Next Article in Journal
Mycotoxins in Portuguese Agricultural Maize Fields and Dairy Farms
Previous Article in Journal
Molecular Screening for Cyanobacteria and Their Cyanotoxin Potential in Diverse Habitats
Previous Article in Special Issue
Metabolome and Its Mechanism Profiling in the Synergistic Toxic Effects Induced by Co-Exposure of Tenuazonic Acid and Patulin in Caco-2 Cells
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Toxins
Volume 16
Issue 8
10.3390/toxins16080334
toxins-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antioxidative and Antimycotoxigenic Efficacies of Thunbergia laurifolia Lindl. for Addressing Aflatoxicosis in Cherry Valley Ducks

by
Chompunut Lumsangkul
1,2,3,*,
Phruedrada Kaewtui
1,
Kiattisak Huanhong
1 and
Ko-Hua Tso
4,*
1
Department of Animal and Aquatic Sciences, Faculty of Agriculture, Chiang Mai University, Chiang Mai 50200, Thailand
2
Multidisciplinary Research Institute, Chiang Mai University, 239 Huay Keaw Rd., Chiang Mai 50200, Thailand
3
Department of Animal Science, National Chung Hsing University, Taichung 40227, Taiwan
4
Dr. Bata Ltd., Bajcsy-Zs. u. 139, H-2364 Ócsa, Hungary
*
Authors to whom correspondence should be addressed.
Toxins 2024, 16(8), 334; https://doi.org/10.3390/toxins16080334
Submission received: 9 June 2024 / Revised: 17 July 2024 / Accepted: 25 July 2024 / Published: 27 July 2024
(This article belongs to the Special Issue Toxicity Assessment, Rapid Detection and Control of Foodborne Mycotoxins: Advances and Prospects)
Browse Figures
Versions Notes

Abstract

:
This study aimed to assess the effectiveness of aflatoxin B1 (AFB1) and Thunbergia laurifolia extract (TLE) in the diets of Cherry Valley ducklings. Our investigation covered growth indicators, blood biochemical indices, meat quality, intestinal morphology, immune response, and CP450 enzyme-related gene expression. We conducted the study with 180 seven-day-old Cherry Valley ducks, randomly divided into five dietary treatments. These treatments included a basal diet without AFB1 (T1 group), TLE, or a commercial binder; the basal diet containing 0.1 mg AFB1/kg (T2 group), 0.1 mg AFB1/kg and 100 mg TLE/kg (T3 group), 0.1 mg AFB1/kg and 200 mg TLE/kg (T4 group), and 0.1 mg AFB1/kg and 0.5 g/kg of a commercial binder (T5 group), respectively. Ducklings fed with the T2 diet exhibited lower final body weight (BW), average body weight gain (ADG), and poor feed conversion ratio (FCR) during the 42-day trials. However, all ducklings in the T3, T4, and T5 groups showed significant improvements in final BW, ADG, and FCR compared to the T2 group. Increased alanine transaminase (ALT) concentration and increased expression of CYP1A1 and CYP1A2 indicated hepatotoxicity in ducklings fed the T2 diet. In contrast, ducklings fed T3, T4, and T5 diets all showed a decrease in the expression of CYP1A1 and CYP1A2, but only the T4 treatment group showed improvement in ALT concentration. AFB1 toxicity considerably raised the crypt depth (CD) in both the duodenum and jejunum of the T2 group, while the administration of 200 mg TLE/kg (T4) or a commercial binder (T5) effectively reduced this toxicity. Additionally, the villus width of the jejunum in the T2 treatment group decreased significantly, while all T3, T4, and T5 groups showed improvement in this regard. In summary, T. laurifolia extract can detoxify aflatoxicosis, leading to growth reduction and hepatic toxicosis in Cherry Valley ducklings.
Keywords:
antimycotoxigenic; aflatoxin B1; cherry valley ducks; Thunbergia laurifolia extract
Key Contribution: This is the first study to completely evaluate the detoxification ability of Thunbergia laurifolia on aflatoxin B1 through growth performance, biochemical indices, carcass traits, meat quality, intestinal morphology, immune response, and CP450 enzyme gene reaction in Cherry Valley Ducks.

1. Introduction

Aflatoxins are secondary fungal metabolites, or mycotoxins, primarily produced by toxigenic strains of the fungi Aspergillus flavus and Aspergillus parasiticus [1]. These mycotoxins are classified as carcinogenic furanocoumarins and consist of twenty related polycyclic structures [2]. Aflatoxin B1 (AFB1), the most toxic and prevalent aflatoxin, causes oxidative stress, leading to severe hepatoxicity. It also inhibits growth and reproductive performance in poultry, resulting in significant negative effects on animal health, food security, and economic trade [3,4,5]. Aflatoxins pose a particular problem in hot and dry climates that favor mycotoxigenic fungal growth. Therefore, one of the most severely contaminated areas of AFB1 in the world is Southeast Asia, especially Thailand, which often experiences higher levels of contamination [6]. Previous research indicated that 38.9% of 3206 samples were highly contaminated with aflatoxin, and the prevalence of aflatoxin reached 44.3% in local corn samples [7].
Poultry aflatoxicosis, traced back to the 1960 outbreak of turkey X diseases in the UK, remains a significant threat to the global poultry industry today [8]. Aflatoxin-contaminated feeds, exacerbated by climate change, continue to cause poor growth performance, compromised reproductive ability, liver necrosis, and bile duct hyperplasia in poultry, leading to substantial economic losses [9]. The detrimental impact extends to bone metabolism, resulting in a weakened skeletal structure and decreased meat yield [10]. Among poultry species, ducklings exhibit the highest sensitivity to AFB1 [11,12] because waterfowls have high levels of unsaturated fatty acids in their body tissues, making them more susceptible to lipid peroxidation induced by AFB1 [13,14,15]. For ducklings, the mortality rates reached 100% at 1 mg/kg AFB1 [10]. Public health concerns arise from aflatoxin residues in poultry products (e.g., eggs and meat), posing risks ranging from mild liver issues to carcinogenesis in consumers [16]. These challenges underscore the urgent need for stringent regulations and effective mitigation strategies to safeguard poultry welfare and human health while preserving the economic viability of the poultry industry.
The physical characteristics of aflatoxins include high heat stability and polarity [17]. Hence, the efficacy of detoxifying AFB1 via thermal inactivation is relatively limited. On the other hand, because of the high polarity of aflatoxins, binders exhibit high adsorption ability, making binder supplements the main detoxifying strategy of AFBs in current farms and feed mills [18]. However, binders not only remove AFB1 but also absorb some nutrition compounds (e.g., zinc and vitamin B group) in feed [19]. The long-term addition of high amounts of adsorbents can cause zinc deficiency, leading to poultry being unable to stand [20]. Phytobiotic feed additives with antioxidant functions appear to be a good choice for detoxifying AFB1 in poultry. When the feed contains high levels of AFB1, phytobiotic feed additives with antioxidant functions can neutralize the mycotoxin toxicities for poultry. When the content is low, they can have multiple uses (e.g., improving immunity and growth traits) for birds [21,22].
Thunbergia laurifolia (Rang chuet) extract (TLE) is widely used for neutralizing toxicities from various toxins [23,24]. It is also a common antidote for several poisonous agents in Thai traditional medicine [25,26]. In addition, TLE contains phenolic compounds, which are involved in anti-inflammation and antioxidants [27,28]. Several papers have reported that apigenin, one of the flavonoid compounds in TLE [29], has antioxidant [30] and anticancer properties [31]. The main toxicity of AFB1 is oxidative stress occurrence via reactive oxygen species production [32]. We hypothesized that TLE had the potential to inhibit aflatoxicosis through its antioxidant ability. In addition, there is no available data about the effects of these herbal medicine products on the duck. Therefore, the poultry industry should develop alternative strategies for detoxifying mycotoxins by TLE in ducks. Hence, the objectives of this research are to comprehensively assess the effects of AFB1 along with TLE as a natural feed additive in duckling diet on the growth performance, serum biochemical parameters, intestine morphology, carcass traits, meat quality, and immunity responses of Cherry Vally ducks.

2. Results

2.1. Phytochemical and Antioxidant Activity of T. laurifolia Extracts

The results showed that the total phenol compound was 0.56 mg GAE/g, and the antioxidant activity, as indicated by the values of 2,2-diphenyl-1-picrylhydrazyl radical (DPPH), 2,2-azino-bis (3-ethylbenzothiazo-line-6-sulfonic acid) (ABTS), and ferric reducing antioxidant power (FRAP), amounted to 7.26 μmol Trolox equivalents (TE)/g, 3.70, and 51.26 mM Fe2+/g, respectively (Table 1).

2.2. Growth Performance

The average daily gain (ADG), the average daily feed intake (ADFI), and the feed conversion ratio (FCR) are presented in Table 2. The final body weight (BW) and ADG were significantly (p < 0.05) reduced by AFB1 during the growth phase (7 to 42 days). However, feeding T. laurifolia extract and commercial mycotoxin binder along with AFB1 significantly improved ADG during days 7–42. There was no significant difference in ADFI between the groups. The FCR during 7 to 42 days was significantly (p < 0.05) higher in the AFB1-challenged groups. Nevertheless, feeding T. laurifolia extract and a commercial mycotoxin binder significantly enhanced the FCR compared to AFB1-fed birds, and it was comparable to that of ducks in the control group.

