Occurrence of Total and Proteinase K-Resistant Alpha-Synuclein in Glioblastoma Cells Depends on mTOR Activity
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Cultures
2.2. Cell Treatments
2.3. Proteinase K Treatment
2.4. Silencing RNA Transfection
- (i)
- For the Western blot, cells were seeded onto 6-well plates, 1 × 106 cells per well;
- (ii)
- For light microscopy, cells were seeded onto 24-well plates, 2 × 105 cells per well.
2.5. Trypan Blue Assay
2.6. Hematoxylin and Eosin (H&E) Staining
2.7. Hoechst Staining
2.8. Immuno-Cytochemistry under Light Microscopy
2.8.1. Immuno-Fluorescence
2.8.2. Immuno-Peroxidase
2.9. Densitometry Analysis under Light Microscopy
2.10. SDS-PAGE Immunoblotting
2.11. RNA Extraction for qRT-PCR
2.12. qRT-PCR
- Alpha-synuclein, SNCA (NM_007308.2)5′–AGGAGTGGTTCATGGAGTG–3′, 5′–AAGCCAGTGGCAGCAGCT–3′;
- Beta-synuclein, SNCB (NM_003085)5′–ATCTGGGAGGAGCTGTGTTC–3′, 5′–CTCTGGCTCATACTCCTGAT–3′;
- Gamma-synuclein, SNCG (NM_003087)5′–ACCAAGCAGGGGGTGACGGA– 3′, 5′–GGTGACCGCGATGTTCTCC–3′;
- β-Actin (NM_001101.3)5′–GTGCGTGACATTAAGGAG–3′, 5′–GCCAGACAGCACTGTGT–3′;
- β-Globin (NM_000518.4)5′–CTAAGGTGAAGGCTCATG–3′, 5′–GATAGGCAGCCTGCACT–3′.
2.13. Transmission Electron Microscopy
2.14. Post-Embedding Immuno-Cytochemistry
2.15. Ultrastructural Morphometry
2.16. Specificity of Anti-α-Syn Primary Antibodies (Specificity of α-Syn Detection in the Study)
2.17. Statistical Analysis
3. Results
3.1. α-Syn Is Abundant in U87MG Cells
3.2. α-Syn Amount and Compartmentalization, Measured by Ultrastructural Stoichiometry
3.3. In U87MG Cells Compared with Astrocytes, Gene Expression of α-Syn Occurs in Excess Compared with β-Syn and γ-Syn
3.4. Rapamycin Reduces α-Syn Immunostaining Dose-Dependently
3.5. Total and PK-Resistant Immunostaining for α-Syn Is Suppressed by Rapamycin
3.6. Rapamycin Suppresses Both Total and PK-Resistant α-Syn with Immunoblotting
3.7. Silencing α-Syn Expression Does Not Alter Cell Viability While Producing Phenotypic Changes
3.8. Ultrastructural Stoichiometry Quantifies Rapamycin-Induced α-Syn Decrease and Compartmentalization
3.9. Ultrastructural Stoichiometry Quantifies Rapamycin-Dependent Decrease in PK-Resistant α-Syn and α-Syn Compartmentalization
3.10. α-Syn Gene Expression Is Reduced by Rapamycin in U87MG Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Polymeropoulos, M.H.; Lavedan, C.; Leroy, E.; Ide, S.E.; Dehejia, A.; Dutra, A.; Pike, B.; Root, H.; Rubenstein, J.; Boyer, R.; et al. Mutation in the alpha-synuclein gene identified in families with Parkinson’s disease. Science 1997, 276, 2045–2047. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Singleton, A.B.; Farrer, M.; Johnson, J.; Singleton, A.; Hague, S.; Kachergus, J.; Hulihan, M.; Peuralinna, T.; Dutra, A.; Nussbaum, R.; et al. Alpha-synuclein locus triplication causes Parkinson’s disease. Science 2003, 302, 841. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vekrellis, K.; Xilouri, M.; Emmanouilidou, E.; Rideout, H.J.; Stefanis, L. Pathological roles of α-synuclein in neurological disorders. Lancet Neurol. 2011, 10, 1015–1025. [Google Scholar] [CrossRef]
- Stoica, G.; Lungu, G.; Bjorklund, N.L.; Taglialatela, G.; Zhang, X.; Chiu, V.; Hill, H.H.; Schenk, J.O.; Murray, I. Potential role of α-synuclein in neurodegeneration: Studies in a rat animal model. J. Neurochem. 2012, 122, 812–822. [Google Scholar] [CrossRef] [PubMed]
- Doherty, K.M.; Silveira-Moriyama, L.; Parkkinen, L.; Healy, D.G.; Farrell, M.; Mencacci, N.E.; Ahmed, Z.; Brett, F.M.; Hardy, J.; Quinn, N.; et al. Parkin disease: A clinicopathologic entity? JAMA Neurol. 2013, 70, 571–579. [Google Scholar] [CrossRef] [Green Version]
- Barker, R.A.; Williams-Gray, C.H. Review: The spectrum of clinical features seen with alpha synuclein pathology. Neuropathol. Appl. Neurobiol. 2016, 42, 6–19. [Google Scholar] [CrossRef] [Green Version]
- Kovacs, G.G. Molecular Pathological Classification of Neurodegenerative Diseases: Turning towards Precision Medicine. Int. J. Mol. Sci. 2016, 17, 189. [Google Scholar] [CrossRef]
- Martí, M.J.; Tolosa, E.; Campdelacreu, J. Clinical overview of the synucleinopathies. Mov. Disord. 2003, 18, S21–S27. [Google Scholar] [CrossRef]
- Unal-Cevik, I.; Gursoy-Ozdemir, Y.; Yemisci, M.; Lule, S.; Gurer, G.; Can, A.; Müller, V.; Kahle, P.J.; Dalkara, T. Alpha-synuclein aggregation induced by brief ischemia negatively impacts neuronal survival in vivo: A study in [A30P]alpha-synuclein transgenic mouse. J. Cereb. Blood Flow Metab. 2011, 31, 913–923. [Google Scholar] [CrossRef] [Green Version]
- McCann, H.; Stevens, C.H.; Cartwright, H.; Halliday, G.M. α-Synucleinopathy phenotypes. Parkinsonism Relat. Disord. 2014, 20, S62–S67. [Google Scholar] [CrossRef] [Green Version]
- Sato, K.; Yamashita, T.; Kurata, T.; Lukic, V.; Fukui, Y.; Hishikawa, N.; Deguchi, K.; Abe, K. Telmisartan reduces progressive oxidative stress and phosphorylated α-synuclein accumulation in stroke-resistant spontaneously hypertensive rats after transient middle cerebral artery occlusion. J. Stroke Cerebrovasc. Dis. 2014, 23, 1554–1563. [Google Scholar] [CrossRef] [PubMed]
- Kim, T.; Mehta, S.L.; Kaimal, B.; Lyons, K.; Dempsey, R.J.; Vemuganti, R. Poststroke Induction of α-Synuclein Mediates Ischemic Brain Damage. J. Neurosci. 2016, 36, 7055–7065. [Google Scholar] [CrossRef] [PubMed]
- Ryskalin, L.; Busceti, C.L.; Limanaqi, F.; Biagioni, F.; Gambardella, S.; Fornai, F. A Focus on the Beneficial Effects of Alpha Synuclein and a Re-Appraisal of Synucleinopathies. Curr. Protein Pept. Sci. 2018, 19, 598–611. [Google Scholar] [CrossRef] [PubMed]
- Webb, J.L.; Ravikumar, B.; Atkins, J.; Skepper, J.N.; Rubinsztein, D.C. Alpha-Synuclein is degraded by both autophagy and the proteasome. J. Biol. Chem. 2003, 278, 25009–25013. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiang, H.; White, E.J.; Conrad, C.; Gomez-Manzano, C.; Fueyo, J. Autophagy pathways in glioblastoma. Methods Enzymol. 2009, 453, 273–286. [Google Scholar]
- Zhao, Y.; Huang, Q.; Yang, J.; Lou, M.; Wang, A.; Dong, J.; Qin, Z.; Zhang, T. Autophagy impairment inhibits differentiation of glioma stem/progenitor cells. Brain Res. 2010, 1313, 250–258. [Google Scholar] [CrossRef]
- Zhuang, W.; Li, B.; Long, L.; Chen, L.; Huang, Q.; Liang, Z. Induction of autophagy promotes differentiation of glioma-initiating cells and their radiosensitivity. Int. J. Cancer 2011, 129, 2720–2731. [Google Scholar] [CrossRef]
- Ryskalin, L.; Limanaqi, F.; Biagioni, F.; Frati, A.; Esposito, V.; Calierno, M.T.; Lenzi, P.; Fornai, F. The emerging role of m-TOR up-regulation in brain Astrocytoma. Histol. Histopathol. 2017, 32, 413–431. [Google Scholar] [CrossRef]
- Chakravarti, A.; Zhai, G.; Suzuki, Y.; Sarkesh, S.; Black, P.M.; Muzikansky, A.; Loeffler, J.S. The prognostic significance of phosphatidylinositol 3-kinase pathway activation in human gliomas. J. Clin. Oncol. 2004, 22, 1926–1933. [Google Scholar] [CrossRef] [Green Version]
- Sunayama, J.; Sato, A.; Matsuda, K.; Tachibana, K.; Suzuki, K.; Narita, Y.; Shibui, S.; Sakurada, K.; Kayama, T.; Tomiyama, A.; et al. Dual blocking of mTor and PI3K elicits a prodifferentiation effect on glioblastoma stem-like cells. Neuro Oncol. 2010, 12, 1205–1219. [Google Scholar] [CrossRef] [Green Version]
- Jhanwar-Uniyal, M.; Jeevan, D.; Neil, J.; Shannon, C.; Albert, L.; Murali, R. Deconstructing mTOR complexes in regulation of glioblastoma multiforme and its stem cells. Adv. Biol. Regul. 2013, 53, 202–210. [Google Scholar] [CrossRef] [PubMed]
- Ryskalin, L.; Gaglione, A.; Limanaqi, F.; Biagioni, F.; Familiari, P.; Frati, A.; Esposito, V.; Fornai, F. The Autophagy Status of Cancer Stem Cells in Gliobastoma Multiforme: From Cancer Promotion to Therapeutic Strategies. Int. J. Mol. Sci. 2019, 20, 3824. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ferrucci, M.; Biagioni, F.; Lenzi, P.; Gambardella, S.; Ferese, R.; Calierno, M.T.; Falleni, A.; Grimaldi, A.; Frati, A.; Esposito, V.; et al. Rapamycin promotes differentiation increasing βIII-tubulin, NeuN, and NeuroD while suppressing nestin expression in glioblastoma cells. Oncotarget 2017, 8, 29574–29599. [Google Scholar] [CrossRef] [Green Version]
- Ferese, R.; Lenzi, P.; Fulceri, F.; Biagioni, F.; Fabrizi, C.; Gambardella, S.; Familiari, P.; Frati, A.; Limanaqi, F.; Fornai, F. Quantitative Ultrastructural Morphometry and Gene Expression of mTOR-Related Mitochondriogenesis within Glioblastoma Cells. Int. J. Mol. Sci. 2020, 21, 4570. [Google Scholar] [CrossRef] [PubMed]
- Lenzi, P.; Ferese, R.; Biagioni, F.; Fulceri, F.; Busceti, C.L.; Falleni, A.; Gambardella, S.; Frati, A.; Fornai, F. Rapamycin Ameliorates Defects in Mitochondrial Fission and Mitophagy in Glioblastoma Cells. Int. J. Mol. Sci. 2021, 22, 5379. [Google Scholar] [CrossRef]
- Supko, J.G.; Malspeis, L. Dose-dependent pharmacokinetics of rapamycin-28-N,N-dimethylglycinate in the mouse. Cancer Chemother. Pharmacol. 1994, 33, 325–330. [Google Scholar] [CrossRef]
- Kirchner, G.I.; Meier-Wiedenbach, I.; Manns, M.P. Clinical pharmacokinetics of everolimus. Clin. Pharmacokinet. 2004, 43, 83–95. [Google Scholar] [CrossRef]
- Haritani, M.; Spencer, Y.I.; Wells, G.A. Hydrated autoclave pretreatment enhancement of prion protein immunoreactivity in formalin-fixed bovine spongiform encephalopathy-affected brain. Acta Neuropathol. 1994, 87, 86–90. [Google Scholar] [CrossRef]
- Van Everbroeck, B.; Pals, P.; Martin, J.J.; Cras, P. Antigen retrieval in prion protein immunohistochemistry. J. Histochem. Cytochem. 1999, 47, 1465–1470. [Google Scholar] [CrossRef]
- Debeer, S.O.; Baron, T.G.; Bencsik, A.A. Immunohistochemistry of PrPsc within bovine spongiform encephalopathy brain samples with graded autolysis. J. Histochem. Cytochem. 2001, 49, 1519–1524. [Google Scholar] [CrossRef] [Green Version]
- Kovács, G.G.; Head, M.W.; Hegyi, I.; Bunn, T.J.; Flicker, H.; Hainfellner, J.A.; McCardle, L.; László, L.; Jarius, C.; Ironside, J.W.; et al. Immunohistochemistry for the prion protein: Comparison of different monoclonal antibodies in human prion disease subtypes. Brain Pathol. 2002, 12, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Rosicarelli, B.; Serafini, B.; Sbriccoli, M.; Lu, M.; Cardone, F.; Pocchiari, M.; Aloisi, F. Migration of dendritic cells into the brain in a mouse model of prion disease. J. Neuroimmunol. 2005, 165, 114–120. [Google Scholar] [CrossRef] [PubMed]
- Schefe, J.H.; Lehmann, K.E.; Buschmann, I.R.; Unger, T.; Funke-Kaiser, H. Quantitative real-time RT-PCR data analysis: Current concepts and the novel “gene expression’s CT difference” formula. J. Mol. Med. 2006, 84, 901–910. [Google Scholar] [CrossRef] [PubMed]
- Lenzi, P.; Lazzeri, G.; Biagioni, F.; Busceti, C.L.; Gambardella, S.; Salvetti, A.; Fornai, F. The Autophagoproteasome a Novel Cell Clearing Organelle in Baseline and Stimulated Conditions. Front. Neuroanat. 2016, 10, 78. [Google Scholar] [CrossRef] [Green Version]
- Bendayan, M.; Zollinger, M. Ultrastructural localization of antigenic sites on osmium-fixed tissues applying the protein A-gold technique. J. Histochem. Cytochem. 1983, 31, 101–109. [Google Scholar] [CrossRef] [Green Version]
- D’Alessandro, D.; Mattii, L.; Moscato, S.; Bernardini, N.; Segnani, C.; Dolfi, A.; Bianchi, F. Immunohistochemical demonstration of the small GTPase RhoAA on epoxy-resin embedded sections. Micron 2004, 35, 287–296. [Google Scholar] [CrossRef]
- Griffiths, G. Fine Structure Immunocytochemistry; Springer: Berlin/Heidelberg, Germany, 1993; pp. 1–459. [Google Scholar]
- Skepper, J.N. Immunocytochemical strategies for electron microscopy: Choice or compromise. J. Microsc. 2000, 199, 1–36. [Google Scholar] [CrossRef] [Green Version]
- Bendayan, M. Worth its weight in gold. Science 2001, 291, 1363–1365. [Google Scholar] [CrossRef]
- Mayhew, T.M.; Lucocq, J.M. Developments in cell biology for quantitative immunoelectron microscopy based on thin sections: A review. Histochem. Cell Biol. 2008, 130, 299–313. [Google Scholar] [CrossRef] [Green Version]
- Lucocq, J.; Habermann, A.; Watt, S.; Backer, J.M.; Mayhew, T.M.; Griffiths, G. A rapid method for assessing the distribution of gold labeling on thin sections. J. Histochem. Cytochem. 2004, 52, 991–1000. [Google Scholar] [CrossRef]
- Fornai, F.; Lenzi, P.; Lazzeri, G.; Ferrucci, M.; Fulceri, F.; Giorgi, F.S.; Falleni, A.; Ruggieri, S.; Paparelli, A. Fine ultrastructure and biochemistry of PC12 cells: A comparative approach to understand neurotoxicity. Brain Res. 2007, 1129, 174–190. [Google Scholar] [CrossRef] [PubMed]
- Lenzi, P.; Marongiu, R.; Falleni, A.; Gelmetti, V.; Busceti, C.L.; Michiorri, S.; Valente, E.M.; Fornai, F. A subcellular analysis of genetic modulation of PINK1 on mitochondrial alterations, autophagy and cell death. Arch. Ital. Biol. 2012, 150, 194–217. [Google Scholar] [PubMed]
- Klionsky, D.J.; Abdel-Aziz, A.K.; Abdelfatah, S.; Abdellatif, M.; Abdoli, A.; Abel, S.; Abeliovich, H.; Abildgaard, M.H.; Abudu, Y.P.; Acevedo-Arozena, A.; et al. Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition). Autophagy 2021, 17, 1–382. [Google Scholar] [PubMed]
- Biagioni, F.; Ferese, R.; Limanaqi, F.; Madonna, M.; Lenzi, P.; Gambardella, S.; Fornai, F. Methamphetamine persistently increases alpha-synuclein and suppresses gene promoter methylation within striatal neurons. Brain Res. 2019, 1719, 157–175. [Google Scholar] [CrossRef] [PubMed]
- Fung, K.M.; Rorke, L.B.; Giasson, B.; Lee, V.M.; Trojanowski, J.Q. Expression of alpha-, beta-, and gamma-synuclein in glial tumors and medulloblastomas. Acta Neuropathol. 2003, 106, 167–175. [Google Scholar] [CrossRef] [PubMed]
- Solano, S.M.; Miller, D.W.; Augood, S.J.; Young, A.B.; Penney, J.B., Jr. Expression of alpha-synuclein, parkin, and ubiquitin carboxy-terminal hydrolase L1 mRNA in human brain: Genes associated with familial Parkinson’s disease. Ann. Neurol. 2000, 47, 201–210. [Google Scholar] [CrossRef]
- Braidy, N.; Gai, W.P.; Xu, Y.H.; Sachdev, P.; Guillemin, G.J.; Jiang, X.M.; Ballard, J.W.; Horan, M.P.; Fang, Z.M.; Chong, B.H.; et al. Uptake and mitochondrial dysfunction of alpha-synuclein in human astrocytes, cortical neurons and fibroblasts. Transl. Neurodegener. 2013, 2, 20. [Google Scholar] [CrossRef] [Green Version]
- Booth, H.D.E.; Hirst, W.D.; Wade-Martins, R. The Role of Astrocyte Dysfunction in Parkinson’s Disease Pathogenesis. Trends Neurosci. 2017, 40, 358–370. [Google Scholar] [CrossRef] [Green Version]
- Tsunemi, T.; Ishiguro, Y.; Yoroisaka, A.; Valdez, C.; Miyamoto, K.; Ishikawa, K.; Saiki, S.; Akamatsu, W.; Hattori, N.; Krainc, D. Astrocytes Protect Human Dopaminergic Neurons from α-Synuclein Accumulation and Propagation. J. Neurosci. 2020, 40, 8618–8628. [Google Scholar] [CrossRef]
- Maroteaux, L.; Scheller, R.H. The rat brain synucleins; family of proteins transiently associated with neuronal membrane. Brain Res. Mol. Brain Res. 1991, 11, 335–343. [Google Scholar] [CrossRef]
- McLean, P.J.; Ribich, S.; Hyman, B.T. Subcellular localization of alpha-synuclein in primary neuronal cultures: Effect of missense mutations. J. Neural. Transm. Suppl. 2000, 58, 53–63. [Google Scholar]
- Mori, F.; Tanji, K.; Yoshimoto, M.; Takahashi, H.; Wakabayashi, K. Immunohistochemical comparison of alpha- and beta-synuclein in adult rat central nervous system. Brain Res. 2002, 941, 118–126. [Google Scholar] [CrossRef]
- Bendor, J.T.; Logan, T.P.; Edwards, R.H. The function of α-synuclein. Neuron 2013, 79, 1044–1066. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Burré, J.; Vivona, S.; Diao, J.; Sharma, M.; Brunger, A.T.; Südhof, T.C. Properties of native brain α-synuclein. Nature 2013, 498, E4–E6; discussion E6–E7. [Google Scholar] [CrossRef]
- Gonçalves, S.; Outeiro, T.F. Assessing the subcellular dynamics of alpha-synuclein using photoactivation microscopy. Mol. Neurobiol. 2013, 47, 1081–1092. [Google Scholar] [CrossRef] [Green Version]
- Ma, K.L.; Song, L.K.; Yuan, Y.H.; Zhang, Y.; Han, N.; Gao, K.; Chen, N.H. The nuclear accumulation of alpha-synuclein is mediated by importin alpha and promotes neurotoxicity by accelerating the cell cycle. Neuropharmacology 2014, 82, 132–142. [Google Scholar] [CrossRef]
- Burré, J.; Sharma, M.; Südhof, T.C. Cell Biology and Pathophysiology of α-Synuclein. Cold Spring Harb. Perspect. Med. 2018, 8, a024091. [Google Scholar] [CrossRef]
- Jiang, K.; Rocha, S.; Westling, A.; Kesarimangalam, S.; Dorfman, K.D.; Wittung-Stafshede, P.; Westerlund, F. Alpha-Synuclein Modulates the Physical Properties of DNA. Chemistry 2018, 24, 15685–15690. [Google Scholar] [CrossRef]
- Pinho, R.; Paiva, I.; Jercic, K.G.; Fonseca-Ornelas, L.; Gerhardt, E.; Fahlbusch, C.; Garcia-Esparcia, P.; Kerimoglu, C.; Pavlou, M.A.S.; Villar-Piqué, A.; et al. Nuclear localization and phosphorylation modulate pathological effects of alpha-synuclein. Hum. Mol. Genet. 2019, 28, 31–50. [Google Scholar] [CrossRef]
- Schaser, A.J.; Osterberg, V.R.; Dent, S.E.; Stackhouse, T.L.; Wakeham, C.M.; Boutros, S.W.; Weston, L.J.; Owen, N.; Weissman, T.A.; Luna, E.; et al. Alpha-synuclein is a DNA binding protein that modulates DNA repair with implications for Lewy body disorders. Sci. Rep. 2019, 9, 10919. [Google Scholar] [CrossRef] [Green Version]
- Arcella, A.; Biagioni, F.; Antonietta Oliva, M.; Bucci, D.; Frati, A.; Esposito, V.; Cantore, G.; Giangaspero, F.; Fornai, F. Rapamycin inhibits the growth of glioblastoma. Brain Res. 2013, 1495, 37–51. [Google Scholar] [CrossRef] [PubMed]
- Gong, H.; Qian, H.; Ertl, R.; Astle, C.M.; Wang, G.G.; Harrison, D.E.; Xu, X. Histone modifications change with age, dietary restriction and rapamycin treatment in mouse brain. Oncotarget 2015, 6, 15882–15890. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Horvath, S.; Zoller, J.A.; Haghani, A.; Lu, A.T.; Raj, K.; Jasinska, A.J.; Mattison, J.A.; Salmon, A.B. DNA methylation age analysis of rapamycin in common marmosets. Geroscience 2021, 43, 2413–2425. [Google Scholar] [CrossRef] [PubMed]
- McGregor, B.A.; Schommer, J.; Guo, K.; Raihan, M.O.; Ghribi, O.; Hur, J.; Porter, J.E. Alpha-Synuclein-induced DNA Methylation and Gene Expression in Microglia. Neuroscience 2021, 468, 186–198. [Google Scholar] [CrossRef]
- Lee, S.S.; Kim, Y.M.; Junn, E.; Lee, G.; Park, K.H.; Tanaka, M.; Ronchetti, R.D.; Quezado, M.M.; Mouradian, M.M. Cell cycle aberrations by alpha-synuclein over-expression and cyclin B immunoreactivity in Lewy bodies. Neurobiol. Aging 2003, 24, 687–696. [Google Scholar] [CrossRef]
- Georgieva, E.R.; Ramlall, T.F.; Borbat, P.P.; Freed, J.H.; Eliezer, D. The lipid-binding domain of wild type and mutant alpha-synuclein: Compactness and interconversion between the broken and extended helix forms. J. Biol. Chem. 2010, 285, 28261–28274. [Google Scholar] [CrossRef] [Green Version]
- Liu, X.; Lee, Y.J.; Liou, L.C.; Ren, Q.; Zhang, Z.; Wang, S.; Witt, S.N. Alpha-synuclein functions in the nucleus to protect against hydroxyurea-induced replication stress in yeast. Hum. Mol. Genet. 2011, 20, 3401–3414. [Google Scholar] [CrossRef] [Green Version]
- Lou, X.; Kim, J.; Hawk, B.J.; Shin, Y.K. α-Synuclein may cross-bridge v-SNARE and acidic phospholipids to facilitate SNARE-dependent vesicle docking. Biochem. J. 2017, 474, 2039–2049. [Google Scholar] [CrossRef] [Green Version]
- Pavlou, M.A.S.; Pinho, R.; Paiva, I.; Outeiro, T.F. The yin and yang of α-synuclein-associated epigenetics in Parkinson’s disease. Brain 2017, 140, 878–886. [Google Scholar] [CrossRef] [Green Version]
- Rodríguez-Losada, N.; de la Rosa, J.; Larriva, M.; Wendelbo, R.; Aguirre, J.A.; Castresana, J.S.; Ballaz, S.J. Overexpression of alpha-synuclein promotes both cell proliferation and cell toxicity in human SH-SY5Y neuroblastoma cells. J. Adv. Res. 2020, 23, 37–45. [Google Scholar] [CrossRef]
- Zhang, X.M.; Anwar, S.; Kim, Y.; Brown, J.; Comte, I.; Cai, H.; Cai, N.N.; Wade-Martins, R.; Szele, F.G. The A30P α-synuclein mutation decreases subventricular zone proliferation. Hum. Mol. Genet. 2019, 28, 2283–2294. [Google Scholar] [CrossRef] [PubMed]
- Ding, J.; Huang, J.; Xia, B.; Hu, S.; Fan, H.; Dai, J.; Li, Z.; Wang, J.; Le, C.; Qiu, P.; et al. Transfer of α-synuclein from neurons to oligodendrocytes triggers myelin sheath destruction in methamphetamine administration mice. Toxicol. Lett. 2021, 352, 34–45. [Google Scholar] [CrossRef] [PubMed]
- Shekoohi, S.; Rajasekaran, S.; Patel, D.; Yang, S.; Liu, W.; Huang, S.; Yu, X.; Witt, S.N. Knocking out alpha-synuclein in melanoma cells dysregulates cellular iron metabolism and suppresses tumor growth. Sci. Rep. 2021, 11, 5267. [Google Scholar] [CrossRef] [PubMed]
- Matsuo, Y.; Kamitani, T. Parkinson’s disease-related protein, alpha-synuclein, in malignant melanoma. PLoS ONE 2010, 5, e10481. [Google Scholar] [CrossRef] [PubMed]
- Israeli, E.; Yakunin, E.; Zarbiv, Y.; Hacohen-Solovich, A.; Kisos, H.; Loeb, V.; Lichtenstein, M.; Ben-Gedalya, T.; Sabag, O.; Pikarsky, E.; et al. α-Synuclein expression selectively affects tumorigenesis in mice modeling Parkinson’s disease. PLoS ONE 2011, 6, e19622. [Google Scholar] [CrossRef] [Green Version]
- Lee, B.R.; Matsuo, Y.; Cashikar, A.G.; Kamitani, T. Role of Ser129 phosphorylation of α-synuclein in melanoma cells. J. Cell Sci. 2013, 126, 696–704. [Google Scholar] [CrossRef] [Green Version]
- Rodriguez-Leyva, I.; Chi-Ahumada, E.; Mejía, M.; Castanedo-Cazares, J.P.; Eng, W.; Saikaly, S.K.; Carrizales, J.; Levine, T.D.; Norman, R.A.; Jimenez-Capdeville, M.E. The Presence of Alpha-Synuclein in Skin from Melanoma and Patients with Parkinson’s Disease. Mov. Disord. Clin. Pract. 2017, 4, 724–732. [Google Scholar] [CrossRef] [Green Version]
- Bruening, W.; Giasson, B.I.; Klein-Szanto, A.J.; Lee, V.M.; Trojanowski, J.Q.; Godwin, A.K. Synucleins are expressed in the majority of breast and ovarian carcinomas and in preneoplastic lesions of the ovary. Cancer 2000, 88, 2154–2163. [Google Scholar] [CrossRef]
- Ye, Q.; Wang, T.F.; Peng, Y.F.; Xie, J.; Feng, B.; Qiu, M.Y.; Li, L.H.; Lu, A.G.; Liu, B.Y.; Zheng, M.H. Expression of alpha-, beta- and gamma-synuclein in colorectal cancer, and potential clinical significance in progression of the disease. Oncol. Rep. 2010, 23, 429–436. [Google Scholar]
- Kawashima, M.; Suzuki, S.O.; Doh-ura, K.; Iwaki, T. alpha-Synuclein is expressed in a variety of brain tumors showing neuronal differentiation. Acta Neuropathol. 2000, 99, 154–160. [Google Scholar] [CrossRef]
- Gao, S.; Duan, C.; Gao, G.; Wang, X.; Yang, H. Alpha-synuclein overexpression negatively regulates insulin receptor substrate 1 by activating mTORC1/S6K1 signaling. Int. J. Biochem. Cell Biol. 2015, 64, 25–33. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Z.; Yang, C.; Iyaswamy, A.; Krishnamoorthi, S.; Sreenivasmurthy, S.G.; Liu, J.; Wang, Z.; Tong, B.C.; Song, J.; Lu, J.; et al. Balancing mTOR Signaling and Autophagy in the Treatment of Parkinson’s Disease. Int. J. Mol. Sci. 2019, 20, 728. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Z.F.; Cui, L.; Jin, M.M.; Hu, D.Y.; Hou, X.G.; Liu, S.S.; Zhang, X.; Zhu, J.H. A Matrigel-based 3D construct of SH-SY5Y cells models the α-synuclein pathologies of Parkinson’s disease. Dis. Model. Mech. 2022, 15, dmm049125. [Google Scholar] [CrossRef] [PubMed]
- Arsac, J.N.; Sedru, M.; Dartiguelongue, M.; Vulin, J.; Davoust, N.; Baron, T.; Mollereau, B. Chronic Exposure to Paraquat Induces Alpha-Synuclein Pathogenic Modifications in Drosophila. Int. J. Mol. Sci. 2021, 22, 11613. [Google Scholar] [CrossRef] [PubMed]
- Takaichi, Y.; Chambers, J.K.; Inoue, H.; Ano, Y.; Takashima, A.; Nakayama, H.; Uchida, K. Phosphorylation and oligomerization of α-synuclein associated with GSK-3β activation in the rTg4510 mouse model of tauopathy. Acta Neuropathol. Commun. 2020, 8, 86. [Google Scholar] [CrossRef]
- Yoshinaga, S.; Yamanaka, T.; Miyazaki, H.; Okuzumi, A.; Hiyama, A.; Murayama, S.; Nukina, N. Preserved proteinase K-resistant core after amplification of alpha-synuclein aggregates: Implication to disease-related structural study. Biochem. Biophys. Res. Commun. 2020, 522, 655–661. [Google Scholar] [CrossRef]
Primary Antibody | Distributor | Cat# | RRID | Work Dilution |
---|---|---|---|---|
Rabbit polyclonal | Sigma | SAB4502828 | AB_10746104 | 1:100 (IF) 1 |
Mouse monoclonal | Abcam | ab27766 | AB_727020 | 1:1000 (IP) |
Mouse monoclonal | BD Transduction Laboratories | 610786 | AB_398107 | 1:800 (WB) |
Rabbit polyclonal | Sigma | SAB4502828 | AB_10746104 | 1:50 (TEM) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ryskalin, L.; Ferese, R.; Morucci, G.; Biagioni, F.; Busceti, C.L.; Michetti, F.; Lenzi, P.; Frati, A.; Fornai, F. Occurrence of Total and Proteinase K-Resistant Alpha-Synuclein in Glioblastoma Cells Depends on mTOR Activity. Cancers 2022, 14, 1382. https://doi.org/10.3390/cancers14061382
Ryskalin L, Ferese R, Morucci G, Biagioni F, Busceti CL, Michetti F, Lenzi P, Frati A, Fornai F. Occurrence of Total and Proteinase K-Resistant Alpha-Synuclein in Glioblastoma Cells Depends on mTOR Activity. Cancers. 2022; 14(6):1382. https://doi.org/10.3390/cancers14061382
Chicago/Turabian StyleRyskalin, Larisa, Rosangela Ferese, Gabriele Morucci, Francesca Biagioni, Carla L. Busceti, Fabrizio Michetti, Paola Lenzi, Alessandro Frati, and Francesco Fornai. 2022. "Occurrence of Total and Proteinase K-Resistant Alpha-Synuclein in Glioblastoma Cells Depends on mTOR Activity" Cancers 14, no. 6: 1382. https://doi.org/10.3390/cancers14061382