Imaging-Based Screening of Deubiquitinating Proteases Identifies Otubain-1 as a Stabilizer of c-MYC
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cloning of pLVX-Puro/ZsGreen1-c-MYC
2.2. Cloning of the Deubiquitinase Library
2.3. Tissue Culture
2.4. Generation of Transduced Cell Lines
2.5. Proteasome Inhibitions
2.6. Chase Experiments
2.7. Transient Transfections
- − V2LHS_155121 (#21): CTGAAGATGACAACATCTA
- − V3LHS_344822 (#22): GGACACTACGATATCCTCT
- − V3LHS_638581 (#81): AGCGACTCCGAAGGTGTTA
- − V3LHS_638586 (#86): AAGGAGTTGCAGCGGTTCA
2.8. Flow Cytometry
2.9. Microscopy
2.10. Protein Extraction
2.11. Western Blotting
2.12. RNA Quantification
- − F_GAPDH: GGAGCGAGATCCCTCCAAAAT
- − R_GAPDH: GGCTGTTGTCATACTTCTCATGG
- − F_MYC: GTCAAGAGGCGAACACACAAC
- − R_MYC: TTGGACGGACAGGATGTATGC
- − F_TP53: CAGCACATGACGGAGGTTGT
- − R_TP53: TCATCCAAATACTCCACACGC
- − F_BAX: CCCGAGAGGTCTTTTTCCGAG
- − R_BAX: CCAGCCCATGATGGTTCTGAT
- − F_CCND2: ACCTTCCGCAGTGCTCCTA
- − R_CCND2: CCCAGCCAAGAAACGGTCC
- − F_CCNE1: AAGGAGCGGGACACCATGA
- − R_CCNE1: ACGGTCACGTTTGCCTTCC
- − F_NPM1: GGAGGTGGTAGCAAGGTTCC
- − R_NPM1: TTCACTGGCGCTTTTTCTTCA
- − F_LDHA: TTGACCTACGTGGCTTGGAAG
- − R_LDHA: GGTAACGGAATCGGGCTGAAT
- − F_ACTB: CATGTACGTTGCTATCCAGGC
- − R_ACTB: CTCCTTAATGTCACGCACGAT
2.13. Primary Multiple Myeloma Analysis
2.14. Statistical Validation
3. Results
3.1. Screen for Deubiquitinases Acting on c-MYC
3.2. Otubain-1 Stabilizes c-MYC Protein Levels
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rock, K.L.; Gramm, C.; Rothstein, L.; Clark, K.; Stein, R.; Dick, L.; Hwang, D.; Goldberg, A.L. Inhibitors of the proteasome block the degradation of most cell proteins and the generation of peptides presented on MHC class I molecules. Cell 1994, 78, 761–771. [Google Scholar] [CrossRef]
- Samant, R.S.; Livingston, C.M.; Sontag, E.M.; Frydman, J. Distinct proteostasis circuits cooperate in nuclear and cytoplasmic protein quality control. Nature 2018, 563, 407–411. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Bengtson, M.H.; Ulbrich, A.; Matsuda, A.; Reddy, V.A.; Orth, A.; Chanda, S.K.; Batalov, S.; Joazeiro, C.A. Genome-wide and functional annotation of human E3 ubiquitin ligases identifies MULAN, a mitochondrial E3 that regulates the organelle’s dynamics and signaling. PLoS ONE 2008, 3, e1487. [Google Scholar] [CrossRef] [PubMed]
- Kliza, K.; Husnjak, K. Resolving the Complexity of Ubiquitin Networks. Front. Mol. Biosci. 2020, 7, 21. [Google Scholar] [CrossRef] [PubMed]
- Love, K.R.; Catic, A.; Schlieker, C.; Ploegh, H.L. Mechanisms, biology and inhibitors of deubiquitinating enzymes. Nat. Chem. Biol. 2007, 3, 697–705. [Google Scholar] [CrossRef] [PubMed]
- Mevissen, T.E.T.; Komander, D. Mechanisms of Deubiquitinase Specificity and Regulation. Annu. Rev. Biochem. 2017, 86, 159–192. [Google Scholar] [CrossRef]