2.3. Blood Biochemistry

Aflatoxin B1 exhibited significant toxic effects by significantly increasing (p < 0.05) the levels of total cholesterol, triglyceride, aspartate transaminase (AST), and globulin (Table 3) in serum biochemical values. When the AFB1-contaminated diet was supplemented with 100 and 200 mg/kg of TLE or 0.5 g/kg of commercial binder, lower concentrations of AST were observed in the serum of the ducklings compared to those fed without these detoxifying agents (p < 0.001). Additionally, the AST values in ducklings fed the AFB1-contaminated diet with TLE treatment were significantly reduced compared to those of the commercial binder treatment.

2.4. Intestine Morphology

Aflatoxin B1 had significantly unequal effects on the different parts of the examined intestine morphology (p < 0.01, Table 4). In general, the villus height (VH) of the duodenum, jejunum, and ileum in ducklings fed the diet containing 0.1 mg/kg AFB1 was higher than those of ducklings fed the control diet. However, all detoxifying treatments did not decrease the VH but rather increased the values. Notably, AFB1 increased crypt depth (CD) in the duodenum and jejunum (p < 0.0001) but reduced CD in the ileum (p = 0.0011), while those fed with the AFB1-contaminated diet supplemented with 200 mg/kg TLE improved these phenomena. The toxicity of AFB1 yielded contrasting results in the villus width (VW) of the duodenum and jejunum. Compared to the control group, the VW in the duodenum of the AFB1-contaminated group was higher (p = 0.0015), while the VW in the jejunum of the AFB1-contaminated group was lower (p = 0.0028). Additionally, 200 mg/kg TLE ameliorated AFB1 toxicity in VW of both parts of the intestine. As for villus height per crypt depth ratio (VH:CD), only the ileum was affected by AFB1 (p = 0.013), while the treatments of 100 mg/kg TLE and 0.5 g/kg commercial binder treatments rather increased the ratio.
Light microscopy micrographs of the intestine of each experimental group were shown in Figure 1. It was observed that the photomicrograph of the jejunum sections of the control group (T1) showed normal histology of intestinal villi with normal pseudostratified epithelium with goblet cells. In contrast, the addition of 0.1 mg/kg AFB1 had a significant effect on jejunum tissue histopathology. The photomicrograph of the jejunum section of the T2 group (0.1 mg/kg AFB1) showed mucosal necrosis. Meanwhile, the photomicrograph of the jejunum section of the T3, T4, and T5 groups (AFB1 with TLE or commercial binder) showed a marked improvement in mucosal necrosis with an increase in villi integrity, especially in T4 (0.1 mg AFB1/kg and 200 mg TLE/kg) and T5 (0.1 mg AFB1/kg and 0.5 g/kg of commercial binder). There were similar results in the ileum sections. The T1 group had relatively complete and compact villus tissue. The T2 group had a looser villus structure than the T1 group due to aflatoxicosis in the ileum villus structure. The T4 and T5 groups had the effect of improving AFB1 toxicity.

2.5. Carcass Trait, Relative Organ Weight, and Meat Quality

The T. laurifolia extract and AFB1 supplementation did not influence the relative weight of carcass (excluding neck and feet), breast meat, bursa of Fabricius, or spleen, but there was a tendency for an increase (p < 0.1) in liver and gizzard weight. The relative weight of the bursa of Fabricius, spleen, breast meat, and carcass (excluding the neck and feet) was not affected by the T. laurifolia extract or AFB1 supplementation; however, there was a tendency for the liver and gizzard weight to increase (p < 0.1) in duckling fed with T2 and T3 (Table 5). Dietary treatments did not affect the pH test for 45 min and 24 h, thiobarbituric acid reactive substances (TBARS), lightness (L), redness (a), or drip loss (Table 6). However, the inclusion of AFB1 increased (p < 0.05) shear force and breast meat yellowness (b).

2.6. Expression of Immune Response and Metabolizing Cytochrome P450 Enzyme-Related Genes

T. laurifolia extract mitigated liver pathological damage caused by AFB1 in ducklings. The mRNA levels of the inflammation-related gene (TNFα) in the liver were significantly upregulated in ducks treated with AFB1 compared to those in the control and TLE groups (Figure 2). Additionally, the mRNA expression levels of CYP1A1 and CYP1A2 in the liver were increased in the AFB1 group compared with those of the control group.

3. Discussion

3.1. Antioxidative Capacity of T. laurifolia Extract

The T. laurifolia extract is a traditional Thai herbal medication known for its antioxidative capacity [33]. One of the main active ingredients of TLE is total phenolic compounds. A previous study [34] indicated a positive correlation exists for other antioxidant capacity methods, such as DPPH and FRAP with polyphenols. The present examination not only investigated the antioxidative capacity of TLE by determining the ABTS, DPPH, and FRAP but also tested the active compound phenolic content. The TLE of the current study exhibited lower activities in terms of DPPH, ABTS, and total phenolic compounds compared to another study [35]. While phytobiotics offer various significant benefits for livestock health, their drawback lies in the variability of composition influenced by factors such as harvesting season and geographical location [36]. This variability may also be one of the reasons why a higher concentration (200 mg/kg TLE) was required to have a noticeable AFB1 detoxification effect in this trial.

3.2. Aflatoxin B1 Toxicity on Growth Performance

The regulatory limit for AFB1 in the EU, FDA, and China is 0.02 mg/kg for ducklings [37,38,39]. However, this limit level serves as a precautionary measure to prevent the potential harmful accumulation of AFB1 in the bodies of animals after long-term ingestion (over four weeks). Previous research has indicated that AFB1 concentration can impair duck production, and significant hepatic lesions can occur at levels as low as 0.5 mg/kg for a short period (lower than four weeks) [40,41]. Taking into account the treatment period (five weeks), experimental efficiency, and various national regulations, we compromised and chose 0.1 mg/kg as the tested content.
It is well established that AFB1 can interfere with poultry energy metabolism, reducing growth efficiency [36,37]. Among poultry, meat ducks are susceptible to aflatoxins. A diet containing a high concentration of AFB1 can cause acute death in meat-type ducks, while prolonged exposure to low levels of AFB1 can induce chronic toxicity, resulting in growth retardation and reduced production [42]. Previous research has indicated that poultry-fed diets containing aflatoxins as low as 0.3 mg/kg started to show reductions in growth rate, and feed intake and feed efficiency worsened [43]. In the current study, the results indicated that a diet containing 0.1 mg/kg of AFB1 led to a reduction in ADG and poor FCR in ducklings. Unlike ADG and FCR, the ADFI of ducklings remained unaffected by AFB1 toxicity, which aligns with the effects of AFB1 on early young broiler research [44].

3.3. Aflatoxin B1 Toxicity on Serum Biochemical Parameters

Hepatotoxicity is the primary characteristic of AFB1 toxicity in numerous animal species [5]. Blood AST, ALT, and alkaline phosphatase (ALP) levels are commonly used as indicators when measuring the effects of aflatoxin on liver toxicity in poultry [45]. Globulin involves several physiological processes, including lipid transportation in birds [15]. Our study revealed that AFB1 altered serum biochemical parameters, leading to significantly higher levels of total cholesterol, triglycerides, AST, and globulin. However, the levels of ALT and ALP in the AFB1 group did not show a significant increase compared to the control group in our study. This may be attributed to the AFB1 concentration in this research not reaching the toxic level required for severe liver damage, which would release high amounts of ALT and ALP. The results of the relative liver weight in our experiment support this. Although the liver weights of the AFB1 group were heavier than those of the control and other treatment groups, the difference was not statistically significant. Similar results were observed in other experiments. For instance, adding over 0.5 mg/kg of AFB1 to broiler diets can increase serum ALP, ALT, and AST activities [46]. However, when the dietary AFB1 concentration was lower than 0.03 mg/kg, only serum AST levels were significantly increased in broilers [5]. The AFB1-induced increase in serum total cholesterol and triglycerides observed in this study is consistent with previous research findings [47,48]. The liver plays a crucial role in blood fatty acid metabolism [49], while AFB1 induces liver damage and can lead to abnormal triglyceride metabolism.

3.4. Aflatoxin B1 Toxicity on Intestine Morphology

Aflatoxin B1 can alter intestinal morphology, leading to reduced nutrient absorption and subsequent growth retardation [50,51]. However, the effects of AFB1 toxicities on poultry intestinal morphology are not entirely clear. This lack of clarity may stem from differences in the specific sections of the intestine, tested variables, and exposure time in previous studies [46]. Additionally, the species and age of poultry used in various studies may also play crucial roles in the intestine’s response to chronic aflatoxicosis. An earlier study indicated that AFB1 can induce morphological alterations of the intestinal epithelium by increasing the depth of the crypts, particularly in the small intestine (duodenum and jejunum) [52]. While these findings were consistent with the observations in the duodenum and jejunum, they did not align with those of the ileum in the present study. Furthermore, most research has indicated that AFB1 decreased VH in the small intestine of broilers. However, contrary to the observations in broilers [46,52], AFB1 had no effect on VH in laying hens [53]. The results of our meat duckling trial also differed from those of the broiler chicken test. Surprisingly, the VH of the duodenum, jejunum, and ileum were all significantly increased by AFB1 toxicity. Alterations in both the height and width of villi were also noted in ducks treated with AFB1. The alterations in the structure of villi were a result of the activation of the apoptotic pathway by AFB1, which subsequently may be related to the absorption of nutrients. Given the differences in these results of intestinal morphology, in addition to the abovementioned differences in varieties and sampling locations, further testing may be necessary to verify and confirm these findings.

