearance of coffee chlorogenic and phenolic acids in adults. Mol. Nutr. Food Res. 2014, 58, 301–309. [Google Scholar] [CrossRef] [PubMed]
- Shimoji, Y.; Tamura, Y.; Nakamura, Y.; Nanda, K.; Nishidai, S.; Nishikawa, Y.; Ishihara, N.; Uenakai, K.; Ohigashi, H. Isolation and identification of DPPH radical scavenging compounds in Kurosu (Japanese unpolished rice vinegar). J. Agric. Food Chem. 2002, 50, 6501–6503. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; He, Y.; He, W.; Song, X.; Peng, Y.; Hu, X.; Bian, S.; Li, Y.; Nie, S.; Yin, J.; et al. Exploring the Biogenic Transformation Mechanism of Polyphenols by Lactobacillus plantarum NCU137 Fermentation and Its Enhancement of Antioxidant Properties in Wolfberry Juice. J. Agric. Food Chem. 2024, 72, 12752–12761. [Google Scholar] [CrossRef] [PubMed]
- Serreli, G.; Naitza, M.R.; Zodio, S.; Leoni, V.P.; Spada, M.; Melis, M.P.; Boronat, A.; Deiana, M. Ferulic Acid Metabolites Attenuate LPS-Induced Inflammatory Response in Enterocyte-like Cells. Nutrients 2021, 13, 3152. [Google Scholar] [CrossRef] [PubMed]
- Ohue-Kitano, R.; Masujima, Y.; Nishikawa, S.; Iwasa, M.; Nishitani, Y.; Kawakami, H.; Kuwahara, H.; Kimura, I. 3-(4-Hydroxy-3-methoxyphenyl) propionic acid contributes to improved hepatic lipid metabolism via GPR41. Sci. Rep. 2023, 13, 21246. [Google Scholar] [CrossRef] [PubMed]
- Wen, Y.; Ushio, H. Ferulic Acid Promotes Hypertrophic Growth of Fast Skeletal Muscle in Zebrafish Model. Nutrients 2017, 9, 1066. [Google Scholar] [CrossRef]
- Lara-Guzmán, O.J.; Arango-González, Á.; Rivera, D.A.; Muñoz-Durango, K.; Sierra, J.A. The colonic polyphenol catabolite dihydroferulic acid (DHFA) regulates macrophages activated by oxidized LDL, 7-ketocholesterol, and LPS switching from pro- to anti-inflammatory mediators. Food Funct. 2024, 15, 10399–10413. [Google Scholar] [CrossRef]
- Ulla, A.; Rahman, M.; Uchida, T.; Kayaki, H.; Nishitani, Y.; Yoshino, S.; Kuwahara, H.; Nikawa, T. 3-(4-Hydroxy-3-methoxyphenyl) propionic acid mitigates dexamethasone-induced muscle atrophy by attenuating Atrogin-1 and MuRF-1 expression in mouse C2C12 skeletal myotubes. J. Clin. Biochem. Nutr. 2024, 76, 16–24. [Google Scholar] [CrossRef] [PubMed]
- Tong, Y.; Huang, J.; Wang, S.; Awa, R.; Tagawa, T.; Zhang, Z.; Cao, T.; Kobori, H.; Suzuki, K. Effects of 3-(4-Hydroxy-3-methoxyphenyl)propionic Acid on Enhancing Grip Strength and Inhibiting Protein Catabolism Induced by Exhaustive Exercise. Int. J. Mol. Sci. 2024, 25, 6627. [Google Scholar] [CrossRef]
- Graber, T.G.; Maroto, R.; Fry, C.S.; Brightwell, C.R.; Rasmussen, B.B. Measuring Exercise Capacity and Physical Function in Adult and Older Mice. J. Gerontol. Biol. Sci. 2021, 76, 819–824. [Google Scholar] [CrossRef]
- Huang, J.; Tagawa, T.; Ma, S.; Suzuki, K. Black Ginger (Kaempferia parviflora) Extract Enhances Endurance Capacity by Improving Energy Metabolism and Substrate Utilization in Mice. Nutrients 2022, 14, 3845. [Google Scholar] [CrossRef]
- Całyniuk, B.; Grochowska-Niedworok, E.; Walkiewicz, K.; Kawecka, S.; Popiołek, E.; Fatyga, E. Malondialdehyde (MDA)—product of lipid peroxidation as marker of homeostasis disorders and aging. AAMS 2016, 70, 224. [Google Scholar] [CrossRef]
