Extracellular Nanovesicles Secreted by Human Osteosarcoma Cells Promote Angiogenesis
Abstract
:1. Introduction
2. Results
2.1. Extracellular Nanovesicles Release Is Increased by Acidic pH
2.2. OS-Derived EVs Are Internalized by Endothelial Cells
2.3. OS-Derived EVs Did Not Affect Endothelial Cells Viability and Migration
2.4. OS-Derived EVs Promoted Endothelial Cells Tubulogenesis and Induced New Blood Vessel Growth In Vivo
2.5. Angiogenesis-Related Proteins and miRNA Contained in OS-Derived EVs
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Extracellular Nanovesicles (EVs) Isolation and Purification
4.3. Electron Microscopy
4.4. Western Blot Analysis
4.5. Extracellular Nanovesicles Labelling and Uptake
4.6. Endothelial Cells Viability Assay
4.7. Endothelial Cells Migration Assay
4.8. In Vitro Tubulogenesis Assay
4.9. Chick Chorioallantoic Membrane (CAM) Angiogenesis Assay
4.10. Expression Profiles of Angiogenesis-Related Proteins
4.11. Expression of Angiogenesis-Related miRNA
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Dubois, S.; Demetri, G. Markers of angiogenesis and clinical features in patients with sarcoma. Cancer 2007, 109, 813–819. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; McManus, M.M.; Hughes, D.P. Understanding the Biology of Bone Sarcoma from Early Initiating Events through Late Events in Metastasis and Disease Progression. Front. Oncol. 2013, 17, 230. [Google Scholar] [CrossRef] [PubMed]
- Van Cruijsen, H.; Voest, E.E.; Punt, C.J.; Hoekman, K.; Witteveen, P.O.; Meijerink, M.R.; Puchalski, T.A.; Robertson, J.; Saunders, O.; Jürgensmeier, J.M.; et al. Phase I evaluation of cediranib, a selective VEGFR signalling inhibitor, in combination with gefitinib in patients with advanced tumours. Eur. J. Cancer 2010, 46, 901–911. [Google Scholar] [CrossRef] [PubMed]
- Xie, L.; Ji, T.; Guo, W. Anti-angiogenesis target therapy for advanced osteosarcoma. Oncol. Rep. 2017, 38, 625–636. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kurmasheva, R.T.; Dudkin, L.; Billups, C.; Debelenko, L.V.; Morton, C.L.; Houghton, P.J. The insulin-like growth factor-1 receptor-targeting antibody, CP-751,871, suppresses tumor-derived VEGF and synergizes with rapamycin in models of childhood sarcoma. Cancer Res. 2009, 69, 7662–7671. [Google Scholar] [CrossRef] [PubMed]
- Hattinger, C.M.; Fanelli, M.; Tavanti, E.; Vella, S.; Ferrari, S.; Picci, P.; Serra, M. Advances in emerging drugs for osteosarcoma. Expert Opin. Emerg. Drugs 2015, 20, 495–514. [Google Scholar] [CrossRef] [PubMed]
- Guo, L.; Guo, N. Exosomes: Potent regulators of tumor malignancy and potential bio-tools in clinical application. Crit. Rev. Oncol. Hematol. 2015, 95, 346–358. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Todorova, D.; Simoncini, S.; Lacroix, R.; Sabatier, F.; Dignat-George, F. Extracellular Vesicles in Angiogenesis. Circ. Res. 2017, 120, 1658–1673. [Google Scholar] [CrossRef] [PubMed]
- Théry, C.; Zitvogel, L.; Amigorena, S. Exosomes: Composition, biogenesis and function. Nat. Rev. Immunol. 2002, 2, 569–579. [Google Scholar] [CrossRef]
- Valadi, H.; Ekström, K.; Bossios, A.; Sjöstrand, M.; Lee, J.J.; Lötvall, J.O. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat. Cell Biol. 2007, 9, 654–659. [Google Scholar] [CrossRef] [Green Version]