3.5. Aflatoxin B1 Toxicity on Carcass Traits and Meat Quality

Several interesting results were observed regarding carcass traits and meat quality. In contrast to other reports [5,10], our results did not show significant changes in the relative weights of the liver and other organs. Although there was a slight increase in the AFB1-contaminated treatment group compared with the control group, this difference did not reach statistical significance. This could be attributed to the tested concentrations of AFB1 in this study causing mild hepatotoxicity that did not reach the threshold to alter liver weight. In terms of meat quality, it was discovered that the color of the meat in the AFB1-contaminated group showed a significant increase. To the best of our knowledge, there were no other poultry reports that investigated whether AFB1 changes the color of poultry meat. However, we found a sheep report [54] indicating that AFB1 altered the lightness (L value) of the meat but not the yellowness (b value). Although there were slight differences between the results of the former study and ours, these variations may be attributed to differences in animal species. Nonetheless, it is plausible that AFB1 could indeed cause changes in meat color. We speculated that disruptions in pigment metabolism and inflammatory responses associated with liver damage could also influence the color of the meat, potentially contributing to changes in its yellowness [55].

3.6. Aflatoxin B1 Toxicity on Immunity and Cytochrome P450 Enzyme-Related Genes

Aflatoxin B1 induces oxidative damage and apoptosis in hepatocyte cells and is primarily metabolized by cytochrome P450 (CYP450) enzymes [56]. In poultry liver, AFB1 is bioactivated by enzymes such as CYP1A1, CYP1A2, and other enzymes (e.g., CYP2A6 and CYP3A4). CYP450 enzymes convert AFB1 into an electrophilic, highly reactive, and unstable metabolite known as aflatoxin-8,9-epoxide (AFBO) [57,58]. This metabolite can interact with cellular macromolecules, binding to guanine residues in DNA, causing genotoxicity, and reacting with proteins to induce cytotoxicity [59]. These interactions result in irreversible DNA damage and can lead to hepatocarcinoma in humans, primates, and ducks [60]. Consistent with previous research in broiler chickens [61], our study observed that AFB1 exposure led to a significant increase in CYP1A1 and CYP1A2 mRNA expression. Additionally, our findings were consistent with previous studies, which demonstrated that AFB1 treatment increased the mRNA levels of TNF-α [62,63]. This indicates that AFB1 toxicity induces the immune response and inflammatory cytokine production in ducklings. However, the mRNA expressions of these enzymes and TNF-α were lower in groups treated with TLE and a commercial binder, suggesting that these feed additives effectively neutralize the hepatotoxic effects of AFB1.

3.7. Antimycotoxigenic Efficacies of Thunbergia laurifolia Lindl.

Aflatoxin B1 is primarily metabolized through CYP1A1 and CYP1A2, producing a highly reactive intermediate (AFBO), which induces the formation of reactive oxygen species (ROS) within hepatocytes [64]. The accumulation of ROS leads to oxidative stress, characterized by an imbalanced response between the production of reactive species and the ability of cells to detoxify or repair the damage [65]. Reactive oxygen species damage cellular components, including lipids, proteins, and DNA, initiating lipid peroxidation and compromising membrane integrity, ultimately leading to cell damage and death [66]. Oxidative damage and cellular stress induce a series of inflammatory responses in the liver, further aggravating tissue damage. Liver damage impairs critical functions, such as detoxification, protein synthesis, and nutrient metabolism, leading to reduced nutrient absorption and utilization, which contributes to poor growth performance [67].
Therefore, T. laurifolia with natural antioxidants may be a promising option to neutralize AFB1 toxicity. Much research has indicated that T. laurifolia possesses antioxidant and anti-inflammatory properties, as well as anticancer activities, due to its ability to increase catalase (CAT) and glutathione peroxidase (GPx) activities, thereby removing ROS [68,69,70]. Previous research on chickens has shown promising results using 2% T. laurifolia leaf [71]. This treatment ameliorated the adverse effects of multiple mycotoxin-contaminated feeds, improving nutrient digestibility and increasing the activity of glutathione peroxidase. However, it did not lead to a significant change in the growth rate. Our research further investigated the potential of TLE in mitigating the effects of AFB1 on growth reduction and hepatoxicity. By utilizing extracts of T. laurifolia in our study, we hypothesized that some impurities were eliminated to enhance the concentration of bioactive chemicals, such as total phenolic compounds [72]. Therefore, we only used 100 mg/kg TLE to improve the growth reduction caused by AFB1, and the treatment of 200 mg/kg TLE had a stronger detoxification ability, as observed in growth performance, serum biochemical traits, intestinal morphology, and meat quality.
Our results suggest that supplementing TLE into duckling diets could be a natural and effective detoxifying agent against AFB1 contamination. This can lead to improved growth performance, feed efficiency, and overall health in poultry, which is crucial for the poultry industry. Additionally, the study presented that TLE improves meat quality by mitigating the adverse effects of AFB1. This is critical for ensuring that the meat produced is safe and high quality. Our findings pave the way for further research into the use of TLE for detoxifying various mycotoxins in different animal species.

4. Conclusions

It can be concluded that dietary supplementation of T. laurifolia extract in ducklings ameliorated the adverse effects of AFB1 on growth performance, alleviated liver damage by increasing the drug-metabolizing enzymes (Cytochrome P450), and improved the intestinal health of ducks through participation in their detoxification.

5. Materials and Methods

5.1. Animal and Ethical Approval

A total of 180 seven-day-old Cherry Valley ducks were obtained from the Faculty of Agriculture, Chiang Mai University, Thailand. The ducks were housed in pens with strict biosecurity measures, with each treatment containing 3 replications of 12 birds each. Over the 35-day duration of the experiment, the ducks received water and feed ad libitum (Table 7). All experimental procedures in this study were conducted strictly in accordance with the recommended guidelines and were submitted for ethical approval by the Animal Ethics Committee, Faculty of Agriculture, Chiang Mai University.

5.2. Plant Materials

The mature leaves of T. laurifolia Lindl. were collected from Hangdong District, Chiang Mai Province, Thailand. The leaves were cleaned, chopped into pieces, and then oven dried at 60 °C for 24 to 48 h. Subsequently, the dried leaves were powdered using a dry grinder to obtain particles of approximately 0.2 mm in size. The powdered material was stored in a light-resistant container until it was used for the extraction studies.

5.3. Extraction Method and Phenolic Content Measurement

The procedure involved soaking the powdered T. laurifolia leaves in boiling distilled water (1:10 w/v) for one hour. Subsequently, the mixture was passed through a filter paper (Whatman No. 41) and three layers of gauze. The filtrate obtained was freeze-dried and kept in a desiccator at a temperature of 4 °C. To facilitate future use, the extract was diluted in distilled water to achieve the appropriate concentrations and then stored at a temperature of −20 °C. The Folin–Ciocalteu technique [73] was employed to quantify the total phenolic content. The extract was combined with the Folin–Ciocalteu reagent and a 7.5% (w/v) solution of NaCO3. The calibration standard for gallic acid was established by incubating it for 60 min and using a UV–Vis spectrophotometer (SPECTROstar Nano, BMG LABTECH, Ortenberg, Germany). The extract’s total phenolic content was determined in milligrams of gallic acid per gram.

5.4. Antioxidative Assays

The DPPH and ABTS radical scavenging activities were evaluated using modified methods based on Sunanta et al. [74] and Sangta et al. [44], respectively. For the DPPH assay, 25 µL of the extract was mixed with 250 µL of 0.20 mM DPPH (2,2-diphenyl-1-picrylhydrazyl) solution. The mixture was then incubated at room temperature, in the dark, for 30 min, and the absorbance was measured at 517 nm. Regarding the ABTS assay, 200 µL of the extract was mixed with 500 µL of a working solution containing 7.00 mM ABTS [2,2-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid)] and 2.45 mM potassium persulfate. The mixture was incubated in the dark at room temperature for 12–16 h, and the absorbance of the samples was measured at 734 nm. The FRAP was determined using the modified Aljadai method [75]. In this method, 10 µL of the extract was mixed with 190 µL of FRAP reagent for 30 min in the dark, and the absorbance was measured at 593 nm using ascorbic acid as a standard reference.

5.5. Treatment Diet Preparation

The powder of AFB1 standard (purity ≥ 98%) and commercial binder (Mycosorb Advance) were purchased from Sigma (Saint Louis, MO, USA) and American Colloid Company (Lovell, WY, USA), respectively. One milligram of AFB1 standard was dissolved in 100 mL of 95% ethanol (Merck, Darmstadt, Germany) to obtain 10 mg/kg AFB1 stock solutions. The prepared solution was then sprayed evenly on the basal feed and mixed to obtain the 0.1 mg/kg AFB1-contaminated diet [76,77]. The equivalent amount of ethanol without AFB1 solution was sprayed evenly on the basal feed to obtain the control diet. The treatment concentration of TLE and the commercial binder were calculated, respectively, added uniformly to the diet, and mixed evenly. Mycotoxins were detected in the basal diet using ELISA kits (R-Biopharm, Darmstadt, Germany). The analysis revealed that the quantities present in the sample were as follows: 0.012 mg/kg AFB1, 0.0212 mg/kg T-2 toxin, 0.015 mg/kg ochratoxin A, 0.035 mg/kg zearalenone, and 0.015 mg/kg deoxynivalenol, respectively.

5.6. Growth Performance

All ducklings were fed treatment diets for 35 days. The ducks were clinically observed at least twice daily, and mortality was recorded. Furthermore, the ducks were individually weighed on the age of day 7 and day 42. The performance variables measured in this study include BW, ADG, ADFI, and FCR.