- Fang, Y.; Shen, X. Ubiquitin carboxyl-terminal hydrolases: Involvement in cancer progression and clinical implications. Cancer Metastasis Rev. 2017, 36, 669–682. [Google Scholar] [CrossRef]
- Young, M.J.; Hsu, K.C.; Lin, T.E.; Chang, W.C.; Hung, J.J. The role of ubiquitin-specific peptidases in cancer progression. J. Biomed. Sci. 2019, 26, 42. [Google Scholar] [CrossRef]
- Zhu, Q.; Fu, Y.; Li, L.; Liu, C.H.; Zhang, L. The functions and regulation of Otubains in protein homeostasis and diseases. Ageing Res. Rev. 2021, 67, 101303. [Google Scholar] [CrossRef]
- Maneix, L.; Catic, A. Touch and go: Nuclear proteolysis in the regulation of metabolic genes and cancer. FEBS Lett. 2016, 590, 908–923. [Google Scholar] [CrossRef]
- Geng, F.; Wenzel, S.; Tansey, W.P. Ubiquitin and proteasomes in transcription. Annu. Rev. Biochem. 2012, 81, 177–201. [Google Scholar] [CrossRef] [PubMed]
- Catic, A.; Suh, C.Y.; Hill, C.T.; Daheron, L.; Henkel, T.; Orford, K.W.; Dombkowski, D.M.; Liu, T.; Liu, X.S.; Scadden, D.T. Genome-wide map of nuclear protein degradation shows NCoR1 turnover as a key to mitochondrial gene regulation. Cell 2013, 155, 1380–1395. [Google Scholar] [CrossRef] [PubMed]
- Salghetti, S.E.; Muratani, M.; Wijnen, H.; Futcher, B.; Tansey, W.P. Functional overlap of sequences that activate transcription and signal ubiquitin-mediated proteolysis. Proc. Natl. Acad. Sci. USA 2000, 97, 3118–3123. [Google Scholar] [CrossRef] [PubMed]
- Lipford, J.R.; Deshaies, R.J. Diverse roles for ubiquitin-dependent proteolysis in transcriptional activation. Nat. Cell Biol. 2003, 5, 845–850. [Google Scholar] [CrossRef]
- O’Malley, B.W. The “fourth dimension” of gene transcription. Mol. Endocrinol. 2009, 23, 587–589. [Google Scholar] [CrossRef]
- Salghetti, S.E.; Kim, S.Y.; Tansey, W.P. Destruction of Myc by ubiquitin-mediated proteolysis: Cancer-associated and transforming mutations stabilize Myc. EMBO J. 1999, 18, 717–726. [Google Scholar] [CrossRef]
- Adhikary, S.; Marinoni, F.; Hock, A.; Hulleman, E.; Popov, N.; Beier, R.; Bernard, S.; Quarto, M.; Capra, M.; Goettig, S.; et al. The ubiquitin ligase HectH9 regulates transcriptional activation by Myc and is essential for tumor cell proliferation. Cell 2005, 123, 409–421. [Google Scholar] [CrossRef]
- Popov, N.; Wanzel, M.; Madiredjo, M.; Zhang, D.; Beijersbergen, R.; Bernards, R.; Moll, R.; Elledge, S.J.; Eilers, M. The ubiquitin-specific protease USP28 is required for MYC stability. Nat. Cell Biol. 2007, 9, 765–774. [Google Scholar] [CrossRef]
- Popov, N.; Schülein, C.; Jaenicke, L.A.; Eilers, M. Ubiquitylation of the amino terminus of Myc by SCFβ-TrCP antagonizes SCFFbw7-mediated turnover. Nat. Cell Biol. 2010, 12, 973–981. [Google Scholar] [CrossRef]
- Eilers, M.; Eisenman, R.N. Myc’s broad reach. Genes Dev. 2008, 22, 2755–2766. [Google Scholar] [CrossRef]
- Dang, C.V. c-Myc Target Genes Involved in Cell Growth, Apoptosis, and Metabolism. Mol. Cell. Biol. 1999, 19, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Stine, Z.E.; Walton, Z.E.; Altman, B.; Hsieh, A.L.; Dang, C.V. MYC, Metabolism, and Cancer. Cancer Discov. 2015, 5, 1024–1039. [Google Scholar] [CrossRef] [PubMed]
- Kress, T.R.; Sabò, A.; Amati, B. MYC: Connecting selective transcriptional control to global RNA production. Nat. Cancer 2015, 15, 593–607. [Google Scholar] [CrossRef] [PubMed]
- Wolf, E.; Lin, C.Y.; Eilers, M.; Levens, D.L. Taming of the beast: Shaping Myc-dependent amplification. Trends Cell Biol. 2014, 25, 241–248. [Google Scholar] [CrossRef]
- Dang, C.V. MYC on the Path to Cancer. Cell 2012, 149, 22–35. [Google Scholar] [CrossRef]
- Thomas, L.R.; Tansey, W.P. Proteolytic control of the oncoprotein transcription factor Myc. Adv. Cancer Res. 2011, 110, 77–106. [Google Scholar] [CrossRef]
- Hofmann, J.W.; Zhao, X.; De Cecco, M.; Peterson, A.L.; Pagliaroli, L.; Manivannan, J.; Hubbard, G.B.; Ikeno, Y.; Zhang, Y.; Feng, B.; et al. Reduced Expression of MYC Increases Longevity and Enhances Healthspan. Cell 2015, 160, 477–488. [Google Scholar] [CrossRef]
- Farrell, A.S.; Sears, R.C. MYC Degradation. Cold Spring Harb. Perspect. Med. 2014, 4, a014365. [Google Scholar] [CrossRef]
- Chen, Y.; Sun, X.-X.; Sears, R.C.; Dai, M.-S. Writing and erasing MYC ubiquitination and SUMOylation. Genes Dis. 2019, 6, 359–371. [Google Scholar] [CrossRef]
- D’Arcy, P.; Linder, S. Proteasome deubiquitinases as novel targets for cancer therapy. Int. J. Biochem. Cell Biol. 2012, 44, 1729–1738. [Google Scholar] [CrossRef]
- Harrigan, J.A.; Jacq, X.; Martin, N.M.; Jackson, S.P. Deubiquitylating enzymes and drug discovery: Emerging opportunities. Nat. Rev. Drug Discov. 2017, 17, 57–78. [Google Scholar] [CrossRef] [PubMed]
- Diefenbacher, M.E.; Popov, N.; Blake, S.M.; Schülein-Völk, C.; Nye, E.; Spencer-Dene, B.; Jaenicke, L.A.; Eilers, M.; Behrens, A. The deubiquitinase USP28 controls intestinal homeostasis and promotes colorectal cancer. J. Clin. Investig. 2014, 124, 3407–3418. [Google Scholar] [CrossRef] [PubMed]
- Fang, X.; Zhou, W.; Wu, Q.; Huang, Z.; Shi, Y.; Yang, K.; Chen, C.; Xie, Q.; Mack, S.C.; Wang, X.; et al. Deubiquitinase USP13 maintains glioblastoma stem cells by antagonizing FBXL14-mediated Myc ubiquitination. J. Exp. Med. 2016, 214, 245–267. [Google Scholar] [CrossRef]
- Xu, Z.; Hu, H.; Fang, D.; Wang, J.; Zhao, K. The deubiquitinase USP38 promotes cell proliferation through stabilizing c-Myc. Int. J. Biochem. Cell Biol. 2021, 137, 106023. [Google Scholar] [CrossRef]
- Frenzel, A.; Zirath, H.; Vita, M.; Albihn, A.; Henriksson, M.A. Identification of Cytotoxic Drugs That Selectively Target Tumor Cells with MYC Overexpression. PLoS ONE 2011, 6, e27988. [Google Scholar] [CrossRef] [PubMed]