- Hood, J.L.; Pan, H.; Lanza, G.M.; Wickline, S.A. Consortium for Translational Research in Advanced Imaging and Nanomedicine (C-TRAIN). Paracrine induction of endothelium by tumor exosomes. Lab. Invest. 2009, 89, 1317–1328. [Google Scholar] [CrossRef] [PubMed]
- Tadokoro, H.; Umezu, T.; Ohyashiki, K.; Hirano, T.; Ohyashiki, J.H. Exosomes derived from hypoxic leukemia cells enhance tube formation in endothelial cells. J. Biol. Chem. 2013, 48, 34343–34351. [Google Scholar] [CrossRef] [PubMed]
- Cui, H.; Seubert, B.; Stahl, E.; Dietz, H.; Reuning, U.; Moreno-Leon, L.; Ilie, M.; Hofman, P.; Nagase, H.; Mari, B.; et al. Tissue inhibitor of metalloproteinases-1 induces a pro-tumourigenic increase of miR-210 in lung adenocarcinoma cells and their exosomes. Oncogene 2015, 34, 3640–3650. [Google Scholar] [CrossRef] [PubMed]
- Treps, L.; Perret, R.; Edmond, S.; Ricard, D.; Gavard, J. Glioblastoma stem-like cells secrete the pro-angiogenic VEGF-A factor in extracellular vesicles. J. Extracell. Vesicles 2017, 6, 1359479. [Google Scholar] [CrossRef] [PubMed]
- Horie, K.; Kawakami, K.; Fujita, Y.; Sugaya, M.; Kameyama, K.; Mizutani, K.; Deguchi, T.; Ito, M. Exosomes expressing carbonic anhydrase 9 promote angiogenesis. Biochem. Biophys. Res. Commun. 2017, 492, 356–361. [Google Scholar] [CrossRef] [PubMed]
- Corbet, C.; Feron, O. Tumour acidosis: From the passenger to the driver’s seat. Nat. Rev. Cancer 2017, 17, 577–593. [Google Scholar] [CrossRef] [PubMed]
- Parolini, I.; Federici, C.; Raggi, C.; Lugini, L.; Palleschi, S.; De Milito, A.; Coscia, C.; Iessi, E.; Logozzi, M.; Molinari, A.; et al. Microenvironmental pH is a key factor for exosome traffic in tumor cells. J. Biol. Chem. 2009, 284, 34211–34222. [Google Scholar] [CrossRef]
- Avnet, S.; Lemma, S.; Cortini, M.; Pellegrini, P.; Perut, F.; Zini, N.; Kusuzaki, K.; Chano, T.; Grisendi, G.; Dominici, M.; et al. Altered pH gradient at the plasma membrane of osteosarcoma cells is a key mechanism of drug resistance. Oncotarget 2016, 7, 63408–63423. [Google Scholar] [CrossRef]
- Chano, T.; Avnet, S.; Kusuzaki, K.; Bonuccelli, G.; Sonveaux, P.; Rotili, D.; Mai, A.; Baldini, N. Tumour-specific metabolic adaptation to acidosis is coupled to epigenetic stability in osteosarcoma cells. Am. J. Cancer Res. 2016, 6, 859–875. [Google Scholar]
- De Palma, M.; Biziato, D.; Petrova, T.V. Microenvironmental regulation of tumour angiogenesis. Nat. Rev. Cancer 2017, 17, 457–474. [Google Scholar] [CrossRef]
- Maia, J.; Caja, S.; Strano Moraes, M.C.; Couto, N.; Costa-Silva, B. Exosome-Based Cell-Cell Communication in the Tumor Microenvironment. Front. Cell Dev. Biol. 2018, 6, 18. [Google Scholar] [CrossRef] [PubMed]
- Prada, I.; Meldolesi, J. Binding and Fusion of Extracellular Vesicles to the Plasma Membrane of Their Cell Targets. Int. J. Mol. Sci. 2016, 17, 1296. [Google Scholar] [CrossRef] [PubMed]
- Taraboletti, G.; D’Ascenzo, S.; Giusti, I.; Marchetti, D.; Borsotti, P.; Millimaggi, D.; Giavazzi, R.; Pavan, A.; Dolo, V. Bioavailability of VEGF in tumor-shed vesicles depends on vesicle burst induced by acidic pH. Neoplasia 2006, 8, 96–103. [Google Scholar] [CrossRef] [PubMed]