5.7. Blood Characteristics

Blood samples were collected at day 42 from each treatment (6 birds) for biochemical analyses. The blood samples were then centrifuged at 3000× g for 15 min, and the serum was separated to determine liver function parameters such as AST, ALT, ALP, total protein, globulin, and albumin. All blood characteristics were measured using a BioMajesty® JCA-BM6010/C kit from DiaSys Diagnostic Systems (Holzheim, Germany) with an automated chemistry analyzer BX-301 (Asia Green, Singapore).

5.8. Relative Organ Weight

Following the bleeding process, all ducks from each treatment were euthanized via cervical dislocation. Subsequently, the liver, kidney, heart, spleen, gizzard, and bursa of Fabricius were removed, and their weights were measured. The organs were weighed, and their weights were represented as relative organ weights:
Relative weight = (Organ weight)/(Final BW) × 100.

5.9. Carcass and Meat Quality

After 42 days of testing, each duck was carefully weighed before being exsanguinated and sacrificed via cervical dislocation. The weight of the carcass (excluding the neck and feet), breast meat, liver, gizzard, pancreas, thymus, bursa of Fabricius, spleen, and abdominal fat was extracted and measured after being rinsed with saline solution. Organ size was quantified as a proportion of BW. The pH of the breast meat was determined using a calibrated glass-electrode pH meter (WTW pH 340-A, WTH Measurement Systems Inc., Ft. Myers, FL). The lightness (L*), redness (a*), and yellowness (b*) values of the breast meat were measured using a Minolta CR410 Chromameter from Konica Minolta Sensing Inc., located in Osaka, Japan. The water-holding capacity (WHC) was determined following the procedures outlined by Kauffman et al. [78]. Additionally, the drip loss was quantified using roughly 2 g of heated material, following the plastic bag technique outlined by Honikel [79]. Subsequently, the cooking loss was calculated using the methodology laid out by Sullivan et al. [80]. The TBARS were quantified using the technique outlined by Witte et al. [81], with the results expressed as milligrams of MDA per kilogram of muscle. The extraction process involved the use of a solution of trichloroacetic acid with a concentration of 20% by weight/volume.

5.10. Immune Response and Metabolizing Cytochrome P450 Enzyme-Related Genes Expression in the Liver

At the end of the experiment, three birds were randomly selected from each treatment, and their liver tissues were immediately removed and frozen at −80 °C until RNA extraction. Total RNA was extracted from 50 mg of liver samples homogenized with liquid nitrogen using Trizol and a columnar RNA extraction kit (Invitrogen, PureLinkTM RNA Mini Kit, Thermo Scientific, Wilmington, NC, USA) according to the manufacturer’s protocol. The extracted RNA was quantified using a spectrophotometer (NanoDropTM 2000, Thermo Scientific, Wilmington, NC, USA) at an absorbance ratio of 260–280 nm. Subsequently, the cDNA was synthesized using a cDNA synthesis kit (iScriptTM cDNA Synthesis Kit, BIO-RAD, Hercules, CA, USA) according to the manufacturer’s instructions.
The qPCR reaction was carried out using the CFX ConnectTM Real-Time PCR System (BIO-RAD, Hercules, CA, USA) with the iTaq Universal SYBR Green supermix 2X (BIO-RAD, Hercules, CA, USA) and specific primers for individual genes (Table 8). Changes in the expression levels of the above genes were measured using the 2-ΔΔCt method and a standard curve, as outlined by Larionov et al. [82].

5.11. Statistical Analysis

The experimental data were analyzed using the analysis of variance (ANOVA) procedure of SAS Enterprise Guide Software V.9.4 (SAS Institute, Cary, NC, USA). The least square means (LSM) were compared using Tukey’s test, and a probability level of p < 0.05 was considered statistically significant.

Author Contributions

Conceptualization, C.L.; methodology, C.L.; validation, C.L. and K.-H.T.; formal analysis, C.L., P.K. and K.H.; investigation C.L. and P.K.; resources, C.L.; data curation, C.L. and K.-H.T.; writing—original draft preparation, C.L. and K.-H.T.; writing—review and editing, C.L. and K.-H.T.; visualization, C.L. and K.-H.T.; supervision, C.L; project administration, C.L.; funding acquisition, C.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work (Grant No. RGNS 63-062) was supported by Office of the Permanent Secretary, Ministry of Higher Education, Science, Research and Innovation (OPS MHESI), Thailand Science Research and Innovation (TSRI) and partly supported by Chiang Mai University.

Institutional Review Board Statement

The animal experiments were conducted in strict accordance with the guidelines recommended and approved by the Animal Ethics Committee, Faculty of Agriculture, Chiang Mai University.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained in the article.

Acknowledgments

The authors thank Chiang Mai University for supporting all research facilities.

Conflicts of Interest

The co-author (K.-H.T.) is an employee of Dr. Bata Ltd. She mainly organized data, wrote manuscripts and gave experiment suggestions, but did not provide funds or samples for this trial. The other authors have no competing interests.