- Chen, X.; Luo, X.; Chen, D.; Yu, B.; He, J.; Huang, Z. Arginine promotes porcine type I muscle fibres formation through improvement of mitochondrial biogenesis. Br. J. Nutr. 2020, 123, 499–507. [Google Scholar] [CrossRef] [PubMed]
- Carey, C.C.; Lucey, A.; Doyle, L. Flavonoid Containing Polyphenol Consumption and Recovery from Exercise-Induced Muscle Damage: A Systematic Review and Meta-Analysis. Sports Med. 2021, 51, 1293–1316. [Google Scholar] [CrossRef]
- Vasileiadou, O.; Nastos, G.G.; Chatzinikolaou, P.N.; Papoutsis, D.; Vrampa, D.I.; Methenitis, S.; Margaritelis, N.V. Redox Profile of Skeletal Muscles: Implications for Research Design and Interpretation. Antioxidants 2023, 12, 1738. [Google Scholar] [CrossRef] [PubMed]
- Duan, F.F.; Guo, Y.; Li, J.W.; Yuan, K. Antifatigue Effect of Luteolin-6-C-Neohesperidoside on Oxidative Stress Injury Induced by Forced Swimming of Rats through Modulation of Nrf2/ARE Signaling Pathways. Oxid. Med. Cell Longev. 2017, 2017, 3159358. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Niu, C.; Lu, J.; Li, N.; Li, J. Hydrolyzed protein supplementation improves protein content and peroxidation of skeletal muscle by adjusting the plasma amino acid spectrums in rats after exhaustive swimming exercise: A pilot study. J. Int. Soc. Sports Nutr. 2014, 11, 5. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Cui, D.; Zhang, Z.; Zhang, T.; Shi, J.; Jin, H.; Ge, Z.; Ji, L.; Ding, S. Attenuated Oxidative Stress following Acute Exhaustive Swimming Exercise Was Accompanied with Modified Gene Expression Profiles of Apoptosis in the Skeletal Muscle of Mice. Oxid. Med. Cell Longev. 2016, 2016, 8381242. [Google Scholar] [CrossRef]
- Fisher-Wellman, K.; Bloomer, R.J. Acute exercise and oxidative stress: A 30 year history. Dyn. Med. 2009, 8, 1. [Google Scholar] [CrossRef] [PubMed]
- Kawamura, T.; Muraoka, I. Exercise-Induced Oxidative Stress and the Effects of Antioxidant Intake from a Physiological Viewpoint. Antioxidants 2018, 7, 119. [Google Scholar] [CrossRef]
- Cobley, J.N.; Close, G.L.; Bailey, D.M.; Davison, G.W. Exercise redox biochemistry: Conceptual, methodological and technical recommendations. Redox Biol. 2017, 12, 540–548. [Google Scholar] [CrossRef] [PubMed]
- Goya, L.; Sánchez-Medina, A.; Redondo-Puente, M.; Dupak, R.; Bravo, L.; Sarriá, B. Main Colonic Metabolites from Coffee Chlorogenic Acid May Counteract Tumor Necrosis Factor-α-Induced Inflammation and Oxidative Stress in 3T3-L1 Cells. Molecules 2023, 29, 88. [Google Scholar] [CrossRef]
- Wei, Y.; Zhang, J.; Yan, X.; Peng, X.; Xu, S.; Chang, H.; Wang, H.; Gao, Y. Remarkable Protective Effects of Nrf2-Mediated Antioxidant Enzymes and Tissue Specificity in Different Skeletal Muscles of Daurian Ground Squirrels Over the Torpor-Arousal Cycle. Front. Physiol. 2019, 10, 1449. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, K.; Shibuya, S.; Koyama, H.; Ozawa, Y.; Toda, T.; Yokote, K.; Shimizu, T. Sod1 loss induces intrinsic superoxide accumulation leading to p53-mediated growth arrest and apoptosis. Int. J. Mol. Sci. 2013, 14, 10998–11010. [Google Scholar] [CrossRef] [PubMed]
- Flynn, J.M.; Melov, S. SOD2 in mitochondrial dysfunction and neurodegeneration. Free Radic. Biol. Med. 2013, 62, 4–12. [Google Scholar] [CrossRef] [PubMed]
- Gurgul, E.; Lortz, S.; Tiedge, M.; Jörns, A.; Lenzen, S. Mitochondrial catalase overexpression protects insulin-producing cells against toxicity of reactive oxygen species and proinflammatory cytokines. Diabetes 2004, 53, 2271–2280. [Google Scholar] [CrossRef]
- Nishida-Tamehiro, K.; Kimura, A.; Tsubata, T.; Takahashi, S.; Suzuki, H. Antioxidative enzyme NAD(P)H quinone oxidoreductase 1 (NQO1) modulates the differentiation of Th17 cells by regulating ROS levels. PLoS ONE 2022, 17, e0272090. [Google Scholar] [CrossRef]
- Liu, C.; Lei, S.; Cai, T.; Cheng, Y.; Bai, J.; Fu, W.; Huang, M. Inducible nitric oxide synthase activity mediates TNF-α-induced endothelial cell dysfunction. Am. J. Physiol. Cell Physiol. 2023, 325, C780–C795. [Google Scholar] [CrossRef] [PubMed]
- Couto, G.K.; Paula, S.M.; Gomes-Santos, I.L.; Negrão, C.E.; Rossoni, L.V. Exercise training induces eNOS coupling and restores relaxation in coronary arteries of heart failure rats. Am. J. Physiol. Heart Circ. Physiol. 2018, 314, H878–H887. [Google Scholar] [CrossRef]
- Suhr, F.; Gehlert, S.; Grau, M.; Bloch, W. Skeletal muscle function during exercise-fine-tuning of diverse subsystems by nitric oxide. Int. J. Mol. Sci. 2013, 14, 7109–7139. [Google Scholar] [CrossRef]
- Martins, K.J.; St-Louis, M.; Murdoch, G.K.; MacLean, I.M.; McDonald, P.; Dixon, W.T.; Putman, C.T.; Michel, R.N. Nitric oxide synthase inhibition prevents activity-induced calcineurin-NFATc1 signalling and fast-to-slow skeletal muscle fibre type conversions. J. Physiol. 2012, 590, 1427–1442. [Google Scholar] [CrossRef] [PubMed]
- Suwa, M.; Nakano, H.; Radak, Z.; Kumagai, S. Effects of Nitric Oxide Synthase Inhibition on Fiber-Type Composition, Mitochondrial Biogenesis, and SIRT1 Expression in Rat Skeletal Muscle. J. Sports Sci. Med. 2015, 14, 548–555. [Google Scholar]
- Wang, L.; Wang, Z.; Yang, K.; Shu, G.; Wang, S.; Gao, P.; Zhu, X.; Xi, Q.; Zhang, Y.; Jiang, Q. Epigallocatechin Gallate Reduces Slow-Twitch Muscle Fiber Formation and Mitochondrial Biosynthesis in C2C12 Cells by Repressing AMPK Activity and PGC-1α Expression. J. Agric. Food Chem. 2016, 64, 6517–6523. [Google Scholar] [CrossRef]
- Brook, M.S.; Wilkinson, D.J.; Smith, K.; Atherton, P.J. It’s not just about protein turnover: The role of ribosomal biogenesis and satellite cells in the regulation of skeletal muscle hypertrophy. Eur. J. Sport Sci. 2019, 19, 952–963. [Google Scholar] [CrossRef] [PubMed]
- Antonio-Santos, J.; Ferreira, D.J.; Gomes Costa, G.L.; Matos, R.J.; Toscano, A.E.; Manhães-de-Castro, R.; Leandro, C.G. Resistance Training Alters the Proportion of Skeletal Muscle Fibers but Not Brain Neurotrophic Factors in Young Adult Rats. J. Strength. Cond. Res. 2016, 30, 3531–3538. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Xu, M.; Chen, X.; Huang, Z.; Chen, D.; Yu, B.; Chen, H.; Luo, Y.; Zheng, P.; Yu, J.; He, J. Grape seed proanthocyanidin extract promotes skeletal muscle fiber type transformation via AMPK signaling pathway. J. Nut. Biochem. 2020, 84, 108462. [Google Scholar] [CrossRef]
- Yoshida, T.; Delafontaine, P. Mechanisms of IGF-1-Mediated Regulation of Skeletal Muscle Hypertrophy and Atrophy. Cells 2020, 9, 1970. [Google Scholar] [CrossRef] [PubMed]
- Meador, B.M.; Mirza, K.A.; Tian, M.; Skelding, M.B.; Reaves, L.A.; Edens, N.K.; Tisdale, M.J.; Pereira, S.L. The Green Tea Polyphenol Epigallocatechin-3-Gallate (EGCg) Attenuates Skeletal Muscle Atrophy in a Rat Model of Sarcopenia. J. Frailty Aging 2015, 4, 209–215. [Google Scholar] [CrossRef] [PubMed]
- Li, X.L.; Wang, L.; He, M.C.; Li, W.X.; Zhang, J.L.; Fu, Y.F.; Zhang, Y. A clinical herbal prescription Gu-Shu-Kang capsule exerted beneficial effects on the musculoskeletal system of dexamethasone-treated mice by acting on tissue IGF-1 signalling pathway. Pharm. Biol. 2022, 60, 2098–2109. [Google Scholar] [CrossRef] [PubMed]
- Philp, A.M.; Saner, N.J.; Lazarou, M.; Ganley, I.G.; Philp, A. The influence of aerobic exercise on mitochondrial quality control in skeletal muscle. J. Physiol. 2021, 599, 3463–3476. [Google Scholar] [CrossRef] [PubMed]
- Hood, D.A.; Memme, J.M.; Oliveira, A.N.; Triolo, M. Maintenance of Skeletal Muscle Mitochondria in Health, Exercise, and Aging. Annu. Rev. Physiol. 2019, 81, 19–41. [Google Scholar] [CrossRef] [PubMed]
- Ryall, J.G.; Dell’Orso, S.; Derfoul, A.; Juan, A.; Zare, H.; Feng, X.; Clermont, D.; Koulnis, M.; Gutierrez-Cruz, G.; Fulco, M.; et al. The NAD+-dependent SIRT1 deacetylase translates a metabolic switch into regulatory epigenetics in skeletal muscle stem cells. Cell Stem Cell 2015, 16, 171–183. [Google Scholar] [CrossRef] [PubMed]
- Sligar, J.; Debruin, D.; Saner, N.; Philp, A.; Philp, A. The importance of mitochondrial quality control for maintaining skeletal muscle function across health span. Am. J. Physiol. Cell Physiol. 2022, 322, C461–C467. [Google Scholar] [CrossRef] [PubMed]
- Asakura, S.; Hosoda, R.; Kuno, A.; Horio, Y. SIRT1, an NAD+-dependent protein deacetylase, maintains oxidative muscle fiber in the skeletal muscle and contributes to exercise capacity in mice. Proc. Annu. Meet. Jpn. Pharmacol. Soc. 2020, 93, 1. [Google Scholar] [CrossRef]
- Hejazi, K.; Attarzadeh Hosseini, S.R.; Fathi, M.; Mosaferi Ziaaldini, M. The Regulation of the Concentrations of Peroxisome Proliferator-Activated Receptor Gamma Coactivator 1-Alpha and Sirtuin 1 Protein in the Soleus Muscle by Aerobic Exercise Training in Obese Wistar Rats. J. Kermanshah Univ. Med. Sci. 2020, 24, e101849. [Google Scholar] [CrossRef]
- Thomson, D.M. The Role of AMPK in the Regulation of Skeletal Muscle Size, Hypertrophy, and Regeneration. Int. J. Mol. Sci. 2018, 19, 3125. [Google Scholar] [CrossRef]
- DiNicolantonio, J.J.; McCarty, M.F.; Assanga, S.I.; Lujan, L.L.; O’Keefe, J.H. Ferulic acid and berberine, via Sirt1 and AMPK, may act as cell cleansing promoters of healthy longevity. Open Heart 2022, 9, e001801. [Google Scholar] [CrossRef] [PubMed]
- Gomez-Cabrera, M.C.; Domenech, E.; Romagnoli, M.; Arduini, A.; Borras, C.; Pallardo, F.V.; Sastre, J.; Viña, J. Oral administration of vitamin C decreases muscle mitochondrial biogenesis and hampers training-induced adaptations in endurance performance. Am. J. Clin. Nutr. 2008, 87, 142–149. [Google Scholar] [CrossRef] [PubMed]
- Paulsen, G.; Cumming, K.T.; Holden, G.; Hallén, J.; Rønnestad, B.R.; Sveen, O.; Skaug, A.; Paur, I.; Bastani, N.E.; Østgaard, H.N.; et al. Vitamin C and E supplementation hampers cellular adaptation to endurance training in humans: A double-blind, randomised, controlled trial. J. Physiol. 2014, 592, 1887–1901. [Google Scholar] [CrossRef]
- Hindupur, S.K.; González, A.; Hall, M.N. The opposing actions of target of rapamycin and AMP-activated protein kinase in cell growth control. Cold Spring Harb. Perspect. Biol. 2015, 7, a019141. [Google Scholar] [CrossRef] [PubMed]
Gene GenBank Accession No. | Forward | Reverse |
---|---|---|
Myh1 NM_030679 | AGAAGCTCCTGGGATCCATT | CTCTCGCCAAGTACCCTCTG |
Myh2 NM_00103954 | GAGCAAAGATGCAGGGAAAG | TAAGGGTTGACGGTGACACA |
Myh4 NM_010855 | GGGGCTGTACCAGAAATCCG | CCTGAAGAGAGCTGACACGG |
Myh7 NM_080728 | AGATGAATGCCGAGCTCACT | CTCATCCAAACCAGCCATCT |
Sod1 NM_011434 | GAACCAGTTGTGTTGTCAG | GTACAGCCTTGTGTATTGTC |
Sod2 NM_013671 | CAACTCAGGTCGCTCTTC | TGATAGCCTCCAGCAACT |
Cat NM_009804 | GATGGAGAGGCAGTCTATTG | ATTGGCGATGGCATTGAA |
Nqo1 NM_008706 | CGAATCTGACCTCTATGCTAT | GCGTCCTTCCTTATATGCTA |
Nos2 NM_010927 | GCAAACCCAAGGTCTACGTTCA | GAGCACGCTGAGTACCTCATTG |
Nos3 NM_008713 | GGCTCTCACCTACTTCCT | GGCTCTCACCTACTTCCT |
Igf1 NM_010512 | CGCTCTGCTTGCTCACCTTCAC | CCTCGGTCCACACACGAACTGA |
Sirt1 NM_019812 | ACGGTATCTATGCTCGCCTTGC | GACACAGAGACGGCTGGAACTG |
Nrf1 NM_010938 | GTGGGACAGCAAGCGATTGTAC | GTGGGACAGCAAGCGATTGTAC |
Tfam NM_009360 | GTGGGACAGCAAGCGATTGTAC | CTTCAGCCATCTGCTCTTCC |
Ppargc1a(Pgc-1alpha) NM_008904 | ACACAACCGCAGTCGCAACAT | GCAGTTCCAGAGAGTTCCACACTT |
Rps18 NM_011296 | TTCTGGCCAACGGTCTAGACAAC | CCAGTGGTCTTGGTGTGCTGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tong, Y.; Ma, S.; Awa, R.; Tagawa, T.; Seki, Y.; Cao, T.; Kobori, H.; Suzuki, K. Effects of 3-(4-Hydroxy-3-methoxyphenyl)propionic Acid on Regulating Oxidative Stress and Muscle Fiber Composition. Nutrients 2025, 17, 668. https://doi.org/10.3390/nu17040668
Tong Y, Ma S, Awa R, Tagawa T, Seki Y, Cao T, Kobori H, Suzuki K. Effects of 3-(4-Hydroxy-3-methoxyphenyl)propionic Acid on Regulating Oxidative Stress and Muscle Fiber Composition. Nutrients. 2025; 17(4):668. https://doi.org/10.3390/nu17040668
Chicago/Turabian StyleTong, Yishan, Sihui Ma, Riyo Awa, Takashi Tagawa, Yasuhiro Seki, Tiehan Cao, Haruki Kobori, and Katsuhiko Suzuki. 2025. "Effects of 3-(4-Hydroxy-3-methoxyphenyl)propionic Acid on Regulating Oxidative Stress and Muscle Fiber Composition" Nutrients 17, no. 4: 668. https://doi.org/10.3390/nu17040668
APA StyleTong, Y., Ma, S., Awa, R., Tagawa, T., Seki, Y., Cao, T., Kobori, H., & Suzuki, K. (2025). Effects of 3-(4-Hydroxy-3-methoxyphenyl)propionic Acid on Regulating Oxidative Stress and Muscle Fiber Composition. Nutrients, 17(4), 668. https://doi.org/10.3390/nu17040668