- Maneix, L.; Sweeney, M.; Lee, S.; Iakova, P.; Moree, S.; Sahin, E.; Lulla, P.; Yellapragada, S.; Tsai, F.; Catic, A. The Mitochondrial Protease LonP1 Promotes Proteasome Inhibitor Resistance in Multiple Myeloma. Cancers 2021, 13, 843. [Google Scholar] [CrossRef] [PubMed]
- Pasupala, N.; Morrow, M.E.; Que, L.T.; Malynn, B.A.; Ma, A.; Wolberger, C. OTUB1 non-catalytically stabilizes the E2 ubiquitin-conjugating enzyme UBE2E1 by preventing its autoubiquitination. J. Biol. Chem. 2018, 293, 18285. [Google Scholar] [CrossRef] [PubMed]
- Manders, E.M.M.; Verbeek, F.J.; Aten, J.A. Measurement of co-localization of objects in dual-colour confocal images. J. Microsc. 1993, 169, 375–382. [Google Scholar] [CrossRef]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Richardson, P.G.; Sonneveld, P.; Schuster, M.W.; Irwin, D.; Stadtmauer, E.A.; Facon, T.; Harousseau, J.-L.; Ben-Yehuda, D.; Lonial, S.; Goldschmidt, H.; et al. Bortezomib or high-dose dexamethasone for relapsed multiple myeloma. N. Engl. J. Med. 2005, 352, 2487–2498. [Google Scholar] [CrossRef] [PubMed]
- Blake, D.R.; Vaseva, A.V.; Hodge, R.G.; Kline, M.P.; Gilbert, T.S.K.; Tyagi, V.; Huang, D.; Whiten, G.C.; Larson, J.E.; Wang, X.; et al. Application of a MYC degradation screen identifies sensitivity to CDK9 inhibitors in KRAS-mutant pancreatic cancer. Sci. Signal. 2019, 12, eaav7259. [Google Scholar] [CrossRef] [PubMed]
- Huang, C.-Y.; Bredemeyer, A.L.; Walker, L.M.; Bassing, C.H.; Sleckman, B.P. Dynamic regulation ofc-Myc proto-oncogene expression during lymphocyte development revealed by aGFP-c-Myc knock-in mouse. Eur. J. Immunol. 2008, 38, 342–349. [Google Scholar] [CrossRef] [PubMed]
- Welcker, M.; Orian, A.; Jin, J.; Grim, J.A.; Harper, J.; Eisenman, R.N.; Clurman, B.E. The Fbw7 tumor suppressor regulates glycogen synthase kinase 3 phosphorylation-dependent c-Myc protein degradation. Proc. Natl. Acad. Sci. USA 2004, 101, 9085–9090. [Google Scholar] [CrossRef]
- Yada, M.; Hatakeyama, S.; Kamura, T.; Nishiyama, M.; Tsunematsu, R.; Imaki, H.; Ishida, N.; Okumura, F.; Nakayama, K.; I Nakayama, K. Phosphorylation-dependent degradation of c-Myc is mediated by the F-box protein Fbw7. EMBO J. 2004, 23, 2116–2125. [Google Scholar] [CrossRef]
- Welcker, M.; Orian, A.; Grim, J.A.; Eisenman, R.N.; Clurman, B.E. A Nucleolar Isoform of the Fbw7 Ubiquitin Ligase Regulates c-Myc and Cell Size. Curr. Biol. 2004, 14, 1852–1857. [Google Scholar] [CrossRef]
- Sweeney, M.A.; Iakova, P.; Maneix, L.; Shih, F.-Y.; Cho, H.E.; Sahin, E.; Catic, A. The ubiquitin ligase Cullin-1 associates with chromatin and regulates transcription of specific c-MYC target genes. Sci. Rep. 2020, 10, 13942. [Google Scholar] [CrossRef]
- Nelson, W.G.; De Marzo, A.M.; Yegnasubramanian, S. USP2a Activation of MYC in Prostate Cancer. Cancer Discov. 2012, 2, 206–207. [Google Scholar] [CrossRef][Green Version]