References

  1. Kumar, A.; Pathak, H.; Bhadauria, S.; Sudan, J. Aflatoxin contamination in food crops: Causes, detection, and management: A review. Food Prod. Process. Nutr. 2021, 3, 17. [Google Scholar] [CrossRef]
  2. Awuchi, C.G.; Ondari, E.N.; Ogbonna, C.U.; Upadhyay, A.K.; Baran, K.; Okpala, C.O.R.; Korzeniowska, M.; Guine, R.P.F. Mycotoxins Affecting Animals, Foods, Humans, and Plants: Types, Occurrence, Toxicities, Action Mechanisms, Prevention, and Detoxification Strategies—A Revisit. Foods 2021, 10, 1279. [Google Scholar] [CrossRef] [PubMed]
  3. Qureshi, H.; Hamid, S.S.; Ali, S.S.; Anwar, J.; Siddiqui, A.A.; Khan, N.A. Cytotoxic effects of aflatoxin B1 on human brain microvascular endothelial cells of the blood-brain barrier. Med. Mycol. 2015, 53, 409–416. [Google Scholar] [CrossRef] [PubMed]
  4. Pleadin, J.; Kovacevic, D.; Perkovic, I. Impact of casing damaging on aflatoxin B1 concentration during the ripening of dry-fermented meat sausages. J. Immunoass. Immunochem. 2015, 36, 655–666. [Google Scholar] [CrossRef] [PubMed]
  5. Zou, Y.; Liu, S.B.; Zhang, Q.; Tan, H.Z. Effects of Aflatoxin B(1) on growth performance, carcass traits, organ index, blood biochemistry and oxidative status in Chinese yellow chickens. J. Vet. Med. Sci. 2023, 85, 1015–1022. [Google Scholar] [CrossRef]
  6. Kananub, S.; Jala, P.; Laopiem, S.; Boonsoongnern, A.; Sanguankiat, A. Mycotoxin profiles of animal feeds in the central part of Thailand: 2015-2020. Vet. World 2021, 14, 739–743. [Google Scholar] [CrossRef]
  7. Waenlor, W.; Wiwanitkit, V. Aflatoxin contamination of food and food products in Thailand: An overview. Southeast. Asian J. Trop. Med. Public. Health 2003, 34 (Suppl. S2), 184–190. [Google Scholar]
  8. Pickova, D.; Ostry, V.; Toman, J.; Malir, F. Aflatoxins: History, Significant Milestones, Recent Data on Their Toxicity and Ways to Mitigation. Toxins 2021, 13, 399. [Google Scholar] [CrossRef]
  9. Alameri, M.M.; Kong, A.S.; Aljaafari, M.N.; Ali, H.A.; Eid, K.; Sallagi, M.A.; Cheng, W.H.; Abushelaibi, A.; Lim, S.E.; Loh, J.Y.; et al. Aflatoxin Contamination: An Overview on Health Issues, Detection and Management Strategies. Toxins 2023, 15, 246. [Google Scholar] [CrossRef]
  10. Mesgar, A.; Aghdam Shahryar, H.; Bailey, C.A.; Ebrahimnezhad, Y.; Mohan, A. Effect of Dietary L-Threonine and Toxin Binder on Performance, Blood Parameters, and Immune Response of Broilers Exposed to Aflatoxin B(1). Toxins 2022, 14, 192. [Google Scholar] [CrossRef]
  11. Tansakul, N.; Rattanasrisomporn, J.; Roytrakul, S. Proteomics analysis of serum protein patterns in duck during aflatoxin B1 exposure. Vet. World 2019, 12, 1499–1505. [Google Scholar] [CrossRef] [PubMed]
  12. Barraud, L.; Guerret, S.; Chevallier, M.; Borel, C.; Jamard, C.; Trepo, C.; Wild, C.P.; Cova, L. Enhanced duck hepatitis B virus gene expression following aflatoxin B1 exposure. Hepatology 1999, 29, 1317–1323. [Google Scholar] [CrossRef] [PubMed]
  13. Maldjian, A.; Cristofori, C.; Noble, R.C.; Speake, B.K. The fatty acid composition of brain phospholipids from chicken and duck embryos. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 1996, 115, 153–158. [Google Scholar] [CrossRef] [PubMed]
  14. Eraslan, G.; Essiz, D.; Akdogan, M.; Sahindokuyucu, F.; Altintas, L.; Hismiogullari, S. Effects of dietary aflatoxin and sodium bentonite on some hormones in broiler chickens. Bull. Vet. Inst. Pulawy 2005, 49, 93–96. [Google Scholar]
  15. Tso, K.H.; Lumsangkul, C.; Cheng, M.C.; Ju, J.C.; Fan, Y.K.; Chiang, H.I. Differential Effects of Green Tea Powders on the Protection of Brown Tsaiya and Kaiya Ducklings against Trichothecene T-2 Toxin Toxicity. Animals 2021, 11, 2541. [Google Scholar] [CrossRef] [PubMed]
  16. Peles, F.; Sipos, P.; Kovacs, S.; Gyori, Z.; Pocsi, I.; Pusztahelyi, T. Biological Control and Mitigation of Aflatoxin Contamination in Commodities. Toxins 2021, 13, 104. [Google Scholar] [CrossRef] [PubMed]
  17. Peng, Z.; Chen, L.; Zhu, Y.; Huang, Y.; Hu, X.; Wu, Q.; Nüssler, A.K.; Liu, L.; Yang, W. Current major degradation methods for aflatoxins: A review. Trends Food Sci. Technol. 2018, 80, 155–166. [Google Scholar] [CrossRef]
  18. Lai, Y.; Sun, M.; He, Y.; Lei, J.; Han, Y.; Wu, Y.; Bai, D.; Guo, Y.; Zhang, B. Mycotoxins binder supplementation alleviates aflatoxin B(1) toxic effects on the immune response and intestinal barrier function in broilers. Poult. Sci. 2022, 101, 101683. [Google Scholar] [CrossRef] [PubMed]
  19. Chung, T.K.; Erdman, J.W., Jr.; Baker, D.H. Hydrated sodium calcium aluminosilicate: Effects on zinc, manganese, vitamin A, and riboflavin utilization. Poult. Sci. 1990, 69, 1364–1370. [Google Scholar] [CrossRef]
  20. Nielsen, F.H. History of zinc in agriculture. Adv. Nutr. 2012, 3, 783–789. [Google Scholar] [CrossRef]
  21. Yesuf, Y.K.; Tamir, B.; Tesfaye, E.; Beyero, N. The synergetic effects of some phytobiotics mix on growth, hematology and microbial loads of broiler chickens. Anim. Biotechnol. 2023, 34, 3507–3515. [Google Scholar] [CrossRef] [PubMed]
  22. Kikusato, M. Phytobiotics to improve health and production of broiler chickens: Functions beyond the antioxidant activity. Anim. Biosci. 2021, 34, 345–353. [Google Scholar] [CrossRef] [PubMed]
  23. Khunkitti, W.; Taweechaisupapong, S.; Aromdee, A.; Pese, M. Antimicrobial activity of Thunbergia laurifolia crude extract. In Proceedings of the 3rd World Congress on Medicinal Plant and Aromatic Plants for Human Welfare, Chiangmai, Thailand, 3–7 February 2003. [Google Scholar]
  24. Srida, C.; Hankete, J.; Aromdee, C.; Pese, M. Antioxidant activity of Thunbergia laurifolia ethanolic extract. Thai J. Pharm. Sci. 2002, 26, 29–35. [Google Scholar]
  25. Ussanawarong, S.; Thesiri, T. Effect of Thunbergia laurifolia Linn. on detoxication of parathion in rat. Khon Kaen Univ. Res. J. 2001, 6, 3–13. [Google Scholar]
  26. Tejasen, P.; Thongthapp, C. The study of the insecticide antitoxicity of Thunbergia laurifolia Linn. Chiang Mai Med. Bull. 1980, 19, 105–114. [Google Scholar]
  27. Palipoch, S.; Jiraungkoorskul, W.; Tansatit, T.; Preyavichyapugdee, N.; Jaikua, W.; Kosai, P. Protective efficiency of Thunbergia laurifolia leaf extract against lead (II) nitrate-induced toxicity in Oreochromis niloticus. J. Med. Plant Res. 2011, 5, 719–728. [Google Scholar]
  28. Wonkchalee, O.; Boonmars, T.; Aromdee, C.; Laummaunwai, P.; Khunkitti, W.; Vaeteewoottacharn, K.; Sriraj, P.; Aukkanimart, R.; Loilome, W.; Chamgramol, Y. Anti-inflammatory, antioxidant and hepatoprotective effects of Thunbergia laurifolia Linn. on experimental opisthorchiasis. Parasitol. Res. 2012, 111, 353–359. [Google Scholar] [CrossRef] [PubMed]
  29. Oonsivilai, R.; Cheng, C.; Bomser, J.; Ferruzzi, M.G.; Ningsanond, S. Phytochemical profiling and phase II enzyme-inducing properties of Thunbergia laurifolia Lindl. (RC) extracts. J. Ethnopharmacol. 2007, 114, 300–306. [Google Scholar] [CrossRef] [PubMed]
  30. Chan, E.; Lim, Y.Y. Antioxidant activity of Thunbergia laurifolia tea. J. Trop. For. Sci. 2006, 18, 130–136. [Google Scholar]
  31. Ruela-de-Sousa, R.R.; Fuhler, G.M.; Blom, N.; Ferreira, C.V.; Aoyama, H.; Peppelenbosch, M.P. Cytotoxicity of apigenin on leukemia cell lines: Implications for prevention and therapy. Cell Death Dis. 2010, 1, e19. [Google Scholar] [CrossRef]
  32. Marin, D.E.; Taranu, I. Overview on aflatoxins and oxidative stress. Toxin Rev. 2012, 31, 32–43. [Google Scholar] [CrossRef]
  33. Junsi, M.; Siripongvutikorn, S. Thunbergia laurifolia, a traditional herbal tea of Thailand: Botanical, chemical composition, biological properties and processing influence. Int. Food Res. J. 2016, 23, 923–927. [Google Scholar]
  34. Forester, S.C.; Lambert, J.D. The role of antioxidant versus pro-oxidant effects of green tea polyphenols in cancer prevention. Mol. Nutr. Food Res. 2011, 55, 844–854. [Google Scholar] [CrossRef] [PubMed]
  35. Essiedu, J.A.; Gonu, H.; Adadi, P.; Usansa, U. Polyphenols and Antioxidant Activity of Thunbergia laurifolia Infused Tea under Drying Conditions. J. Food Qual. 2023, 2023, 5046880. [Google Scholar] [CrossRef]
