1. Background
Bladder cancer is considered a critical malignancy worldwide. Approximately, 90% of the bladder cancers manifest as transitional cell carcinoma (TCC), which are categorized as non-muscle invasive bladder cancer (NMIBC) and muscle invasive bladder cancer (MIBC) [
1,
2,
3]. Although the common treatment, including transurethral resection, intravesical immunotherapy, and chemotherapy, is effective in the patients with NMIBC, depending on the tumor heterogeneity and clinical stage and grade, the tumors tend to recur and progress into an invasive disease such as MIBC [
3]. Maximum mortality cases are encountered among patients with MIBC [
3]. Therefore, the development of effective strong and safe novel drugs for MIBC treatment is urgently needed.
The main process in the development and progression of bladder cancer is strongly associated with proliferation and metastasis of tumor cells [
3]. Intensive research has demonstrated that cancer cells proliferated via regulation of control of cell cycle, apoptosis-related factors, and activation of MAPK and AKT signaling pathways [
4,
5,
6]. Metastasis potential is responsible for the migration and invasion of tumor cells [
3,
7]. Angiogenesis is a primary prerequisite pathological phenomenon during proliferation and metastasis of tumor cells [
8]. A number of anti-cancer drugs have been developed to estimate the tumor-suppressive efficacy of the target molecules [
9]. However, a highly efficacious, safe, and novel agent for bladder tumor treatment has not yet been found.
Cyclic depsipeptides, one variety of secondary metabolites produced by fungi, bacteria, and plants, are known to possess numerous pharmacological properties, such as antifungal, antibacterial, immunomodulatory, and antitumor properties [
10,
11]. Sansalvamide analogs are the new cytotoxic cyclic pentadepsipeptide present in marine plants, namely
Fusarium species [
11]. Sansalvamide A, which is a cyclic pentadepsipeptide found in
Halodule wrightii, exhibited a molecular structure containing one hydroxy acid (leucic acid (
O-Leu)) and four hydrophobic amino acids (two leucines (Leu), phenylalanine (Phe), and valine (Val)) [
11,
12]. Additionally,
N-methylsansalvamide, which was purified from green algae in ocean, had a molecular structure comprising one hydroxy acid (leucic acid (
O-Leu)) and four amino acids (phenylalanine (Phe), leucine (Leu),
N-methyl-leucine (
N-MeLeu), and valine (Val)) [
11,
13]. Both sansalvamide A and
N-methylsansalvamide have reported a weak anticancer effect [
11,
12,
13].
We identified a cyclic pentadepsipeptide,
N-methylsansalvamide (MSSV), which was produced by
Fusarium spp. isolated from Korean potato. MSSV (-
OLeu-Val-
NMeLeu-Phe-Leu) has a cyclic peptide structure containing a sansalvamide attached to four amino acids and one hydroxy acid. It has a similar molecular structure compared to that of a peptide previously isolated from cultures of a marine Fusarium sp. found in green algae [
11,
13]. A previous study revealed in vitro cytotoxic effects of cyclic depsipeptides including sansalvamide,
N-methylsansalvamide, and their analogue [
10,
11,
12,
13,
14]. However, the molecular effect and safety of MSSV obtained from land plant-associated fungus as a strong chemotherapeutic agent against cancer has not yet been investigated. Here, to our knowledge, the anti-tumor efficacy, anti-angiogenic effect, and single-dose acute toxicity of MSSV in cancer cells both in vitro and in vivo are reported for the first time.