- Sun, X.-X.; He, X.; Yin, L.; Komada, M.; Sears, R.C.; Dai, M.-S. The nucleolar ubiquitin-specific protease USP36 deubiquitinates and stabilizes c-Myc. Proc. Natl. Acad. Sci. USA 2015, 112, 3734–3739. [Google Scholar] [CrossRef]
- Borodovsky, A.; Ovaa, H.; Kolli, N.; Gan-Erdene, T.; Wilkinson, K.D.; Ploegh, H.L.; Kessler, B. Chemistry-Based Functional Proteomics Reveals Novel Members of the Deubiquitinating Enzyme Family. Chem. Biol. 2002, 9, 1149–1159. [Google Scholar] [CrossRef]
- Saldana, M.; Vandervorst, K.; Berg, A.L.; Lee, H.; Carraway, K.L. Otubain 1: A non-canonical deubiquitinase with an emerging role in cancer. Endocr.-Relat. Cancer 2019, 26, R1–R14. [Google Scholar] [CrossRef] [PubMed]
- Clague, M.J.; Heride, C.; Urbe, S. The demographics of the ubiquitin system. Trends Cell Biol. 2015, 25, 417–426. [Google Scholar] [CrossRef] [PubMed]
- Herhaus, L.; Perez-Oliva, A.B.; Cozza, G.; Gourlay, R.; Weidlich, S.; Campbell, D.G.; Pinna, L.A.; Sapkota, G.P. Casein kinase 2 (CK2) phosphorylates the deubiquitylase OTUB1 at Ser 16 to trigger its nuclear localization. Sci. Signal. 2015, 8, ra35. [Google Scholar] [CrossRef] [PubMed]
- Shou, Y.; Martelli, M.L.; Gabrea, A.; Qi, Y.; Brents, L.A.; Roschke, A.; Dewald, G.; Kirsch, I.R.; Bergsagel, P.L.; Kuehl, W.M. Diverse karyotypic abnormalities of the c-myc locus associated with c-myc dysregulation and tumor progression in multiple myeloma. Proc. Natl. Acad. Sci. USA 2000, 97, 228–233. [Google Scholar] [CrossRef]
- Giusti, K. Company Profile: Multiple Myeloma Research Foundation. Pers. Med. 2012, 9, 333–336. [Google Scholar] [CrossRef]
- Bhattacharya, S.; Ghosh, M.K. HAUSP regulates c-MYC expression via de-ubiquitination of TRRAP. Cell. Oncol. 2015, 38, 265–277. [Google Scholar] [CrossRef]
- Love, C.; Sun, Z.; Jima, D.; Li, G.; Zhang, J.; Miles, R.; Richards, K.L.; Dunphy, C.H.; Choi, W.W.; Srivastava, G.; et al. The genetic landscape of mutations in Burkitt lymphoma. Nat. Genet. 2012, 44, 1321–1325. [Google Scholar] [CrossRef]
- Liu, J.; Levens, D. Making myc. In The Myc/Max/Mad Transcription Factor Network. Current Topics in Microbiology and Immunology; Springer: Berlin, Germany, 2006; Volume 302, pp. 1–32. [Google Scholar] [CrossRef] [PubMed]
- Wierstra, I.; Alves, J. The c-myc promoter: Still mystery and challenge. Adv. Cancer. Res. 2008, 99, 113–333. [Google Scholar] [CrossRef] [PubMed]
- Levens, D. Cellular MYCro economics: Balancing MYC function with MYC expression. Cold Spring Harb. Perspect. Med. 2013, 3, a014233. [Google Scholar] [CrossRef]
- He, M.; Zhou, Z.; Shah, A.A.; Zou, H.; Tao, J.; Chen, Q.; Wan, Y. The emerging role of deubiquitinating enzymes in genomic integrity, diseases, and therapeutics. Cell Biosci. 2016, 6, 62. [Google Scholar] [CrossRef]
- Sun, X.X.; Li, Y.; Sears, R.C.; Dai, M.S. Targeting the MYC Ubiquitination-Proteasome Degradation Pathway for Cancer Therapy. Front. Oncol. 2021, 11, 679445. [Google Scholar] [CrossRef]
- Xu, Y.; Xu, M.; Tong, J.; Tang, X.; Chen, J.; Chen, X.; Zhang, Z.; Cao, B.; Stewart, A.K.; Moran, M.F.; et al. Targeting the Otub1/c-Maf axis for the treatment of multiple myeloma. Blood 2021, 137, 1478–1490. [Google Scholar] [CrossRef] [PubMed]
- Altun, M.; Walter, T.S.; Kramer, H.B.; Herr, P.; Iphöfer, A.; Boström, J.; David, Y.; Komsany, A.; Ternette, N.; Navon, A.; et al. The Human Otubain2-Ubiquitin Structure Provides Insights into the Cleavage Specificity of Poly-Ubiquitin-Linkages. PLoS ONE 2015, 10, e0115344. [Google Scholar] [CrossRef] [PubMed]
- Juang, Y.-C.; Landry, M.-C.; Sanches, M.; Vittal, V.; Leung, C.C.; Ceccarelli, D.; Mateo, A.-R.F.; Pruneda, J.; Mao, D.Y.; Szilard, R.K.; et al. OTUB1 Co-opts Lys48-Linked Ubiquitin Recognition to Suppress E2 Enzyme Function. Mol. Cell 2012, 45, 384–397. [Google Scholar] [CrossRef] [PubMed]
- Wiener, R.; Dibello, A.T.; Lombardi, P.M.; Guzzo, C.M.; Zhang, X.; Matunis, M.; Wolberger, C. E2 ubiquitin-conjugating enzymes regulate the deubiquitinating activity of OTUB1. Nat. Struct. Mol. Biol. 2013, 20, 1033–1039. [Google Scholar] [CrossRef]
- Van Nieuwenhuijzen, N.; Spaan, I.; Raymakers, R.; Peperzak, V. From MGUS to Multiple Myeloma, a Paradigm for Clonal Evolution of Premalignant Cells. Cancer Res. 2018, 78, 2449–2456. [Google Scholar] [CrossRef]
- Borodovsky, A.; Ovaa, H.; Meester, W.J.N.; Venanzi, E.S.; Bogyo, M.S.; Hekking, B.G.; Ploegh, H.L.; Kessler, B.M.; Overkleeft, H.S. Small-Molecule Inhibitors and Probes for Ubiquitin- and Ubiquitin-Like-Specific Proteases. ChemBioChem 2005, 6, 287–291. [Google Scholar] [CrossRef]
- Hussain, S.; Zhang, Y.; Galardy, P.J. DUBs and cancer: The role of deubiquitinating enzymes as oncogenes, non-oncogenes and tumor suppressors. Cell Cycle 2009, 8, 1688–1697. [Google Scholar] [CrossRef]







Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Moree, S.E.; Maneix, L.; Iakova, P.; Stossi, F.; Sahin, E.; Catic, A. Imaging-Based Screening of Deubiquitinating Proteases Identifies Otubain-1 as a Stabilizer of c-MYC. Cancers 2022, 14, 806. https://doi.org/10.3390/cancers14030806
Moree SE, Maneix L, Iakova P, Stossi F, Sahin E, Catic A. Imaging-Based Screening of Deubiquitinating Proteases Identifies Otubain-1 as a Stabilizer of c-MYC. Cancers. 2022; 14(3):806. https://doi.org/10.3390/cancers14030806
Chicago/Turabian StyleMoree, Shannon E., Laure Maneix, Polina Iakova, Fabio Stossi, Ergun Sahin, and Andre Catic. 2022. "Imaging-Based Screening of Deubiquitinating Proteases Identifies Otubain-1 as a Stabilizer of c-MYC" Cancers 14, no. 3: 806. https://doi.org/10.3390/cancers14030806
APA StyleMoree, S. E., Maneix, L., Iakova, P., Stossi, F., Sahin, E., & Catic, A. (2022). Imaging-Based Screening of Deubiquitinating Proteases Identifies Otubain-1 as a Stabilizer of c-MYC. Cancers, 14(3), 806. https://doi.org/10.3390/cancers14030806