  36. Jayasundara, N.; Arampath, P. Effect of variety, location & maturity stage at harvesting, on essential oil chemical composition, and weight yield of Zingiber officinale roscoe grown in Sri Lanka. Heliyon 2021, 7, e06560. [Google Scholar] [CrossRef]
  37. No, E. Commission regulation (EC) No. 1881/2006 of 19 December 2006. Setting maximum levels for certain contaminants in foodstuffs (Text with EEA relevance). Off. J. Eur. Comm. 1881, 364, 2006. [Google Scholar]
  38. Ksenija, N. Mycotoxins–climate impact and steps to prevention based on prediction. Acta Vet. 2018, 68, 1–15. [Google Scholar] [CrossRef]
  39. Selvaraj, J.N.; Wang, Y.; Zhou, L.; Zhao, Y.; Xing, F.; Dai, X.; Liu, Y. Recent mycotoxin survey data and advanced mycotoxin detection techniques reported from China: A review. Food Addit. Contam. Part. A Chem. Anal. Control Expo. Risk Assess. 2015, 32, 440–452. [Google Scholar] [CrossRef]
  40. Monson, M.; Coulombe, R.; Reed, K. Aflatoxicosis: Lessons from Toxicity and Responses to Aflatoxin B1 in Poultry. Agriculture 2015, 5, 742–777. [Google Scholar] [CrossRef]
  41. Muller, R.D.; Carlson, C.W.; Semeniuk, G.; Harshfield, G.S. The response of chicks, ducklings, goslings, pheasants and poults to graded levels of aflatoxins. Poult. Sci. 1970, 49, 1346–1350. [Google Scholar] [CrossRef]
  42. Xie, Q.; Sun, M.; Chang, W.; Liu, Z.; Ma, J.; Liu, G.; Cai, H.; Wang, J.; Lyu, C. Effects of aflatoxins and absorbents on growth performance and immune indices of meat ducks. Chin. J. Anim. Nutr. 2015, 27, 204–211. [Google Scholar]
  43. Chen, X.; Grenier, B. Aflatoxins in Poultry; Purdue University Department of Animal Sciences: New York, NY, USA, 2013. [Google Scholar]
  44. Randall, G.M.; Bird, F.H. The effect of exercise on the toxicity of aflatoxin B1 in chickens. Poult. Sci. 1979, 58, 1284–1288. [Google Scholar] [CrossRef] [PubMed]
  45. Malekinezhad, P.; Ellestad, L.E.; Afzali, N.; Farhangfar, S.H.; Omidi, A.; Mohammadi, A. Evaluation of berberine efficacy in reducing the effects of aflatoxin B1 and ochratoxin A added to male broiler rations. Poult. Sci. 2021, 100, 797–809. [Google Scholar] [CrossRef] [PubMed]
  46. Yunus, A.W.; Razzazi-Fazeli, E.; Bohm, J. Aflatoxin B(1) in affecting broiler’s performance, immunity, and gastrointestinal tract: A review of history and contemporary issues. Toxins 2011, 3, 566–590. [Google Scholar] [CrossRef] [PubMed]
  47. Rotimi, O.A.; Rotimi, S.O.; Duru, C.U.; Ebebeinwe, O.J.; Abiodun, A.O.; Oyeniyi, B.O.; Faduyile, F.A. Acute aflatoxin B1—Induced hepatotoxicity alters gene expression and disrupts lipid and lipoprotein metabolism in rats. Toxicol. Rep. 2017, 4, 408–414. [Google Scholar] [CrossRef] [PubMed]
  48. El-Nekeety, A.A.; Abdel-Azeim, S.H.; Hassan, A.M.; Hassan, N.S.; Aly, S.E.; Abdel-Wahhab, M.A. Quercetin inhibits the cytotoxicity and oxidative stress in liver of rats fed aflatoxin-contaminated diet. Toxicol. Rep. 2014, 1, 319–329. [Google Scholar] [CrossRef]
  49. Alves-Bezerra, M.; Cohen, D.E. Triglyceride metabolism in the liver. Compr. Physiol. 2017, 8, 1. [Google Scholar]
  50. Han, X.-Y.; Huang, Q.-C.; Li, W.-F.; Jiang, J.-F.; Xu, Z.-R. Changes in growth performance, digestive enzyme activities and nutrient digestibility of cherry valley ducks in response to aflatoxin B1 levels. Livest. Sci. 2008, 119, 216–220. [Google Scholar] [CrossRef]
  51. Zhang, M.; Li, Q.; Wang, J.; Sun, J.; Xiang, Y.; Jin, X. Aflatoxin B1 disrupts the intestinal barrier integrity by reducing junction protein and promoting apoptosis in pigs and mice. Ecotoxicol. Environ. Saf. 2022, 247, 114250. [Google Scholar] [CrossRef]
  52. Poloni, V.; Magnoli, A.; Fochesato, A.; Cristofolini, A.; Caverzan, M.; Merkis, C.; Montenegro, M.; Cavaglieri, L. A Saccharomyces cerevisiae RC016-based feed additive reduces liver toxicity, residual aflatoxin B1 levels and positively influences intestinal morphology in broiler chickens fed chronic aflatoxin B1-contaminated diets. Anim. Nutr. 2020, 6, 31–38. [Google Scholar] [CrossRef]
  53. Applegate, T.J.; Schatzmayr, G.; Prickel, K.; Troche, C.; Jiang, Z. Effect of aflatoxin culture on intestinal function and nutrient loss in laying hens. Poult. Sci. 2009, 88, 1235–1241. [Google Scholar] [CrossRef] [PubMed]
  54. Cao, Q.Q.; Lin, L.X.; Xu, T.T.; Lu, Y.; Zhang, C.D.; Yue, K.; Huang, S.C.; Dong, H.J.; Jian, F.C. Aflatoxin B1 alters meat quality associated with oxidative stress, inflammation, and gut-microbiota in sheep. Ecotoxicol. Environ. Saf. 2021, 225, 112754. [Google Scholar] [CrossRef] [PubMed]
  55. Seideman, S.C.; Cross, H.R.; Smith, G.C.; Durland, P.R. Factors associated with fresh meat color: A review. J. Food Qual. 1984, 6, 211–237. [Google Scholar] [CrossRef]
  56. Diaz, G.J.; Murcia, H.W.; Cepeda, S.M. Cytochrome P450 enzymes involved in the metabolism of aflatoxin B1 in chickens and quail. Poult. Sci. 2010, 89, 2461–2469. [Google Scholar] [CrossRef] [PubMed]
  57. Do, J.H.; Choi, D.-K. Aflatoxins: Detection, toxicity, and biosynthesis. Biotechnol. Bioprocess. Eng. 2007, 12, 585–593. [Google Scholar] [CrossRef]
  58. Stern, A.; Furlan, V.; Novak, M.; Stampar, M.; Kolenc, Z.; Kores, K.; Filipic, M.; Bren, U.; Zegura, B. Chemoprotective Effects of Xanthohumol against the Carcinogenic Mycotoxin Aflatoxin B1. Foods 2021, 10, 1331. [Google Scholar] [CrossRef] [PubMed]
  59. Ferguson, L.R.; Philpott, M. Nutrition and mutagenesis. Annu. Rev. Nutr. 2008, 28, 313–329. [Google Scholar] [CrossRef]
  60. Diaz, G.J.; Murcia, H.W.; Cepeda, S.M.; Boermans, H.J. The role of selected cytochrome P450 enzymes on the bioactivation of aflatoxin B1 by duck liver microsomes. Avian Pathol. 2010, 39, 279–285. [Google Scholar] [CrossRef] [PubMed]
  61. Liu, W.C.; Yang, Y.Y.; Pushparaj, K.; Balasubramanian, B. Evaluation of Hepatic Detoxification Effects of Enteromorpha prolifera Polysaccharides against Aflatoxin B(1) in Broiler Chickens. Antioxidants 2022, 11, 1757. [Google Scholar] [CrossRef]
  62. Hou, L.; Qiu, H.; Li, A.; Dong, J.; Zhu, L.; Liu, G.; Chen, F. Effects of aflatoxin B(1) on growth performance, antioxidant status, immune response, and pro-inflammatory cytokine mRNA expression in ISA chicks. Front. Vet. Sci. 2022, 9, 993039. [Google Scholar] [CrossRef]
  63. Li, Y.; Ma, Q.G.; Zhao, L.H.; Wei, H.; Duan, G.X.; Zhang, J.Y.; Ji, C. Effects of lipoic acid on immune function, the antioxidant defense system, and inflammation-related genes expression of broiler chickens fed aflatoxin contaminated diets. Int. J. Mol. Sci. 2014, 15, 5649–5662. [Google Scholar] [CrossRef] [PubMed]
  64. Benkerroum, N. Chronic and Acute Toxicities of Aflatoxins: Mechanisms of Action. Int. J. Environ. Res. Public Health 2020, 17, 423. [Google Scholar] [CrossRef] [PubMed]
  65. Pizzino, G.; Irrera, N.; Cucinotta, M.; Pallio, G.; Mannino, F.; Arcoraci, V.; Squadrito, F.; Altavilla, D.; Bitto, A. Oxidative Stress: Harms and Benefits for Human Health. Oxid. Med. Cell Longev. 2017, 2017, 8416763. [Google Scholar] [CrossRef] [PubMed]
  66. Juan, C.A.; Pérez de la Lastra, J.M.; Plou, F.J.; Pérez-Lebeña, E. The Chemistry of Reactive Oxygen Species (ROS) Revisited: Outlining Their Role in Biological Macromolecules (DNA, Lipids and Proteins) and Induced Pathologies. Int. J. Mol. Sci. 2021, 22, 4642. [Google Scholar] [CrossRef]
  67. Allameh, A.; Niayesh-Mehr, R.; Aliarab, A.; Sebastiani, G.; Pantopoulos, K. Oxidative Stress in Liver Pathophysiology and Disease. Antioxidants 2023, 12, 1653. [Google Scholar] [CrossRef] [PubMed]
  68. Junsi, M.; Takahashi Yupanqui, C.; Usawakesmanee, W.; Slusarenko, A.; Siripongvutikorn, S. Thunbergia laurifolia Leaf Extract Increased Levels of Antioxidant Enzymes and Protected Human Cell-Lines In Vitro Against Cadmium. Antioxidants 2020, 9, 47. [Google Scholar] [CrossRef] [PubMed]
  69. Palipoch, S.; Punsawad, C.; Suwannalert, P. Thunbergia laurifolia, a new choice of natural antioxidant to prevent oxidative stress-related pathology: A review. J. Med. Plants Res. 2013, 7, 698–701. [Google Scholar] [CrossRef]
  70. Junsi, M.; Siripongvutikorn, S.; Yupanqui, C.; Usawakesmanee, W. Phenolic and flavonoid compounds in aqueous extracts of Thunbergia laurifolia leaves and their effect on the toxicity of the carbamate insecticide methomyl to murine macrophage cells. Funct. Foods Health Dis. 2017, 7, 529. [Google Scholar] [CrossRef]