- Ban, J.J.; Lee, M.; Im, W.; Kim, M. Low pH increases the yield of exosome isolation. Biochem. Biophys. Res. Commun. 2015, 461, 76–79. [Google Scholar] [CrossRef] [PubMed]
- Daft, P.G.; Yang, Y.; Napierala, D.; Zayzafoon, M. The growth and aggressive behavior of human osteosarcoma is regulated by a CaMKII-controlled autocrine VEGF signaling mechanism. PLoS ONE 2015, 10, e0121568. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Zhang, F.; Zhang, Z.; Wang, D.; Cui, B.; Zeng, F.; Huang, L.; Zhang, Q.; Sun, Q. High expression levels of Cyr61 and VEGF are associated with poor prognosis in osteosarcoma. Pathol. Res. Pract. 2017, 213, 895–899. [Google Scholar] [CrossRef] [PubMed]
- Sulzbacher, I.; Birner, P.; Trieb, K.; Träxler, M.; Lang, S.; Chott, A. Expression of platelet-derived growth factor-AA is associated with tumor progression in osteosarcoma. Mod. Pathol. 2003, 16, 66–71. [Google Scholar] [CrossRef] [PubMed]
- Abd El-Rehim, D.M.; Osman, N.A. Expression of a disintegrin and metalloprotease 8 and endostatin in human osteosarcoma: Implication in tumor progression and prognosis. J. Egypt Natl. Canc. Inst. 2015, 27, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Liu, B.; Wu, Y.; Zhou, Y.; Peng, D. Endothelin A receptor antagonism enhances inhibitory effects of anti-ganglioside GD2 monoclonal antibody on invasiveness and viability of human osteosarcoma cells. PLoS ONE 2014, 9, e93576. [Google Scholar] [CrossRef]
- Zhang, H.; Lin, H.; Mo, X.; Chen, G.; Lin, L. Synergistic relationship between dipeptidyl peptidase IV and neutral endopeptidase expression and the combined prognostic significance in osteosarcoma patients. Med. Oncol. 2013, 30, 608. [Google Scholar] [CrossRef]
- Hirahata, M.; Osaki, M.; Kanda, Y.; Sugimoto, Y.; Yoshioka, Y.; Kosaka, N.; Takeshita, F.; Fujiwara, T.; Kawai, A.; Ito, H.; et al. PAI-1, a target gene of miR-143, regulates invasion and metastasis by upregulating MMP-13 expression of human osteosarcoma. Cancer Med. 2016, 5, 892–902. [Google Scholar] [CrossRef] [PubMed]
- Hu, C.; Wen, J.; Gong, L.; Chen, X.; Wang, J.; Hu, F.; Zhou, Q.; Liang, J.; Wei, L.; Shen, Y.; et al. Thrombospondin-1 promotes cell migration, invasion and lung metastasis of osteosarcoma through FAK dependent pathway. Oncotarget 2017, 8, 75881–75892. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Endo-Munoz, L.; Cai, N.; Cumming, A.; Macklin, R.; Merida de Long, L.; Topkas, E.; Mukhopadhyay, P.; Hill, M.; Saunders, N.A. Progression of Osteosarcoma from a Non-Metastatic to a Metastatic Phenotype Is Causally Associated with Activation of an Autocrine and Paracrine uPA Axis. PLoS ONE 2015, 10, e0133592. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.H.; Tsai, H.C.; Cheng, Y.C.; Lin, C.Y.; Huang, Y.L.; Tsai, C.H.; Xu, G.H.; Wang, S.W.; Fong, Y.C.; Tang, C.H. CTGF promotes osteosarcoma angiogenesis by regulating miR-543/angiopoietin 2 signaling. Cancer Lett. 2017, 391, 28–37. [Google Scholar] [CrossRef] [PubMed]
- Tieken, C.; Verboom, M.C.; Ruf, W.; Gelderblom, H.; Bovée, J.V.; Reitsma, P.H.; Cleton-Jansen, A.M.; Versteeg, H.H. Tissue factor associates with survival and regulates tumour progression in osteosarcoma. Thromb. Haemost. 2016, 115, 1025–1033. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tsagaraki, I.; Tsilibary, E.C.; Tzinia, A.K. TIMP-1 interaction with alphavbeta3 integrin confers resistance to human osteosarcoma cell line MG-63 against TNF-alpha induced apoptosis. Cell Tissue Res. 2010, 342, 87–96. [Google Scholar] [CrossRef]
- Becerra, S.P.; Notario, V. The effects of PEDF on cancer biology: Mechanisms of action and therapeutic potential. Nat. Rev. Cancer 2013, 13, 258–271. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.F.; Wang, Y.P.; Zhang, S.J.; Chen, Y.; Gu, H.F.; Dou, X.F.; Xia, B.; Bi, Q.; Fan, S.W. Exosomes containing differential expression of microRNA and mRNA in osteosarcoma that can predict response to chemotherapy. Oncotarget 2017, 8, 75968–75978. [Google Scholar] [CrossRef]
- Zhang, J.; Wang, T.Y.; Niu, X.C. Increased plasma levels of pentraxin 3 are associated with poor prognosis of colorectal carcinoma patients. Tohoku J. Exp. Med. 2016, 240, 39–46. [Google Scholar] [CrossRef]
- Miyamoto, S.; Yagi, H.; Yotsumoto, F.; Kawarabayashi, T.; Mekada, E. Heparin-binding epidermal growth factor-like growth factor as a novel targeting molecule for cancer therapy. Cancer Sci. 2006, 97, 341–347. [Google Scholar] [CrossRef]
- Nassiri, F.; Cusimano, M.D.; Scheithauer, B.W.; Rotondo, F.; Fazio, A.; Yousef, G.M.; Syro, L.V.; Kovacs, K.; Lloyd, R.V. Endoglin (CD105): A review of its role in angiogenesis and tumor diagnosis, progression and therapy. Anticancer Res. 2011, 31, 2283–2290. [Google Scholar] [PubMed]
- Hua, Z.; Lv, Q.; Ye, W.; Wong, C.K.; Cai, G.; Gu, D.; Ji, Y.; Zhao, C.; Wang, J.; Yang, B.B.; et al. MiRNA-directed regulation of VEGF and other angiogenic factors under hypoxia. PLoS ONE 2006, 1, e116. [Google Scholar] [CrossRef]
- Liu, Y.; Zhao, L.; Li, D.; Yin, Y.; Zhang, C.Y.; Li, J.; Zhang, Y. Microvesicle-delivery miR-150 promotes tumorigenesis by up-regulating VEGF, and the neutralization of miR-150 attenuate tumor development. Protein Cell 2013, 4, 932–941. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hassel, D.; Cheng, P.; White, M.P.; Ivey, K.N.; Kroll, J.; Augustin, H.G.; Katus, H.A.; Stainier, D.Y.; Srivastava, D. MicroRNA-10 regulates the angiogenic behavior of zebrafish and human endothelial cells by promoting vascular endothelial growth factor signaling. Circ. Res. 2012, 111, 1421–1433. [Google Scholar] [CrossRef] [PubMed]
- Gallach, S.; Calabuig-Fariñas, S.; Jantus-Lewintre, E.; Campus, C. MicroRNAs: Promising new antiangiogenic targets in cancer. Biomed. Res. Int. 2014, 2014, 878450. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Luo, F.; Wang, B.; Li, H.; Xu, Y.; Liu, X.; Shi, L.; Lu, X.; Xu, W.; Lu, L.; et al. STAT3-regulated exosomal miR-21 promotes angiogenesis and is involved in neoplastic processes of transformed human bronchial epithelial cells. Cancer Lett. 2016, 370, 125–135. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Ma, X.; Wang, J.; Zhao, Y.; Wang, Y.; Bihl, J.C.; Chen, Y.; Jiang, C. Glioma stem cells-derived exosomes promote the angiogenic ability of endothelial cells through miR-21/VEGF signal. Oncotarget 2017, 8, 36137–36148. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liang, Z.; Chi, Y.J.; Lin, G.Q.; Luo, S.H.; Jiang, Q.Y.; Chen, Y.K. MiRNA-26a promotes angiogenesis in a rat model of cerebral infarction via PI3K/AKT and MAPK/ERK pathway. Eur. Rev. Med. Pharmacol. Sci. 2018, 22, 3485–3492. [Google Scholar] [CrossRef] [PubMed]
- Jo, H.N.; Kang, H.; Lee, A.; Choi, J.; Chang, W.; Lee, M.S.; Kim, J. Endothelial miR-26a regulates VEGF-Nogo-B receptor-mediated angiogenesis. BMB Rep. 2017, 50, 384–389. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.L.; Gong, W.G.; Yuan, Q.L. Effects of miR-27a upregulation on thyroid cancer cells migration, invasion, and angiogenesis. Genet. Mol. Res. 2016, 15. [Google Scholar] [CrossRef]
- Ohyashiki, J.H.; Umezu, T.; Ohyashiki, K. Exosomes promote bone marrow angiogenesis in hematologic neoplasia: The role of hypoxia. Curr. Opin. Hematol. 2016, 23, 268–273. [Google Scholar] [CrossRef] [PubMed]
- Kalinina, N.; Klink, G.; Glukhanyuk, E.; Lopatina, T.; Efimenko, A.; Akopyan, Z. miR-92a regulates angiogenic activity of adipose-derived mesenchymal stromal cells. Exp. Cell Res. 2015, 339, 61–66. [Google Scholar] [CrossRef] [PubMed]
- Fang, L.; Du, W.W.; Yang, W.; Rutnam, Z.J.; Peng, C.; Li, H.; O’Malley, Y.Q.; Askeland, R.W.; Sugg, S.; Liu, M.; et al. MiR-93 enhances angiogenesis and metastasis by targeting LATS2. Cell Cycle 2012, 11, 4352–4365. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liang, L.; Zhao, L.; Zan, Y.; Zhu, Q.; Ren, J.; Zhao, X. MiR-93-5p enhances growth and angiogenesis capacity of HUVECs by down-regulating EPLIN. Oncotarget 2017, 8, 107033–107043. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Muramatsu, F.; Kidoya, H.; Naito, H.; Sakimoto, S.; Takakura, N. microRNA-125b inhibits tube formation of blood vessels through translational suppression of VE-cadherin. Oncogene 2013, 32, 414–421. [Google Scholar] [CrossRef] [PubMed]
- Lawson, J.; Dickman, C.; MacLellan, S.; Towle, R.; Jabalee, J.; Lam, S.; Garnis, C. Selective secretion of microRNAs from lung cancer cells via extracellular vesicles promotes CAMK1D-mediated tube formation in endothelial cells. Oncotarget 2017, 8, 83913–83924. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, K.; Pan, Q.; Zhang, X.; Kong, L.Q.; Fan, J.; Dai, Z.; Wang, L.; Yang, X.R.; Hu, J.; Wan, J.L.; et al. MiR-146a enhances angiogenic activity of endothelial cells in hepatocellular carcinoma by promoting PDGFRA expression. Carcinogenesis 2013, 9, 2071–2079. [Google Scholar] [CrossRef]
- Seo, H.H.; Lee, S.Y.; Lee, C.Y.; Kim, R.; Kim, P.; Oh, S.; Lee, H.; Lee, M.Y.; Kim, J.; Kim, L.K.; et al. Exogenous miRNA-146a Enhances the Therapeutic Efficacy of Human Mesenchymal Stem Cells by Increasing Vascular Endothelial Growth Factor Secretion in the Ischemia/Reperfusion-Injured Heart. J. Vasc. Res. 2017, 54, 100–108. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Zhang, Y.; Sun, X.X.; Ma, X.; Chen, Z.N. microRNA-146a inhibits cancer metastasis by downregulating VEGF through dual pathways in hepatocellular carcinoma. Mol. Cancer 2015, 14, 5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, X.; Zeng, K.; Xu, M.; Hu, X.; Liu, X.; Xu, T.; He, B.; Pan, Y.; Sun, H.; Wang, S. SP1-induced lncRNA-ZFAS1 contributes to colorectal cancer progression via the miR-150-5p/VEGFA axis. Cell Death Dis. 2018, 9, 982. [Google Scholar] [CrossRef]
- Seok, J.K.; Lee, S.H.; Kim, M.J.; Lee, Y.M. MicroRNA-382 induced by HIF-1α is an angiogenic miR targeting the tumor suppressor phosphatase and tensin homolog. Nucleic Acids Res. 2014, 42, 8062–8072. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Ma, J.; Wang, A.; Wang, W.; Luo, S.; Liu, Y.; Ye, X. A support vector machine and a random forest classifier indicates a 15-miRNA set related to osteosarcoma recurrence. Onco Targets Ther. 2018, 11, 253–269. [Google Scholar] [CrossRef] [PubMed]
- Zhou, C.; Jiang, C.Q.; Zong, Z.; Lin, J.C.; Lao, L.F. miR-146a promotes growth of osteosarcoma cells by targeting ZNRF3/GSK-3β/β-catenin signaling pathway. Oncotarget 2017, 8, 74276–74286. [Google Scholar] [CrossRef] [PubMed]
- Chen, D.; Zhang, Y.J.; Zhu, K.W.; Wang, W.C. A systematic review of vascular endothelial growth factor expression as a biomarker of prognosis in patients with osteosarcoma. Tumour Biol. 2013, 34, 1895–1899. [Google Scholar] [CrossRef] [PubMed]
- Kubota, D.; Kosaka, N.; Fujiwara, T.; Yoshida, A.; Arai, Y.; Qiao, Z.; Takeshita, F.; Ochiya, T.; Kawai, A.; Kondo, T. miR-125b and miR-100 Are Predictive Biomarkers of Response to Induction Chemotherapy in Osteosarcoma. Sarcoma 2016, 2016, 1390571. [Google Scholar] [CrossRef] [PubMed]
- Xiao, J.; Yu, W.; Hu, K.; Li, M.; Chen, J.; Li, Z. miR-92a promotes tumor growth of osteosarcoma by targeting PTEN/AKT signaling pathway. Oncol. Rep. 2017, 37, 2513–2521. [Google Scholar] [CrossRef]
- Wang, L.; Aireti, A.; Aihaiti, A.; Li, K. Expression of microRNA-150 and its Target Gene IGF2BP1 in Human Osteosarcoma and their Clinical Implications. Pathol. Oncol. Res. 2018. [Google Scholar] [CrossRef]
- Kawano, M.; Tanaka, K.; Itonaga, I.; Ikeda, S.; Iwasaki, T.; Tsumura, H. microRNA-93 promotes cell proliferation via targeting of PTEN in osteosarcoma cells. J. Exp. Clin. Cancer Res. 2015, 34, 76. [Google Scholar] [CrossRef]
- Sun, X.; Dai, G.; Yu, L.; Hu, Q.; Chen, J.; Guo, W. miR-143-3p inhibits the proliferation, migration and invasion in osteosarcoma by targeting FOSL2. Sci. Rep. 2018, 8, 606. [Google Scholar] [CrossRef]
- Sanz-Rubio, D.; Martin-Burriel, I.; Gil, A.; Cubero, P.; Forner, M.; Khalyfa, A.; Marin, J.M. Stability of Circulating Exosomal miRNAs in Healthy Subjects. Sci. Rep. 2018, 8, 10306. [Google Scholar] [CrossRef]
- Logozzi, M.; Mizzoni, D.; Angelini, D.F.; Di Raimo, R.; Falchi, M.; Battistini, L.; Fais, S. Microenvironmental pH and Exosome Levels Interplay in Human Cancer Cell Lines of Different Histotypes. Cancers (Basel) 2018, 10, 370. [Google Scholar] [CrossRef] [PubMed]
- Torreggiani, E.; Perut, F.; Roncuzzi, L.; Zini, N.; Baglìo, S.R.; Baldini, N. Exosomes: Novel effectors of human platelet lysate activity. Eur. Cell Mater. 2014, 28, 137–151. [Google Scholar] [CrossRef] [PubMed]
- Krause, A.W.; Carley, W.W.; Webb, W.W. Fluorescent erythrosin B is preferable to trypan blue as a vital exclusion dye for mammalian cells in monolayer culture. J. Histochem. Cytochem. 1984, 32, 1084–1090. [Google Scholar] [CrossRef] [PubMed]
- Yue, P.Y.; Leung, E.P.; Mak, N.K.; Wong, R.N. A simplified method for quantifying cell migration/wound healing in 96-well plates. J. Biomol. Screen 2010, 15, 427–433. [Google Scholar] [CrossRef] [PubMed]
- Manjunathan, R.; Ragunathan, M. Chicken chorioallantoic membrane as a reliable model to evaluate osteosarcoma-an experimental approach using SaOS2 cell line. Biol. Proced. Online 2015, 17, 10. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
microRNA | Target | Function | References |
---|---|---|---|
miR-10b-5p | HOXD10, FLT1 | Positive regulation of VEGF receptor signaling pathway | [44,45] |
miR-21-5p | PTEN | Increasing VEGF production | [46,47] |
miR-26a-5p | AKT and ERK1/2 Nogo-B receptor SMAD-1 and SMAD-4 | Up-regulation of HIF-1 α expression Decreasing the VEGF-induced phosphorylation of the endothelial nitric oxide synthase | [48,49] |
miR-27a-3p | Sprouty2 and Sema6A | Increase endothelial cells mediated angiogenesis | [50] |
miR-92a-3p | VHL gene ITGA5 and MEK4 | Stabilization of HIF-1 α, thus promoting VEGF transcription. Down-regulation of HGF secretion | [51,52] |
miR-93a-5p | Integrin β8, LATS2, PTEN, VEGF | Inhibition of EPLIN expression in endothelial cells. | [42,45,53,54] |
miR-106a-5p | VEGF | Anti-angiogenic | [42] |
miR-125b-5p | HER2, HER3 | Decrease of ERBB2 and VEGF expression Inhibits translation of VE-cadherin | [45,55] |
miR-143-3p | CAMK1D | Increases tube formation by endothelial cells | [56] |
miR-145-5p | CAMK1D, P70S6K1 | Increases tube formation by endothelial cells Inhibition tumor angiogenesis | [45,56] |
miR-146a-5p | Smad4, HAb18G | Increases the expression of VEGF Promoting PDGFRA expression Downregulates VEGF | [57,58,59] |
miR-150-5p | ING4, VEGF | Up-regulation the secretion of VEGF Negative regulator of VEGF A | [43,60] |
miR-382-5p | PTEN | Increases vascular endothelial cell proliferation, migration and tube formation | [61] |
miRNA Name | Target Sequence |
---|---|
hsa-miR-101-3p | UACAGUACUGUGAUAACUGAA |
hsa-miR-106a-5p | AAAAGUGCUUACAGUGCAGGUAG |
hsa-miR-10b-5p | UACCCUGUAGAACCGAAUUUGUG |
hsa-miR-125b-5p | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-143-3p | UGAGAUGAAGCACUGUAGCUC |
hsa-miR-145-5p | GUCCAGUUUUCCCAGGAAUCCCU |
hsa-miR-146a-5p | UGAGAACUGAAUUCCAUGGGUU |
hsa-miR-150-5p | UCUCCCAACCCUUGUACCAGUG |
hsa-miR-16-5p | UAGCAGCACGUAAAUAUUGGCG |
hsa-miR-210-3p | CUGUGCGUGUGACAGCGGCUGA |
hsa-miR-214-3p | ACAGCAGGCACAGACAGGCAGU |
hsa-miR-21-5p | UAGCUUAUCAGACUGAUGUUGA |
hsa-miR-23a-3p | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-26a-5p | UUCAAGUAAUCCAGGAUAGGCU |
hsa-miR-27a-3p | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-296-5p | AGGGCCCCCCCUCAAUCCUGU |
hsa-miR-29b-3p | UAGCACCAUUUGAAAUCAGUGUU |
hsa-miR-34a-5p | UGGCAGUGUCUUAGCUGGUUGU |
hsa-miR-382-5p | GAAGUUGUUCGUGGUGGAUUCG |
hsa-miR-92a-3p | UAUUGCACUUGUCCCGGCCUGU |
hsa-miR-93-5p | CAAAGUGCUGUUCGUGCAGGUAG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Perut, F.; Roncuzzi, L.; Zini, N.; Massa, A.; Baldini, N. Extracellular Nanovesicles Secreted by Human Osteosarcoma Cells Promote Angiogenesis. Cancers 2019, 11, 779. https://doi.org/10.3390/cancers11060779
Perut F, Roncuzzi L, Zini N, Massa A, Baldini N. Extracellular Nanovesicles Secreted by Human Osteosarcoma Cells Promote Angiogenesis. Cancers. 2019; 11(6):779. https://doi.org/10.3390/cancers11060779
Chicago/Turabian StylePerut, Francesca, Laura Roncuzzi, Nicoletta Zini, Annamaria Massa, and Nicola Baldini. 2019. "Extracellular Nanovesicles Secreted by Human Osteosarcoma Cells Promote Angiogenesis" Cancers 11, no. 6: 779. https://doi.org/10.3390/cancers11060779