2. Materials and Methods
2.1. Materials
Polyclonal antibodies specific to extracellular signal regulated kinase (ERK), phospho-ERK, p38MAPK, phospho-p38MAPK, c-Jun N-terminal kinase (JNK), phospho-JNK, AKT, and phospho-AKT were obtained from Cell Signaling (Danvers, MA, USA). U0126, SP600125, SB203580, and LY294002 were obtained from Calbiochem (San Diego, CA, USA). Polyclonal antibodies against cyclin D1, cyclin E, CDK2, CDK4, p53, p21WAF1, p27KIP1, and GAPDH were obtained from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). Polyclonal antibodies specific to FAS, B-cell lymphoma 2 (Bcl-2), Bcl-2-associated X protein (Bax), X-linked inhibitor of apoptosis protein (XIAP), poly(ADP-ribose) polymerase-1 (PARP-1), caspase-3, caspase-6, caspase-7, caspase-8, caspase-9, and actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and Cell Signaling (Danvers, MA, USA). Polyclonal antibodies to phospho-endothelial nitric oxide synthase (eNOS) (S1177) and eNOS were obtained from Cell Signaling (Danvers, MA, USA). Human recombinant VEGF was purchased from Research and Diagnostic Systems, Inc. (Minneapolis, MN, USA).
2.2. Production of MSSV and Structure Elucidation
MSSV was obtained similarly as described in the previous studies [
10,
12]. Briefly, MSSV was produced by cultivation of
Fusarium spp. KCCM12601P isolated from Korean potato in the
Fusarium defined media agar at 25 °C for 10 days. The culture was extracted with same volume of chloroform by agitation at 150 rpm for 6 h (25 °C). The extracted solvent was filtrated through Whatman No. 4 filter and the filtrate was evaporated to dryness at 36 °C using rotary evaporator. The residue was dissolved in HPLC-grade methanol and the solution was filtered through a Whatman PVDF filter (pore size 0.45 μm). MSSV was further purified by recycling preparative HPLC (Japan Analytical Industry Co. Ltd., Tokyo, Japan) equipped with UV detector (Japan Analytical Industry Co. Ltd., Tokyo, Japan) and fraction collector (Japan Analytical Industry Co. Ltd., Tokyo, Japan) using PrepHT XDB-C18 column (21.2 × 250 mm, 7-micron, Agilent, Pal Alto, CA, USA) at 25 °C. A mixture of acetonitrile and water (90:10,
v/
v) was applied as mobile phase (flow rate of 6 mL/min) and MSSV peak was monitored at 210 nm. MSSV powder was obtained from the collected solution after concentration with rotary evaporator (Eyela, Tokyo Rikakikai Co. Ltd., Tokyo, Japan).
The molecular formula of MSSV was assigned as C33H52N4O6 (obsd (M + H)+ as m/z 600.43) by high-resolution electrospray ionization mass spectra (HR-ESI-MS) and by using Waters Synapt G2 mass spectrometer (Waters, city, Milford, MA, USA). 1H-(400 MHz), 13C-(100 MHz) NMR spectra were recorded on a Bruker Avance II 400 MHz NMR spectrometer (Karlsruhe, Germany) in ppm relative to that of tetramethylsilane (TMS) as an internal standard (J in Hz) at 294 K.
2.3. Cell Culture
The human bladder carcinoma cell lines, 5637 and T24, were purchased from the American Type Culture Collection (Manassas, VA, USA) and maintained in Dulbecco’s modified Eagle medium supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 μg/mL streptomycin at 37 °C in a 5% CO2 humidified incubator. The 5637 cells were referred to as MGH-U1 cells. Additionally, primary human umbilical vein endothelial cells (HUVECs) were obtained from Lonza (Walkersville, MD, USA). Cells were grown on plates coated with 0.1% gelatin (Sigma, San Diego, CA, USA) in endothelial basic medium (EBM) and cultured in endothelial growth medium-2 (EGMTM 2) BulletkitTM (Lonza) at 37 °C in a 5% CO2 humidified incubator. All experiments were performed between passages 2 and 5.
2.4. Cell Viability
Cell viability was performed using a modification of the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Briefly, cells were plated in 96-well plates (6 × 103 cells/well), followed by incubation with MSSV (0, 10, 20, and 30 µg/mL). After 24 h incubation, the plate was washed and fresh medium containing 10 μL of 5 mg/mL MTT was added. After 1 h, the medium was removed and replaced with 100 μL of dimethyl sulfoxide (DMSO). Absorbance at 540 nm was measured using a fluorescent plate reader.
2.5. Cell Counting
Cells were plated in 6-well plates and treated with MSSV (0, 10, 20, and 30 µg/mL) for 24 h. The cells were removed from the plates by treatment with 0.25% trypsin containing 0.2% EDTA (Corning, NY, USA). Separated cells were mixed with 50 μL of 0.4% trypan blue (Sigma-Aldrich, St. Louis, MI, USA) by gentle pipetting. Then, 20 μL of the mixture was loaded into each chamber of a hemocytometer and counted.
2.6. Cell Cycle Analysis
Cells were harvested and fixed in 70% ethanol. After washing once with ice-cold phosphate buffered saline (PBS), cells were incubated with RNase (1 mg/mL) followed by propidium iodide (50 mg/mL). The phase distribution of the cell cycle was analyzed using a flow cytometer (FACStar, BD Biosciences, San Jose, CA, USA) equipped with the BD Cell Fit software.
2.7. Apoptosis Assay
For the apoptosis assay, Cell Death Detection ELISA Plus Kit (Roche Diagnostics, Pleasanton, CA, USA) was used by measurement of histone-complexed DNA fragments. Briefly, cells were cultured and treated with various concentrations of MSSV in 96-well plates. After 24 h, collected cells were treated with lysis buffer and centrifuged at 12,000 rpm. Supernatants were transferred to a streptavidin-coated 96 well microplate and incubated with anti-histone antibody (biotin-labeled) and anti-DNA antibody (peroxidase-conjugated) for 2 h at room temperature. After washing with the plates, the absorbance was determined using precision microplate reader at 405 nm.
2.8. Immunoblotting and Immunoprecipitation
Cells were washed twice with cold PBS and freeze–thawed in 200 μL of lysis buffer (containing HEPES (pH 7.5), 50; NaCl, 150; EDTA, 1; DTT, 1; EGTA, 2.5; β-glycerophosphate, 10; Na3VO4, 0.1; NaF, 1; and PMSF, 0.1 (all in mmol/L); 10% glycerol; 0.1% Tween-20; 10 μg/mL leupeptin; and 2 μg/mL aprotinin). After the cells were scraped into 1.5-mL tubes, the lysates were incubated on ice for 10 min. The cells were then centrifuged at 10,000× g for 10 min at 4 °C. The amount of protein was determined using a BCA protein assay reagent kit (Thermo Fisher Scientific Inc., Waltham, MA, USA). An equal amount of protein (25 μg each) was loaded onto a sodium dodecyl sulfate (SDS, 0.1%)–polyacrylamide gel (10%) and resolved by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions. The proteins were transferred onto nitrocellulose membranes (Hybond, GE Healthcare Bio-Sciences, Marlborough, MA, USA). After blocking with 5% skim milk, the membranes were incubated with primary antibodies for 12 h, followed by incubation with peroxidase-conjugated secondary antibodies for 90 min. The immunocomplexes were then detected using a chemiluminescence reagent kit (GE Healthcare Bio-Sciences, Marlborough, MA, USA). For immunoprecipitation analysis, equal amounts of cell lysates were incubated with the indicated antibodies at 4 °C overnight. Protein A-Sepharose beads (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) were then added to the immunocomplexes, followed by incubation at 4 °C for 2 h. The immunoprecipitated complexes were washed with 1× lysis buffer three times, resuspended in SDS-PAGE sample buffer containing β-mercaptoethanol (Bio-Rad, Richmond, CA, USA), and separated by electrophoresis.
2.9. Wound Healing Migration Assay
Cells (3 × 105/well) were plated in 6-well plates. Cells were pretreated with mitomycin C (5 μg/mL, Sigma #M4287) for 2 h to inhibit cell proliferation. The cell surface area was then scratched with a 2 mm-wide pipette tip. After washing with PBS three times, the plate was incubated with culture media in the presence or absence of MSSV (0, 10, 20, and 30 µg/mL) for 24 h. The recovery capacity of the MSSV-treated cancer cells migrating into the scratched area was measured and compared with that of the control cells. Cellular images were photographed under an inverted microscope at 40× magnification.
2.10. Boyden Chamber Invasion Assay
Invasiveness was estimated using an invasion assay kit (Cell Biolabs, San Diego, CA, USA), according to the manufacturer’s instructions. Briefly, 2.5 × 104 cells were resuspended in serum-free culture medium and incubated with mitomycin C (5 μg/mL) for 2 h before being seeded in the upper chamber. The medium containing 10% FBS or VEGF was added to the lower chamber as a chemo-attractant. After 24 h, cells in the lower chamber were fixed, stained with 0.01% crystal violet in 20% ethanol, and photographed.
2.11. Zymography
The conditioned medium was obtained and electrophoresed on a polyacrylamide gel containing 0.25% gelatin. The gel was washed twice for 15 min at room temperature with 2.5% Triton X-100. Subsequently, the gel was incubated at 37 °C overnight in a buffer containing 150 mM NaCl, 50 mM Tris-HCl, and 10 mM CaCl2 and having a pH of 7.5. The gel was stained with 0.2% Coomassie blue and photographed on a light box. Proteolysis was detected as a white zone on a blue field.
2.12. Electrophoretic Mobility Shift Assay (EMSA)
Nuclear extracts were prepared with a Nuclear Extraction kit (Panomics, Fremont, CA, USA). Briefly, cells were harvested by centrifugation, washed, and resuspended in a buffer containing 10 mM HEPES (pH 7.9), 10 mM KCl, 1 mM DTT, 0.5 mM PMSF, 0.1 mM EDTA, and 0.1 mM EGTA. After incubation on ice for 15 min, the cells were mixed vigorously with 0.5% NP-40. The nuclear pellet was separated by centrifugation, followed by extraction in a buffer containing 20 mM HEPES (pH 7.9), 400 mM NaCl, 1 mM DTT, 1 mM PMSF, 1 mM EDTA, and 1 mM EGTA at 4 °C for 15 min. The nuclear extract (10–20 μg) was preincubated at 4 °C for 30 min with a 100-fold excess of an unlabeled oligonucleotide spanning the −79 position of the MMP-9 cis-acting element of interest. The sequences were as follows: AP-1, CTGACCCCTGAGTCAGCACTT; NF-κB, CAGTGGAATTCCCCAGCC; and Sp-1, GCCCATTCCTTCCGCCCCCAGATGAAGCAG. The reaction mixture was then incubated at 4 °C for 20 min in a buffer (25 mM HEPES buffer (pH 7.9), 0.5 mM EDTA, 0.5 mM DTT, 50 mM NaCl, and 2.5% glycerol) with 2 μg of poly dI/dC and 5 fmol (2 × 104 cpm) of a Klenow end-labeled (32P ATP) 30-mer oligonucleotide, which spanned the DNA-binding site of the MMP-9 promoter. The reaction mixture was resolved by electrophoresis at 4 °C using a 6% polyacrylamide gel. The gel was exposed on to an X-ray film overnight. The gray values of the blots were measured using the Image-Pro Plus 6.0 software (Media Cybernetics, Rockville, MD, USA).
2.13. Colony Tube Formation Assay (HUVECs)
Colony tube formation by HUVEC on a Matrigel was performed as described previously [
15]. Briefly, HUVECs treated with MSSV (0, 1, 2.5 and 5 µg/mL) were incubated in a BD Matrigel matrix growth factor reduced-coated 24-well plate. After 8 h of incubation, tube formation was observed using an inverted microscope (40× magnification) and quantified by measuring the length of tubes using Image-Pro Plus software.
2.14. Aortic Ring Assay
The mouse aortic ring angiogenesis assay was performed as previously described [
15]. Briefly, the aortas isolated from C57BL/6 mice were cut into sections of 1–1.5 mm long rings, and individually embedded in the Matrigel pre-coated wells. The aortic rings were incubated with the growth medium containing VEGF (50 ng/mL) and MSSV (25 and 50 µg/mL) for 9 days. The sprouting of endothelial tubes was quantified using Image-Pro Plus software (Media Cybernetics, Rockville, MD, USA). All animal experiments were performed with the approval of the Animal Care and Use Committee of Chungbuk National University.
2.15. Plug In Vivo Assay
Matrigel plug angiogenesis assay was performed as described previously [
15]. Briefly, a mixture of BD Matrigel matrix (0.5 mL) and heparin (50 unit/mL; BD Bioscience) was subcutaneously injected into C57BL/6 mice (aged 6–7 weeks) with VEGF (50 ng/mL) and MSSV (125 and 250 µg/mL). After 7 days, mice were euthanized and the Matrigel plugs were removed. Vascularization was determined by measuring the hemoglobin content of the Matrigel plugs using the Drabkin method (Drabkin reagent kit 525, Sigma-Aldrich, Louis, MO, USA) as well as the infiltrated endothelial cell count in the Matrigel plugs via CD31 antibody staining. All animal experiments were performed with the approval of the Animal Care and Use Committee of Chungbuk National University.
2.16. Immunochemistry (CD31)
Paraffin sections (5 µm thick) were deparaffinized and rehydrated. Nonspecific sites were blocked with a solution containing 5% bovine serum albumin in PBS (pH 7.4) for 1 h. The sections were incubated overnight at 4 °C with QD565 nanoparticle-conjugated CD31 antibody (1:100) and further incubated with a fluorescent secondary IgG antibody (1:300). Images were obtained using confocal laser scanning microscopy (Carl Zeiss LSM 510, Carl Zeiss, Jena, Germany).
2.17. Hematoxylin and Eosin (H&E) Staining
The transplanted tumor tissues from mice were removed, fixed with formalin, and embedded in paraffin. Paraffin sections (5 µm thick) were stained with hematoxylin and eosin. Sections were deparaffinized in xylene and rehydrated in a graded series of alcohol. The tissue sections were stained for 7 min in 10% hematoxylin (Sigma-Aldrich) and the cytoplasm was subsequently stained for 5 min in 1% eosin (Sigma-Aldrich). The sections were imaged using an inverted microscope (Leica, Wetzlar, Germany).
2.18. Xenograft Experiment
For the nude mice xenograft tumor assay, 3.6 ×107 T24 cells/mL were suspended in 100 µL PBS and mixed with 100 µL BD Matrigel matrix (BD Biosciences, NJ, USA); this solution was then injected subcutaneously into the back of male BALB/c nude mice (7-week-old; weight, 23–28 g). The mice were randomly divided into five groups (n = 6) when the tumor volume reached an average size of 200–400 mm3. Tumor volume was measured every 2 or 3 days using Vernier calipers and calculated using the formula (Tumor volume (TV) = (W2 × L)/2). Vehicle alone (methanol), MSSV (1, 5, and 15 mg/kg) were orally administered daily for 15 days and cisplatin (5 mg/kg) was intraperitoneally injected daily for 12 days. The general condition and body weight of mice were monitored daily. Tumor inhibition rate (%) was calculated using the formula (mean tumor weight of vehicle group−mean tumor weight of experiment group)/mean tumor weight of vehicle group ×100).
2.19. Oral Acute Toxicity and Biochemical Marker (ALT, AST) Test
Acute oral toxicity study was conducted at the Biotoxtech Co., Ltd. (Ochang, South Korea) which follows the Regulation of Good Laboratory Practice (GLP), as inspected by the Ministry of Food and Drug Safety. This study was approved by the Institutional Animal Care and Use Committees of Biotoxtech Co., Ltd. (Approval No. 150048). In this study, the animals used were 6 week old specific pathogen free (SPF) CrljOri:CD1 (ICR) male (25.3–29.0 g, 10 animals) and female (21.6–25.0 g, 10 animals) mice. There were four groups of ICR mice (5 mice/sex/group). Vehicle (DMSO, 4 mL/kg) or MSSV (2000 mg/4 mL/kg) was administrated only once on day 0 and observed until 14 days after treatment. On day 0, general symptoms (types of toxic indications, times of toxic expression and recovery times) and any deaths were observed at 30 min and at 1, 2, 4, and 6 h after administration of MSSV. General symptoms were continuously recorded once daily until day 14. Body weight were measured on the day 0, 1, 3, 7, and 14 after administration. On the day 14, all mice were euthanized under isoflurane anesthesia, and blood was collected from the abdominal aorta. The weights were statistically analyzed by using SAS (version 9.3, SAS Institute Inc., USA). The level of aspartate transaminase (AST) and alanine aminotransferase (ALT) in serum samples were determined by the manufacturer’s instructions. H&E staining was performed on tissue samples.
2.20. Statistics
All experiments were independently performed at least three times. One-way ANOVA and Student’s t-test were used to analyze the statistical significance among groups. Differences were considered significant when p value was < 0.05.
4. Discussion
In this study, we focused on MSSV as a strong anti-tumor agent. As revealed by cell counting and cell viability assay, MSSV treatment inhibited the proliferation of both T-24 and 5637 bladder cancer cell lines. Previous studies have reported that sansalvamide analogue (sansalvamide 12) suppressed pancreatic cell growth by arresting the G1-phase cell cycle [
16]. Hence, we examined whether MSSV affects cell cycle regulation in bladder cancer cell lines. As expected, MSSV induced G1-phase cell cycle arrest in both T-27 and 5637 cell lines, which is associated with reduced expression of cyclin D1/CDK4 and cyclin E/CDK2 that are the two main protein complexes responsible for G1- to S-phase progression [
4,
5,
7]. Investigation of both the MSSV-treated bladder cancer cell lines indicated an increase in p21WAF1 and p27KIP1 levels without an alteration in p53 level. These results demonstrated that MSSV suppresses the proliferation of bladder cancer cells via G1-phase cell cycle arrest by increasing p21WAF1 and p27KIP1 levels.
Apoptosis is known to regulate the response of cell death program [
17,
18]. Apoptosis is mainly divided into intrinsic pathway (Bcl-2 family/caspase-9/XIAP/caspase-3, or capsase-7/PARP-1 cascade) and extrinsic pathway (FAS/caspase-8XIAP//caspase-3 or capsase-7 cascade) [
17,
18]. Induction of tumor cell apoptosis is beneficial for the development of anti-cancer agents. The results of cell viability assay and immunoblot analysis as well as histone-complexed DNA fragments detection data revealed that MSSV treatment decreased the expression of Bcl-2 and XIAP in bladder cancer cells. Treatment of cells with MSSV caused an increase in Bax and Fas. Moreover, MSSV induced the activation of both initiator caspases (caspase-8 and -9) and effector caspases (caspase-6 and -7) as well as the proteolytic degradation of PARP. However, it is noteworthy that caspase-3 activation remained unaffected by MSSV treatment. The present data demonstrate the involvement of both intrinsic and extrinsic caspase pathways of apoptosis, which were associated with PARP-1 cleavage, Bax, and Fas induction, and Bcl-2 and XIAP suppression in a MSSV-treated bladder cancer cells.
Cumulating studies have demonstrated the involvement of MAPK and AKT signaling in cellular survival signaling [
4,
5,
6]. In contrast, previous studies suggested that the inhibition of cell growth is mediated through the MAPK and AKT signaling pathway [
4,
7,
19,
20]. The results from the present study revealed that MSSV treatment induced the activation of AKT and MAPKs, such as ERK1/2, JNK, and p38MAPK. These results may highlight the critical view that AKT and MAPK signaling pathways are responsible for MSSV-induced inhibition of cell growth signal that counteracts the induction of G1-phase cell cycle arrest and the strong apoptotic effect. These data might suggest that AKT and MAPKs are crucial mediators of cell growth inhibition, G1-phase cell cycle arrest, and cell death signaling in MSSV-treated cells. However, further studies are warranted to understand the detailed mechanism underlying the interaction between the signaling pathway (AKT and MAPKs) and inhibitory cell growth (G1-phase cell cycle arrest and apoptosis) in bladder cancer cells treated with MSSV.
Both migration and invasion are believed to mediate progression and development of tumor cells [
3,
4,
7]. MSSV treatment reduced the migration and invasion of bladder cancer cells. Matrix metalloproteinases (MMPs) are one of the main factors that cause the degradation of the surrounding extracellular matrix, which in turn activates the metastatic potential of cancer cells, including migration and invasion, through the basement membrane [
3,
4]. MMP-9 has been considered as a well-known proteolytic enzyme that plays a critical role in inducing migration and invasion of bladder cancer cells [
3,
4,
7]. Additionally, transcription factors, including NF-κB, AP-1, and Sp-1, have been closely linked with MMP-9 expression in tumor cells [
3,
7]. The present results provide evidence that MSSV could impair MMP-9 expression by decreasing the binding activities of AP-1 and Sp-1 motifs, and thereby weakening the migration and invasion capabilities of bladder cancer cells.
Tumor growth warrants the formation of new vessels through angiogenesis [
8,
21]. VEGF is one of the most important angiogenic factors involved in the process of angiogenesis [
22]. VEGF-induced tube formation, proliferation, migration, and invasion of endothelial cells are considered as pivotal mechanisms of angiogenesis [
22,
23,
24,
25]. eNOS, ERK1/2, and AKT signaling pathways are key events to regulate the endothelial cells in response to VEGF during angiogenesis [
23,
24,
25]. Because angiogenesis is an important phenomenon for tumor growth, it is considered a suitable target in anti-tumor drug development strategies; we hypothesized that MSSV also demonstrates anti-angiogenic effects via suppression of VEGF-induced angiogenic responses. Here, we found that proliferation, migration, invasion, and tube formation are inhibited in VEGF-treated HUVECs. MSSV blocked the phosphorylation of eNOS, ERK1/2, and AKT induced by VEGF in HUVECs. Moreover, we observed the strong blockage of VEGF-induced neovessel formation by performing ex vivo aortic ring and in vivo Matrigel plug assays, which suggested that MSSV is a potent anti-tumor-associated angiogenic molecule.
Tumor-associated angiogenesis contributes to the growth, development, and establishment of solid tumors [
8,
21,
22]. To further understand the anti-tumor effects of MSSV, we developed a xenograft mice model implanted with human bladder cancer 5637 cells. Oral administration of MSSV significantly suppressed the bladder tumor growth without altering body weight. The anti-tumor efficacy of MSSV (5 mg/kg) was similar to that of cisplatin drug (5 mg/kg). Particularly, 50% of the xenografted mice treated with cisplatin (5 mg/kg) died within 2 weeks. However, the xenografted mice that received oral administration of MSSV (15 mg/kg) remained alive for 2 weeks. These results led us to investigate whether a single oral dose of MSSV (2000 mg/kg) administered to mice over 14 days could be toxic. The present results of acute oral toxicity test show no signs of weight change and adverse clinical symptoms as well as no cases of animal death for both male and female mice. We subsequently investigated the biochemical levels of AST and ALT in serum, which are considered as suitable indicators of liver function; as expected, these biochemical tests along with histopathological analysis of liver tissue sections demonstrated that the oral administration of MSSV at 2000 mg/kg for 14 days did not cause any hepatic injury. Toxicity evaluation is one of the most essential steps for the development of an anti-tumor drug. Despite the identification of several cyclic depsipeptides including sansalvamide,
N-methylsansalvamide, and their analogue [
10,
11,
12,
13,
14], its safety level has never been addressed to date. As mentioned above, MSSV isolated from
Fusarium spp. showed no evidence of acute toxic effects. These findings will help strategize the design and development of safer anti-cancer drugs having a strong pharmacologic activity. Further studies are required to clarify the cytotoxic effects on other tissues, such as the kidneys, testicles, heart, lungs, brain, and spleen.