  71. Donkotjan, C.; Benjanirut, C.; Angkanaporn, K. Effect of Thunbergia laurifolia leaves on the growth performance, nutrient digestibility and liver antioxidant enzymes of broilers fed mycotoxin-contaminated feed. Anim. Prod. Sci. 2020, 60, 1885–1893. [Google Scholar] [CrossRef]
  72. Zhang, J.; Wen, C.; Zhang, H.; Duan, Y.; Ma, H. Recent advances in the extraction of bioactive compounds with subcritical water: A review. Trends Food Sci. Technol. 2019, 95, 183–195. [Google Scholar] [CrossRef]
  73. Lamuela-Raventós, R.M. Folin–Ciocalteu method for the measurement of total phenolic content and antioxidant capacity. Meas. Antioxid. Act. Capacit. Recent. Trends Appl. 2018, 107–115. [Google Scholar]
  74. Sunanta, P.; Chung, H.H.; Kunasakdakul, K.; Ruksiriwanich, W.; Jantrawut, P.; Hongsibsong, S.; Sommano, S.R. Genomic relationship and physiochemical properties among raw materials used for Thai black garlic processing. Food Sci. Nutr. 2020, 8, 4534–4545. [Google Scholar] [CrossRef]
  75. Kek, S.P.; Chin, N.L.; Yusof, Y.A.; Tan, S.W.; Chua, L.S. Classification of entomological origin of honey based on its physicochemical and antioxidant properties. Int. J. Food Prop. 2017, 20, S2723–S2738. [Google Scholar] [CrossRef]
  76. Li, S.; Han, M.; Zhang, Y.; Ishfaq, M.; Liu, R.; Wei, G.; Zhang, X.; Zhang, X. Effect of Curcumin as feed supplement on immune response and pathological changes of broilers exposed to Aflatoxin B1. Biomolecules 2022, 12, 1188. [Google Scholar] [CrossRef]
  77. Lin, M.-J.; Chang, S.-C.; Tso, K.-H.; Lin, W.-C.; Chang, C.-L.; Lee, T.-T. Effect of T-2 toxin and antioxidants on angel wing incidence and severity in White Roman geese. J. Appl. Anim. Res. 2018, 46, 340–348. [Google Scholar] [CrossRef]
  78. Kauffman, S.A. Autocatalytic sets of proteins. J. Theor. Biol. 1986, 119, 1–24. [Google Scholar] [CrossRef] [PubMed]
  79. Honikel, K.O. Reference methods for the assessment of physical characteristics of meat. Meat Sci. 1998, 49, 447–457. [Google Scholar] [CrossRef] [PubMed]
  80. O’sullivan, M.; Byrne, D.; Jensen, M.; Andersen, H.J.; Vestergaard, J. A comparison of warmed-over flavour in pork by sensory analysis, GC/MS and the electronic nose. Meat Sci. 2003, 65, 1125–1138. [Google Scholar] [CrossRef]
  81. Witte, V.C.; Krause, G.F.; Bailey, M.E. A new extraction method for determining 2-thiobarbituric acid values of pork and beef during storage. J. Food Sci. 1970, 35, 582–585. [Google Scholar] [CrossRef]
  82. Larionov, A.; Krause, A.; Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinform. 2005, 6, 62. [Google Scholar] [CrossRef]
Toxins 16 00334 g001
Figure 1. Histological representations of the H&E-stained jejunum and ileum sections of ducks. (a) T1: Control, only basal diet without AFB1, TLE, or commercial binder, which showed normal histology of intestinal villi with normal pseudostratified epithelium with goblet cells (arrow) in jejunum; (b) T2: the basal diet containing 0.1 mg AFB1/kg, which AFB1 showed significant mucosal necrosis and decreased villi integrity in the jejunum (arrow); (c) T3: the basal diet containing 0.1 mg AFB1/kg and 100 mg TLE/kg, which showed mild mucosal necrosis and loose villi integrity in the jejunum (arrow); (d) T4: the basal diet containing 0.1 mg AFB1/kg and 200 mg TLE/kg, which showed slight mucosal necrosis and loose villi integrity in the jejunum (arrow); (e) T5: the basal diet containing 0.1 mg AFB1/kg and 0.5 g/kg of commercial binder, which showed slight mucosal necrosis and loose villi integrity in the jejunum (arrow). (f) T1 showed the complete and compact villus tissue in the ileum (arrow); (g) T2 showed loose villus structure in the ileum (arrow); (h) T3 showed slightly loose villus structure in the ileum (arrow); (i) T4 showed slightly loose villus structure in the ileum (arrow); (j) T5 showed slightly loose villus structure in the ileum (arrow); Magnification was 10× the objective lens. Scale bars represent 100 µm.
Figure 1. Histological representations of the H&E-stained jejunum and ileum sections of ducks. (a) T1: Control, only basal diet without AFB1, TLE, or commercial binder, which showed normal histology of intestinal villi with normal pseudostratified epithelium with goblet cells (arrow) in jejunum; (b) T2: the basal diet containing 0.1 mg AFB1/kg, which AFB1 showed significant mucosal necrosis and decreased villi integrity in the jejunum (arrow); (c) T3: the basal diet containing 0.1 mg AFB1/kg and 100 mg TLE/kg, which showed mild mucosal necrosis and loose villi integrity in the jejunum (arrow); (d) T4: the basal diet containing 0.1 mg AFB1/kg and 200 mg TLE/kg, which showed slight mucosal necrosis and loose villi integrity in the jejunum (arrow); (e) T5: the basal diet containing 0.1 mg AFB1/kg and 0.5 g/kg of commercial binder, which showed slight mucosal necrosis and loose villi integrity in the jejunum (arrow). (f) T1 showed the complete and compact villus tissue in the ileum (arrow); (g) T2 showed loose villus structure in the ileum (arrow); (h) T3 showed slightly loose villus structure in the ileum (arrow); (i) T4 showed slightly loose villus structure in the ileum (arrow); (j) T5 showed slightly loose villus structure in the ileum (arrow); Magnification was 10× the objective lens. Scale bars represent 100 µm.
Toxins 16 00334 g001
Toxins 16 00334 g002
Figure 2. Expressions of immune (tumor necrosis factorα, TNFα; interleukin 6, IL6; interleukin 8, IL8) and metabolizing Cytochrome P450 enzyme (CYP1A1 = cytochrome P450 1A1; CYP1A2 = cytochrome P450 1A2) related genes in liver of aflatoxin-challenged ducks. Three replicates. a–c Columns without the same superscripts differ (p < 0.05). T1: Control, only basal diet without AFB1, TLE, or commercial binder; T2: the basal diet containing 0.1 mg AFB1/kg; T3: the basal diet containing 0.1 mg AFB1/kg and 100 mg TLE/kg; T4: the basal diet containing 0.1 mg AFB1/kg and 200 mg of TLE/kg; T5: the basal diet containing 0.1 mg AFB1/kg and 0.5 g/kg of commercial binder; AFB1: aflatoxin B1; TLE: T. laurifolia extract.
Figure 2. Expressions of immune (tumor necrosis factorα, TNFα; interleukin 6, IL6; interleukin 8, IL8) and metabolizing Cytochrome P450 enzyme (CYP1A1 = cytochrome P450 1A1; CYP1A2 = cytochrome P450 1A2) related genes in liver of aflatoxin-challenged ducks. Three replicates. a–c Columns without the same superscripts differ (p < 0.05). T1: Control, only basal diet without AFB1, TLE, or commercial binder; T2: the basal diet containing 0.1 mg AFB1/kg; T3: the basal diet containing 0.1 mg AFB1/kg and 100 mg TLE/kg; T4: the basal diet containing 0.1 mg AFB1/kg and 200 mg of TLE/kg; T5: the basal diet containing 0.1 mg AFB1/kg and 0.5 g/kg of commercial binder; AFB1: aflatoxin B1; TLE: T. laurifolia extract.
Toxins 16 00334 g002
Table 1. Total phenolic compounds and antioxidant activity of T. laurifolia extract.
Table 1. Total phenolic compounds and antioxidant activity of T. laurifolia extract.
Total Phenol Compound
(mg GAE/g)		DPPH
(μmol TE/g)		1ABTS
(IC50)		FRAP
(mM Fe2+/g)
T. laurifolia extract0.56 ± 0.057.26 ± 0.983.70 ± 0.5251.26 ± 1.5
1ABTS: 2,2-azino-bis (3-ethylbenzothiazo-line-6-sulfonic acid); DPPH: 2,2-diphenyl-1-picrylhydrazyl radical; FRAP: ferric reducing antioxidant power; Fe2+: iron divalent ions; GAE: gallic acid equivalents; IC50: half maximal inhibitory concentration; TE: Trolox equivalents.
Table 2. Effects of T. laurifolia extract on growth parameters of aflatoxin B1-challenged ducklings.
Table 2. Effects of T. laurifolia extract on growth parameters of aflatoxin B1-challenged ducklings.
Item1T1T2T3T4T5SEMp-Value
Initial BW, g88.382.884.782.786.01.610.1290
Final BW, g2303.0 a1831.4 b2244.9 a2307.3 a2236.6 a44.06<0.0001
ADG, g63.3 a50.0 b61.7 a63.6 a61.4 a1.82<0.0001
ADFI, g145.8144.9144.1139.9139.71.270.0880
FCR2.3 b2.9 a2.3 b2.2 b2.3 b0.080.0001
a–b Means with different superscripts in a column differ significantly (p < 0.05). 1T1: Control, only basal diet without AFB1, TLE or commercial binder; T2: the basal diet containing 0.1 mg AFB1/kg; T3: the basal diet containing 0.1 mg AFB1/kg and 100 mg TLE/kg; T4: the basal diet containing 0.1 mg AFB1/kg and 200 mg TLE/kg; T5: the basal diet containing 0.1 mg AFB1/kg and 0.5 g/kg of commercial binder; AFB1: aflatoxin B1; TLE: T. laurifolia extract; BW, body weight; ADG, average daily gain; ADFI, average daily feed intake; FCR, feed conversion ratio.
