In Silico-Based Design of a Hybrid Peptide with Antimicrobial Activity against Multidrug-Resistant Pseudomonas aeruginosa Using a Spider Toxin Peptide
Abstract
:1. Introduction
2. Results
2.1. Identification of Toxin Peptide Lycotoxin-Pa1a from the Transcriptome of Pardosa astrigera Spider Venom Gland
2.2. Design and Characterization of a Hybrid Peptide Based on Computational Approach
2.3. Anti-Microbial Activities of Lytx-Pa1a and KFH-Pa1a
2.4. Induction of Bacterial Membrane Disruption upon Lytx-Pa1a and KFH-Pa1a Treatment
2.5. ROS Production and Bacterial DNA Cleavage by KFH-Pa1a
2.6. Synergistic Effect of KFH-Pa1a in Combination with Conventional Antibiotics
3. Discussion
4. Materials and Methods
4.1. In Silico Analyses of Peptide Sequences
4.2. Peptide Synthesis and Preparation
4.3. Bacterial Strains and Cell Line
4.4. Antimicrobial Activity Measurement
4.5. Cell Viability Assay
4.6. Hemolytic Activity
4.7. FE-SEM Imaging
4.8. Membrane Depolarization Measurement
4.9. LDH Release Assay
4.10. ROS Measurement
4.11. Agarose Gel Electrophoresis
4.12. qRT-PCR
4.13. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hutchings, M.I.; Truman, A.W.; Wilkinson, B. Antibiotics: Past, present and future. Curr. Opin. Microbiol. 2019, 51, 72–80. [Google Scholar] [CrossRef] [PubMed]
- Cook, M.A.; Wright, G.D. The past, present, and future of antibiotics. Sci. Transl. Med. 2022, 14, eabo7793. [Google Scholar] [CrossRef] [PubMed]
- Kohanski, M.A.; Dwyer, D.J.; Collins, J.J. How antibiotics kill bacteria: From targets to networks. Nat. Rev. Microbiol. 2010, 8, 423–435. [Google Scholar] [CrossRef] [PubMed]
- Tacconelli, E.; Carrara, E.; Savoldi, A.; Harbarth, S.; Mendelson, M.; Monnet, D.L.; Pulcini, C.; Kahlmeter, G.; Kluytmans, J.; Carmeli, Y.; et al. Discovery, research, and development of new antibiotics: The WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect. Dis. 2018, 18, 318–327. [Google Scholar] [CrossRef]
- Terreni, M.; Taccani, M.; Pregnolato, M. New Antibiotics for Multidrug-Resistant Bacterial Strains: Latest Research Developments and Future Perspectives. Molecules 2021, 26, 2671. [Google Scholar] [CrossRef]
- Årdal, C.; Balasegaram, M.; Laxminarayan, R.; McAdams, D.; Outterson, K.; Rex, J.H.; Sumpradit, N. Antibiotic development—Economic, regulatory and societal challenges. Nat. Rev. Microbiol. 2020, 18, 267–274. [Google Scholar] [CrossRef] [PubMed]
- Utkin, Y.N. Animal venom studies: Current benefits and future developments. World J. Biol. Chem. 2015, 6, 28–33. [Google Scholar] [CrossRef]
- Calvete, J.J. Venomics: Integrative venom proteomics and beyond*. Biochem. J. 2017, 474, 611–634. [Google Scholar] [CrossRef]
- Koch, T.L.; Torres, J.P.; Baskin, R.P.; Salcedo, P.F.; Chase, K.; Olivera, B.M.; Safavi-Hemami, H. A toxin-based approach to neuropeptide and peptide hormone discovery. Front. Mol. Neurosci. 2023, 16, 1176662. [Google Scholar] [CrossRef]
- Ma, R.; Mahadevappa, R.; Kwok, H.F. Venom-based peptide therapy: Insights into anti-cancer mechanism. Oncotarget 2017, 8, 100908. [Google Scholar] [CrossRef]
- Gui, J.; Liu, B.; Cao, G.; Lipchik, A.M.; Perez, M.; Dekan, Z.; Mobli, M.; Daly, N.L.; Alewood, P.F.; Parker, L.L.; et al. A Tarantula-Venom Peptide Antagonizes the TRPA1 Nociceptor Ion Channel by Binding to the S1–S4 Gating Domain. Curr. Biol. 2014, 24, 473–483. [Google Scholar] [CrossRef]
- Coulter-Parkhill, A.; McClean, S.; Gault, V.A.; Irwin, N. Therapeutic Potential of Peptides Derived from Animal Venoms: Current Views and Emerging Drugs for Diabetes. Clin. Med. Insights Endocrinol. Diabetes 2021, 14, 11795514211006071. [Google Scholar] [CrossRef] [PubMed]
- Vassilevski, A.A.; Kozlov, S.A.; Grishin, E.V. Molecular diversity of spider venom. Biochemistry 2009, 74, 1505–1534. [Google Scholar] [CrossRef]
- Perumal Samy, R.; Stiles, B.G.; Franco, O.L.; Sethi, G.; Lim, L.H.K. Animal venoms as antimicrobial agents. Biochem. Pharmacol. 2017, 134, 127–138. [Google Scholar] [CrossRef] [PubMed]
- Saez, N.J.; Senff, S.; Jensen, J.E.; Er, S.Y.; Herzig, V.; Rash, L.D.; King, G.F. Spider-Venom Peptides as Therapeutics. Toxins 2010, 2, 2851–2871. [Google Scholar] [CrossRef] [PubMed]
- von Reumont, B.M.; Anderluh, G.; Antunes, A.; Ayvazyan, N.; Beis, D.; Caliskan, F.; Crnković, A.; Damm, M.; Dutertre, S.; Ellgaard, L.; et al. Modern venomics—Current insights, novel methods, and future perspectives in biological and applied animal venom research. GigaScience 2022, 11, giac048. [Google Scholar]
- Amorim, F.G.; Redureau, D.; Crasset, T.; Freuville, L.; Baiwir, D.; Mazzucchelli, G.; Menzies, S.K.; Casewell, N.R.; Quinton, L. Next-Generation Sequencing for Venomics: Application of Multi-Enzymatic Limited Digestion for Inventorying the Snake Venom Arsenal. Toxins 2023, 15, 357. [Google Scholar] [CrossRef]
- Romano, J.D. Omics Methods in Toxins Research-A Toolkit to Drive the Future of Scientific Inquiry. Toxins 2022, 14, 761. [Google Scholar] [CrossRef]
- Negi, S.S.; Schein, C.H.; Ladics, G.S.; Mirsky, H.; Chang, P.; Rascle, J.B.; Kough, J.; Sterck, L.; Papineni, S.; Jez, J.M.; et al. Functional classification of protein toxins as a basis for bioinformatic screening. Sci. Rep. 2017, 7, 13940. [Google Scholar] [CrossRef]
- Mason, A.J.; Margres, M.J.; Strickland, J.L.; Rokyta, D.R.; Sasa, M.; Parkinson, C.L. Trait differentiation and modular toxin expression in palm-pitvipers. BMC Genom. 2020, 21, 147. [Google Scholar] [CrossRef]
- Dean, S.N.; Alvarez, J.A.E.; Zabetakis, D.; Walper, S.A.; Malanoski, A.P. PepVAE: Variational Autoencoder Framework for Antimicrobial Peptide Generation and Activity Prediction. Front. Microbiol. 2021, 12, 725727. [Google Scholar] [CrossRef] [PubMed]
- Lee, B.; Shin, M.K.; Kim, T.; Shim, Y.J.; Joo, J.W.J.; Sung, J.S.; Jang, W. Prediction Models for Identifying Ion Channel-Modulating Peptides via Knowledge Transfer Approaches. IEEE J. Biomed. Health Inform. 2022, 26, 6150–6160. [Google Scholar] [CrossRef] [PubMed]
- Muttenthaler, M.; King, G.F.; Adams, D.J.; Alewood, P.F. Trends in peptide drug discovery. Nat. Rev. Drug Discov. 2021, 20, 309–325. [Google Scholar] [CrossRef] [PubMed]
- Koehbach, J.; Craik, D.J. The Vast Structural Diversity of Antimicrobial Peptides. Trends Pharmacol. Sci. 2019, 40, 517–528. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Wang, N.; Zhang, W.; Cheng, X.; Yan, Z.; Shao, G.; Wang, X.; Wang, R.; Fu, C. Therapeutic peptides: Current applications and future directions. Signal Transduct. Target. Ther. 2022, 7, 48. [Google Scholar] [CrossRef]
- Alford, M.A.; Baquir, B.; Santana, F.L.; Haney, E.F.; Hancock, R.E.W. Cathelicidin Host Defense Peptides and Inflammatory Signaling: Striking a Balance. Front. Microbiol. 2020, 11, 1902. [Google Scholar] [CrossRef] [PubMed]
- de Barros, E.; Gonçalves, R.M.; Cardoso, M.H.; Santos, N.C.; Franco, O.L.; Cândido, E.S. Snake Venom Cathelicidins as Natural Antimicrobial Peptides. Front. Pharmacol. 2019, 10, 1415. [Google Scholar] [CrossRef]
- Ji, M.; Zhu, T.; Xing, M.; Luan, N.; Mwangi, J.; Yan, X.; Mo, G.; Rong, M.; Li, B.; Lai, R.; et al. An Antiviral Peptide from Alopecosa nagpag Spider Targets NS2B–NS3 Protease of Flaviviruses. Toxins 2019, 11, 584. [Google Scholar] [CrossRef]
- Shiba, K. Natural and artificial peptide motifs: Their origins and the application of motif-programming. Chem. Soc. Rev. 2010, 39, 117–126. [Google Scholar] [CrossRef] [PubMed]
- Saito, H.; Kashida, S.; Inoue, T.; Shiba, K. The role of peptide motifs in the evolution of a protein network. Nucleic Acids Res. 2007, 35, 6357–6366. [Google Scholar] [CrossRef]
- Shiba, K. Exploitation of peptide motif sequences and their use in nanobiotechnology. Curr. Opin. Biotechnol. 2010, 21, 412–425. [Google Scholar] [CrossRef]
- Sankararamakrishnan, R.; Verma, S.; Kumar, S. ATCUN-like metal-binding motifs in proteins: Identification and characterization by crystal structure and sequence analysis. Proteins 2005, 58, 211–221. [Google Scholar] [CrossRef] [PubMed]
- Maiti, B.K.; Govil, N.; Kundu, T.; Moura, J.J.G. Designed Metal-ATCUN Derivatives: Redox- and Non-redox-Based Applications Relevant for Chemistry, Biology, and Medicine. iScience 2020, 23, 101792. [Google Scholar] [CrossRef] [PubMed]
- Shin, M.K.; Hwang, I.-W.; Kim, Y.; Kim, S.T.; Jang, W.; Lee, S.; Bang, W.Y.; Bae, C.-H.; Sung, J.-S. Antibacterial and Anti-Inflammatory Effects of Novel Peptide Toxin from the Spider Pardosa astrigera. Antibiotics 2020, 9, 422. [Google Scholar] [CrossRef] [PubMed]
- Benfield, A.H.; Henriques, S.T. Mode-of-Action of Antimicrobial Peptides: Membrane Disruption vs. Intracellular Mechanisms. Front. Med. Technol. 2020, 2, 610997. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.-Y.; Yan, Z.-B.; Meng, Y.-M.; Hong, X.-Y.; Shao, G.; Ma, J.-J.; Cheng, X.-R.; Liu, J.; Kang, J.; Fu, C.-Y. Antimicrobial peptides: Mechanism of action, activity and clinical potential. Mil. Med. Res. 2021, 8, 48. [Google Scholar] [CrossRef]
- Bordon, K.C.F.; Cologna, C.T.; Fornari-Baldo, E.C.; Pinheiro-Júnior, E.L.; Cerni, F.A.; Amorim, F.G.; Anjolette, F.A.P.; Cordeiro, F.A.; Wiezel, G.A.; Cardoso, I.A.; et al. From Animal Poisons and Venoms to Medicines: Achievements, Challenges and Perspectives in Drug Discovery. Front. Pharmacol. 2020, 11, 1132. [Google Scholar] [CrossRef] [PubMed]
- Herzig, V.; Cristofori-Armstrong, B.; Israel, M.R.; Nixon, S.A.; Vetter, I.; King, G.F. Animal toxins—Nature’s evolutionary-refined toolkit for basic research and drug discovery. Biochem. Pharmacol. 2020, 181, 114096. [Google Scholar] [CrossRef]
- Lüddecke, T.; Herzig, V.; von Reumont, B.M.; Vilcinskas, A. The biology and evolution of spider venoms. Biol. Rev. 2022, 97, 163–178. [Google Scholar] [CrossRef] [PubMed]
- Langenegger, N.; Nentwig, W.; Kuhn-Nentwig, L. Spider Venom: Components, Modes of Action, and Novel Strategies in Transcriptomic and Proteomic Analyses. Toxins 2019, 11, 611. [Google Scholar] [CrossRef]
- Greve, J.M.; Cowan, J.A. Activity and Synergy of Cu-ATCUN Antimicrobial Peptides. Int. J. Mol. Sci. 2022, 23, 14151. [Google Scholar] [CrossRef]
- Portelinha, J.; Duay, S.S.; Yu, S.I.; Heilemann, K.; Libardo, M.D.J.; Juliano, S.A.; Klassen, J.L.; Angeles-Boza, A.M. Antimicrobial Peptides and Copper(II) Ions: Novel Therapeutic Opportunities. Chem. Rev. 2021, 121, 2648–2712. [Google Scholar] [CrossRef] [PubMed]
- Melino, S.; Santone, C.; Di Nardo, P.; Sarkar, B. Histatins: Salivary peptides with copper(II)- and zinc(II)-binding motifs. FEBS J. 2014, 281, 657–672. [Google Scholar] [CrossRef] [PubMed]
- Di Natale, C.; De Benedictis, I.; De Benedictis, A.; Marasco, D. Metal–Peptide Complexes as Promising Antibiotics to Fight Emerging Drug Resistance: New Perspectives in Tuberculosis. Antibiotics 2020, 9, 337. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; Cowan, J.A. DNA Cleavage by Copper−ATCUN Complexes. Factors Influencing Cleavage Mechanism and Linearization of dsDNA. J. Am. Chem. Soc. 2005, 127, 8408–8415. [Google Scholar] [CrossRef]
- Rasouly, A.; Nudler, E. Reactive oxygen species as the long arm of bactericidal antibiotics. Proc. Natl. Acad. Sci. USA 2019, 116, 9696–9698. [Google Scholar] [CrossRef]
- Kim, S.Y.; Park, C.; Jang, H.-J.; Kim, B.-o.; Bae, H.-W.; Chung, I.-Y.; Kim, E.S.; Cho, Y.-H. Antibacterial strategies inspired by the oxidative stress and response networks. J. Microbiol. 2019, 57, 203–212. [Google Scholar] [CrossRef] [PubMed]
- Adékambi, T.; Drancourt, M.; Raoult, D. The rpoB gene as a tool for clinical microbiologists. Trends Microbiol. 2009, 17, 37–45. [Google Scholar] [CrossRef] [PubMed]
- Gautier, R.; Douguet, D.; Antonny, B.; Drin, G. HELIQUEST: A web server to screen sequences with specific α-helical properties. Bioinformatics 2008, 24, 2101–2102. [Google Scholar] [CrossRef]
- Rey, J.; Murail, S.; de Vries, S.; Derreumaux, P.; Tuffery, P. PEP-FOLD4: A pH-dependent force field for peptide structure prediction in aqueous solution. Nucleic Acids Res. 2023, 51, W432–W437. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.-T.; Lee, C.-C.; Yang, J.-R.; Lai, J.Z.C.; Chang, K.Y. A Large-Scale Structural Classification of Antimicrobial Peptides. BioMed Res. Int. 2015, 2015, 475062. [Google Scholar] [CrossRef] [PubMed]
- Burdukiewicz, M.; Sidorczuk, K.; Rafacz, D.; Pietluch, F.; Chilimoniuk, J.; Rödiger, S.; Gagat, P. Proteomic Screening for Prediction and Design of Antimicrobial Peptides with AmpGram. Int. J. Mol. Sci. 2020, 21, 4310. [Google Scholar] [CrossRef] [PubMed]
- Pirtskhalava, M.; Amstrong, A.A.; Grigolava, M.; Chubinidze, M.; Alimbarashvili, E.; Vishnepolsky, B.; Gabrielian, A.; Rosenthal, A.; Hurt, D.E.; Tartakovsky, M. DBAASP v3: Database of antimicrobial/cytotoxic activity and structure of peptides as a resource for development of new therapeutics. Nucleic Acids Res. 2020, 49, D288–D297. [Google Scholar] [CrossRef] [PubMed]
- Waghu, F.H.; Barai, R.S.; Gurung, P.; Idicula-Thomas, S. CAMPR3: A database on sequences, structures and signatures of antimicrobial peptides. Nucleic Acids Res 2016, 44, D1094–D1097. [Google Scholar] [CrossRef] [PubMed]
- Chaudhary, K.; Kumar, R.; Singh, S.; Tuknait, A.; Gautam, A.; Mathur, D.; Anand, P.; Varshney, G.C.; Raghava, G.P.S. A Web Server and Mobile App for Computing Hemolytic Potency of Peptides. Sci. Rep. 2016, 6, 22843. [Google Scholar] [CrossRef] [PubMed]
Peptide | Length | Molecular Weight | Net Charge | Water Solubility | Hydrophobic Face |
---|---|---|---|---|---|
Lytx-Pa1a | 23 | 2586.15 | +5.1 | Good | None |
KFH-Pa1a | 18 | 2112.56 | +5.2 | Good | LFLGF |
Peptide | Antimicrobial Activity | Hemolytic Activity | ||||
---|---|---|---|---|---|---|
ADAM | AmpGram | DBAASPV3 | CAMPR3 * | HemoPI | DBAASP | |
Lytx-Pa1a | 1.86 | 1.000 | AMP | 0.816 | 0.50 | Not Active |
KFH-Pa1a | 2.96 | 1.000 | AMP | 0.925 | 0.46 | Not Active |
Gene | Forward | Reverse |
---|---|---|
E. coli 16s | CACACTGGAACTGAGACACG | GCTTCTTCTGCGGGTAACG |
E. coli polA | ATGGTTCAGATCCCCCAA | TTCTACGCCAGAAACCGCCA |
E. coli rpoB | AGACCGTTTCACCACCATCC | TCGGCGTTACCTTACCAACC |
S. aureus 16s | GTAGGTGGCAAGCGTTATCC | CGCACATCAGCGTCAG |
S. aureus polA | TTCATTGGAAGAAGCGGCCA | AACCATGAAACTAGTTCGGCA |
S. aureus rpoB | GAACATGCAACGTCAAGCAG | AATAGCCGCACCAGAATCAC |
P. aeruginosa 16s | CAAAACTACTGAGCTAGAGTACG | TAAGATCTCAAGGATCCCAACGGGT |
P. aeruginosa polA | TCAACACCATGACCGGTAGC | GGGGATGTTGTCGACCTTGT |
P. aeruginosa rpoB | CTGATCATCTTCGACCGCGA | TTCTCGGTCATCAGGGGGAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shin, M.K.; Park, H.-R.; Hwang, I.-W.; Bu, K.-B.; Jang, B.-Y.; Lee, S.-H.; Oh, J.W.; Yoo, J.S.; Sung, J.-S. In Silico-Based Design of a Hybrid Peptide with Antimicrobial Activity against Multidrug-Resistant Pseudomonas aeruginosa Using a Spider Toxin Peptide. Toxins 2023, 15, 668. https://doi.org/10.3390/toxins15120668
Shin MK, Park H-R, Hwang I-W, Bu K-B, Jang B-Y, Lee S-H, Oh JW, Yoo JS, Sung J-S. In Silico-Based Design of a Hybrid Peptide with Antimicrobial Activity against Multidrug-Resistant Pseudomonas aeruginosa Using a Spider Toxin Peptide. Toxins. 2023; 15(12):668. https://doi.org/10.3390/toxins15120668
Chicago/Turabian StyleShin, Min Kyoung, Hye-Ran Park, In-Wook Hwang, Kyung-Bin Bu, Bo-Young Jang, Seung-Ho Lee, Jin Wook Oh, Jung Sun Yoo, and Jung-Suk Sung. 2023. "In Silico-Based Design of a Hybrid Peptide with Antimicrobial Activity against Multidrug-Resistant Pseudomonas aeruginosa Using a Spider Toxin Peptide" Toxins 15, no. 12: 668. https://doi.org/10.3390/toxins15120668