Table 3. Effects of T. laurifolia extract on serum biochemical of aflatoxin B1-challenged ducklings.
Table 3. Effects of T. laurifolia extract on serum biochemical of aflatoxin B1-challenged ducklings.
Item1T1T2T3T4T5SEMp-Value
Total cholesterol, mg/dL110.0 c151.0 ab161.3 a157.7 ab129.3 bc9.280.0135
Triglyceride, mg/dL122.0 c183.3 ab177.0 ab158.0 bc218.3 a16.510.0232
AST, U/L27.0 d43.3 a33.0 c29.7 cd37.7 b1.41<0.0001
ALT, U/L32.7 ab62.3 a 47.3 a32.3 b44.0 a3.170.0001
ALP, U/L846.3 a834.0 a749.7 b662.0 c833.67 a18.050.1922
Total protein, mg/dL2.73 c2.87 bc 3.03 abc3.30 a3.23 ab0.120.0431
Albumin, mg/dL1.371.371.271.431.430.060.2742
Globulin, mg/dL1.37 b1.67 a1.60 ab1.86 a1.80 a0.080.0118
a–d Means with different superscripts in a column differ significantly (p < 0.05). 1T1: Control, only basal diet without AFB1, TLE or commercial binder; T2: the basal diet containing 0.1 mg AFB1/kg; T3: the basal diet containing 0.1 mg AFB1/kg and 100 mg TLE/kg; T4: the basal diet containing 0.1 mg AFB1/kg and 200 mg TLE/kg; T5: the basal diet containing 0.1 mg AFB1/kg and 0.5 g/kg of commercial binder; AFB1: aflatoxin B1; TLE: T. laurifolia extract; AST: aspartate transaminase; ALT: alanine transaminase; ALP: alkaline phosphatase.
Table 4. Effects of T. laurifolia extract supplementation on intestinal morphology of aflatoxin B1-challenged ducklings.
Table 4. Effects of T. laurifolia extract supplementation on intestinal morphology of aflatoxin B1-challenged ducklings.
Item1T1T2T3T4T5SEMp-Value
Duodenum
 VH904.36 e974.41 d989.81 c1069.15 b1098.01 a1.32<0.0001
 VW115.85 d133.42 ab136.02 a126.65 c128.02 bc1.080.0015
 CD214.37 b222.21 a226.21 a178.33 c166.74 d0.96<0.0001
 VH:CD4.52 c4.62 c4.75 c6.58 b7.31 a0.10<0.0001
Jejunum
 VH775.95 e782.95 d799.55 c857.01 b961.79 a1.15<0.0001
 VW113.55 ab103.52 c109.12 b117.88 a117.59 a0.960.0028
 CD174.95 b181.74 a180.64 a167.56 c150.76 d0.97<0.0001
 VH:CD4.56 c4.53 c4.37 c5.78 b6.57 a0.05<0.0001
Ileum
 VH539.73 e616.03 d627.63 c700.65 a650.57 b1.76<0.0001
 VW98.3993.3798.7794.8591.331.670.2557
 CD101.35 a86.01 b90.03 b102.74 a84.81 b1.110.0011
 VH:CD6.00 d7.33 c7.93 ab7.56 bc8.18 a0.110.0013
a–e Means with different superscripts in a column differ significantly (p < 0.05). 1T1: Control, only basal diet without AFB1, TLE or commercial binder; T2: the basal diet containing 0.1 mg AFB1/kg; T3: the basal diet containing 0.1 mg AFB1/kg and 100 mg TLE/kg; T4: the basal diet containing 0.1 mg AFB1/kg and 200 mg TLE/kg; T5: the basal diet containing 0.1 mg AFB1/kg and 0.5 g/kg of commercial binder; AFB1: aflatoxin B1; TLE: T. laurifolia extract; VH: villus height; VW: villus width; CD: crypt depth; VH:CD: villus height per crypt depth ratio.
Table 5. Effects of T. laurifolia extract on carcass trait and relative organ weight of aflatoxin B1-challenged ducklings.
Table 5. Effects of T. laurifolia extract on carcass trait and relative organ weight of aflatoxin B1-challenged ducklings.
Item1T1T2T3T4T5SEMp-Value
Carcass traits
 Dressing, %87.7386.2387.3087.6585.900.570.0822
 Breast, g10.819.7510.0210.4811.200.520.2814
 Thigh, g7.497.717.908.227.820.290.4990
 Wing, g12.0712.0712.1912.4012.560.220.4555
Relative organ weight, g
 Liver, g2.242.342.282.042.170.080.0696
 Spleen0.110.090.090.090.090.010.5229
 Kidney0.700.740.750.760.720.020.4222
 Bursa of fabricius0.170.180.160.180.170.010.7154
 Heart0.610.650.630.660.650.020.6874
 Gizzard4.714.754.794.495.070.140.0918
1T1: Control, only basal diet without AFB1, TLE or commercial binder; T2: the basal diet containing 0.1 mg AFB1/kg; T3: the basal diet containing 0.1 mg AFB1/kg and 100 mg TLE/kg; T4: the basal diet containing 0.1 mg AFB1/kg and 200 mg TLE/kg; T5: the basal diet containing 0.1 mg AFB1/kg and 0.5 g/kg of commercial binder; AFB1: aflatoxin B1; TLE: T. laurifolia extract.
Table 6. Effect of T. laurifolia extract on meat quality of aflatoxin B1-challenged ducklings.
Table 6. Effect of T. laurifolia extract on meat quality of aflatoxin B1-challenged ducklings.
Item1T1T2T3T4T5SEMp-Value
pH value45 min5.916.166.215.955.900.120.2494
pH value24 h5.605.585.665.575.550.060.6975
Cook loss, %30.6031.8132.5233.9133.951.300.3258
Drip loss, %2.832.202.562.422.480.660.9743
Shear force, N32.20 b34.20 b29.48 b32.37 b45.44 a3.350.0374
TBARS, mg MDA/kg1.591.451.501.551.540.060.5031
Meat color
L*40.5042.2043.0038.8042.151.740.4822
a*15.9016.7916.2814.8316.710.640.2671
b*4.03 c7.23 a7.04 a4.36 bc6.46 ab0.720.0258
a–c Means with different superscripts in a column differ significantly (p < 0.05). 1T1: Control, only basal diet without AFB1, TLE or commercial binder; T2: the basal diet containing 0.1 mg AFB1/kg; T3: the basal diet containing 0.1 mg AFB1/kg and 100 mg TLE/kg; T4: the basal diet containing 0.1 mg AFB1/kg and 200 mg TLE/kg; T5: the basal diet containing 0.1 mg AFB1/kg and 0.5 g/kg of commercial binder; AFB1: aflatoxin B1; TLE: T. laurifolia extract; TBARS: thiobarbituric acid reactive substances; MDA: malondialdehyde; L*: lightness; a*: redness; b*: yellowness.
Table 7. The formulation and proximate composition of the experimental diet (g/kg).
Table 7. The formulation and proximate composition of the experimental diet (g/kg).
Items1–3 Weeks4–5 Weeks
Ingredient (g/kg feed)
 Corn meal700.00575.00
 Rice bran0.0075.00
 Full-fat soybean meal0.0025.00
 Soybean meal, 44%205.00192.50
 Meat meal, 50%25.0025.00
 Limestone 10.0025.00
 Calcium carbonate0.0047.40
 Monopotassium phosphate, 22%10.5017.50
 1 Premix2.502.50
 Methionine0.901.50
 Toxin binder1.000.50
 Salt0.002.00
 Multi protein plus, 68%45.0011.00
 Phytase0.100.10
 Total1000.001000.00
Nutrient composition (% dry matter basis)
 Moisture12.239.78
 Ash6.7911.91
 Crude protein22.2218.0
 Crude fiber4.563.82
 Crude fat5.154.59
 Gross energy (Cal/g)2964.923581.65
1 Vitamin premix (per kg premix): vitamin A 19,000,000 IU, vitamin D3 3,900,000 IU, vitamin E 11,500 IU, vitamin K3 4.30 g, vitamin B1 5.50 g, vitamin B2 10.50 g, vitamin B6 4.80 g, vitamin B12 0.19 g, vitamin C 15.50 g, pantothenic acid 15.10 g, folic acid 2.90 g, nicotinic acid 39.00 g, biotin 0.25 g. 2 Mineral premix (per kg premix): magnesium 105.00 g, potassium 89.00 g, sodium 105.00 g, and feed additive 24.50 g.
Table 8. Primer sequences, amplicons, and the related information for quantitative real-time PCR.
Table 8. Primer sequences, amplicons, and the related information for quantitative real-time PCR.
Target Gene Primer SequencesProduct Size (bp)
Housekeeping gene
GAPDHForwardCTGGCATTGCACTGAACGAC165
ReverseCTCCAACAAAGGGTCCTGCT
Immune-related genes
IL-6ForwardGCGGAACCAAGAGCAGAGATGAG130
ReverseCCACGGCAGGACTGGATAATAACC
IL-8ForwardGCTGTCCTGGCTCTTCTCCT120
ReverseGCACACCTCTCTGTTGTCCTTC
TNF-α ForwardCCGTGGTCAGTTTCCATCAGG117
ReverseACTTTGCAGTTAGGTGACGCT
P450 (Metabolism of AFB1) genes
CYP1A1ForwardAGGACGGAGGCTGACAAGGTG104
ReverseAGGATGGTGGTGAGGAAGAGGAAG
CYP1A2ForwardCCACGCAGATCCCAAACGAG120
ReverseTGTGAGGGTACGTCACGAGG
IL6 = interleukin 6; IL8 = interleukin 8; TNF-α = tumor necrosis factor alpha; CYP1A1 = cytochrome P450 1A1; CYP1A2 = cytochrome P450 1A2.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lumsangkul, C.; Kaewtui, P.; Huanhong, K.; Tso, K.-H. Antioxidative and Antimycotoxigenic Efficacies of Thunbergia laurifolia Lindl. for Addressing Aflatoxicosis in Cherry Valley Ducks. Toxins 2024, 16, 334. https://doi.org/10.3390/toxins16080334

AMA Style

Lumsangkul C, Kaewtui P, Huanhong K, Tso K-H. Antioxidative and Antimycotoxigenic Efficacies of Thunbergia laurifolia Lindl. for Addressing Aflatoxicosis in Cherry Valley Ducks. Toxins. 2024; 16(8):334. https://doi.org/10.3390/toxins16080334

Chicago/Turabian Style

Lumsangkul, Chompunut, Phruedrada Kaewtui, Kiattisak Huanhong, and Ko-Hua Tso. 2024. "Antioxidative and Antimycotoxigenic Efficacies of Thunbergia laurifolia Lindl. for Addressing Aflatoxicosis in Cherry Valley Ducks" Toxins 16, no. 8: 334. https://doi.org/10.3390/toxins16080334

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop