Regulation of EZH2 Expression by INPP4B in Normal Prostate and Primary Prostate Cancer
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture Reagents and Compounds
2.2. Reverse Phase Protein Array (RPPA)
2.3. Gene Set Enrichment Analysis (GSEA)
2.4. siRNA Transfection
2.5. Western Blotting
2.6. Gene Expression Analysis
2.7. Single-Cell RNA-seq Analysis
2.8. Animal Husbandry
2.9. Immunohistochemistry
2.10. Statistical Analysis
3. Results
3.1. INPP4B Depletion Reduces EZH2 Expression in Prostate Cancer
3.2. Expression of INPP4B Positively Correlates with EZH2 Levels in Human Prostate Epithelium and Primary Tumors
3.3. Androgen Signaling Induces EZH2 in Prostate Cancer Cells
3.4. EZH2 Is Regulated by INPP4B In Vivo in Mouse Prostate
3.5. INPP4B Loss Leads to a Compensatory Increase in TP53 Protein Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hodgson, M.C.; Deryugina, E.I.; Suarez, E.; Lopez, S.M.; Lin, D.; Xue, H.; Gorlov, I.P.; Wang, Y.; Agoulnik, I.U. INPP4B suppresses prostate cancer cell invasion. Cell Commun. Signal. 2014, 12, 61. [Google Scholar] [CrossRef] [PubMed]
- Hodgson, M.C.; Shao, L.J.; Frolov, A.; Li, R.; Peterson, L.E.; Ayala, G.; Ittmann, M.M.; Weigel, N.L.; Agoulnik, I.U. Decreased expression and androgen regulation of the tumor suppressor gene INPP4B in prostate cancer. Cancer Res. 2011, 71, 572–582. [Google Scholar] [CrossRef] [PubMed]
- Norris, F.A.; Atkins, R.C.; Majerus, P.W. The cDNA cloning and characterization of inositol polyphosphate 4-phosphatase type II. Evidence for conserved alternative splicing in the 4-phosphatase family. J. Biol. Chem. 1997, 272, 23859–23864. [Google Scholar] [CrossRef] [PubMed]
- Taylor, B.S.; Schultz, N.; Hieronymus, H.; Gopalan, A.; Xiao, Y.; Carver, B.S.; Arora, V.K.; Kaushik, P.; Cerami, E.; Reva, B.; et al. Integrative genomic profiling of human prostate cancer. Cancer Cell 2010, 18, 11–22. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Gao, J.; Lei, Q.; Rozengurt, N.; Pritchard, C.; Jiao, J.; Thomas, G.V.; Li, G.; Roy-Burman, P.; Nelson, P.S.; et al. Prostate-specific deletion of the murine Pten tumor suppressor gene leads to metastatic prostate cancer. Cancer Cell 2003, 4, 209–221. [Google Scholar] [CrossRef]
- Jamaspishvili, T.; Berman, D.M.; Ross, A.E.; Scher, H.I.; De Marzo, A.M.; Squire, J.A.; Lotan, T.L. Clinical implications of PTEN loss in prostate cancer. Nat. Rev. Urol. 2018, 15, 222–234. [Google Scholar] [CrossRef]
- Chen, M.; Zhang, J.; Sampieri, K.; Clohessy, J.G.; Mendez, L.; Gonzalez-Billalabeitia, E.; Liu, X.S.; Lee, Y.R.; Fung, J.; Katon, J.M.; et al. An aberrant SREBP-dependent lipogenic program promotes metastatic prostate cancer. Nat. Genet. 2018, 50, 206–218. [Google Scholar] [CrossRef]
- Ding, Z.; Wu, C.J.; Chu, G.C.; Xiao, Y.; Ho, D.; Zhang, J.; Perry, S.R.; Labrot, E.S.; Wu, X.; Lis, R.; et al. SMAD4-dependent barrier constrains prostate cancer growth and metastatic progression. Nature 2011, 470, 269–273. [Google Scholar] [CrossRef]
- Nowak, D.G.; Cho, H.; Herzka, T.; Watrud, K.; DeMarco, D.V.; Wang, V.M.; Senturk, S.; Fellmann, C.; Ding, D.; Beinortas, T.; et al. MYC Drives Pten/Trp53-Deficient Proliferation and Metastasis due to IL6 Secretion and AKT Suppression via PHLPP2. Cancer Discov. 2015, 5, 636–651. [Google Scholar] [CrossRef]
- Wang, L.; Xiong, H.; Wu, F.; Zhang, Y.; Wang, J.; Zhao, L.; Guo, X.; Chang, L.J.; Zhang, Y.; You, M.J.; et al. Hexokinase 2-mediated Warburg effect is required for PTEN- and p53-deficiency-driven prostate cancer growth. Cell Rep. 2014, 8, 1461–1474. [Google Scholar] [CrossRef]
- Chen, Z.; Trotman, L.C.; Shaffer, D.; Lin, H.K.; Dotan, Z.A.; Niki, M.; Koutcher, J.A.; Scher, H.I.; Ludwig, T.; Gerald, W.; et al. Crucial role of p53-dependent cellular senescence in suppression of Pten-deficient tumorigenesis. Nature 2005, 436, 725–730. [Google Scholar] [CrossRef] [PubMed]
- Westaby, D.; Fenor de La Maza, M.L.D.; Paschalis, A.; Jimenez-Vacas, J.M.; Welti, J.; de Bono, J.; Sharp, A. A New Old Target: Androgen Receptor Signaling and Advanced Prostate Cancer. Annu. Rev. Pharmacol. Toxicol. 2022, 62, 131–153. [Google Scholar] [CrossRef] [PubMed]
- Wilding, G. The importance of steroid hormones in prostate cancer. Cancer Surv. 1992, 14, 113–130. [Google Scholar] [PubMed]
- Varambally, S.; Dhanasekaran, S.M.; Zhou, M.; Barrette, T.R.; Kumar-Sinha, C.; Sanda, M.G.; Ghosh, D.; Pienta, K.J.; Sewalt, R.G.; Otte, A.P.; et al. The polycomb group protein EZH2 is involved in progression of prostate cancer. Nature 2002, 419, 624–629. [Google Scholar] [CrossRef]
- Yamagishi, M.; Uchimaru, K. Targeting EZH2 in cancer therapy. Curr. Opin. Oncol. 2017, 29, 375–381. [Google Scholar] [CrossRef]
- Cao, R.; Wang, L.; Wang, H.; Xia, L.; Erdjument-Bromage, H.; Tempst, P.; Jones, R.S.; Zhang, Y. Role of histone H3 lysine 27 methylation in Polycomb-group silencing. Science 2002, 298, 1039–1043. [Google Scholar] [CrossRef]
- Mozzetta, C.; Pontis, J.; Fritsch, L.; Robin, P.; Portoso, M.; Proux, C.; Margueron, R.; Ait-Si-Ali, S. The histone H3 lysine 9 methyltransferases G9a and GLP regulate polycomb repressive complex 2-mediated gene silencing. Mol. Cell 2014, 53, 277–289. [Google Scholar] [CrossRef]
- Zhang, Q.; Dong, P.; Liu, X.; Sakuragi, N.; Guo, S.W. Enhancer of Zeste homolog 2 (EZH2) induces epithelial-mesenchymal transition in endometriosis. Sci. Rep. 2017, 7, 6804. [Google Scholar] [CrossRef]
- Bracken, A.P.; Pasini, D.; Capra, M.; Prosperini, E.; Colli, E.; Helin, K. EZH2 is downstream of the pRB-E2F pathway, essential for proliferation and amplified in cancer. EMBO J. 2003, 22, 5323–5335. [Google Scholar] [CrossRef]
- Xu, K.; Wu, Z.J.; Groner, A.C.; He, H.H.; Cai, C.; Lis, R.T.; Wu, X.; Stack, E.C.; Loda, M.; Liu, T.; et al. EZH2 oncogenic activity in castration-resistant prostate cancer cells is Polycomb-independent. Science 2012, 338, 1465–1469. [Google Scholar] [CrossRef]
- Cha, T.L.; Zhou, B.P.; Xia, W.; Wu, Y.; Yang, C.C.; Chen, C.T.; Ping, B.; Otte, A.P.; Hung, M.C. Akt-mediated phosphorylation of EZH2 suppresses methylation of lysine 27 in histone H3. Science 2005, 310, 306–310. [Google Scholar] [CrossRef] [PubMed]
- Saad, F.; Shore, N.; Zhang, T.; Sharma, S.; Cho, H.K.; Jacobs, I.A. Emerging therapeutic targets for patients with advanced prostate cancer. Cancer Treat. Rev. 2019, 76, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Astle, M.V.; Hannan, K.M.; Ng, P.Y.; Lee, R.S.; George, A.J.; Hsu, A.K.; Haupt, Y.; Hannan, R.D.; Pearson, R.B. AKT induces senescence in human cells via mTORC1 and p53 in the absence of DNA damage: Implications for targeting mTOR during malignancy. Oncogene 2012, 31, 1949–1962. [Google Scholar] [CrossRef]
- Zhang, M.; Suarez, E.; Vasquez, J.L.; Nathanson, L.; Peterson, L.E.; Rajapakshe, K.; Basil, P.; Weigel, N.L.; Coarfa, C.; Agoulnik, I.U. Inositol polyphosphate 4-phosphatase type II regulation of androgen receptor activity. Oncogene 2019, 38, 1121–1135. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Ceyhan, Y.; Kaftanovskaya, E.M.; Vasquez, J.L.; Vacher, J.; Knop, F.K.; Nathanson, L.; Agoulnik, A.I.; Ittmann, M.M.; Agoulnik, I.U. INPP4B protects from metabolic syndrome and associated disorders. Commun. Biol. 2021, 4, 416. [Google Scholar] [CrossRef]
- Grubb, R.L.; Deng, J.; Pinto, P.A.; Mohler, J.L.; Chinnaiyan, A.; Rubin, M.; Linehan, W.M.; Liotta, L.A.; Petricoin, E.F.; Wulfkuhle, J.D. Pathway biomarker profiling of localized and metastatic human prostate cancer reveal metastatic and prognostic signatures. J. Proteome Res. 2009, 8, 3044–3054. [Google Scholar] [CrossRef]
- Silvestri, A.; Colombatti, A.; Calvert, V.S.; Deng, J.; Mammano, E.; Belluco, C.; De Marchi, F.; Nitti, D.; Liotta, L.A.; Petricoin, E.F.; et al. Protein pathway biomarker analysis of human cancer reveals requirement for upfront cellular-enrichment processing. Lab. Investig. 2010, 90, 787–796. [Google Scholar] [CrossRef]
- Zhang, M.; Krause, W.C.; Agoulnik, I.U. Techniques for Evaluation of AR Transcriptional Output and Recruitment to DNA. Methods Mol. Biol. 2018, 1786, 219–236. [Google Scholar] [CrossRef]
- Kim, J.; Lee, Y.; Lu, X.; Song, B.; Fong, K.W.; Cao, Q.; Licht, J.D.; Zhao, J.C.; Yu, J. Polycomb- and Methylation-Independent Roles of EZH2 as a Transcription Activator. Cell Rep. 2018, 25, 2808–2820.e4. [Google Scholar] [CrossRef]
- Kfoury, Y.; Baryawno, N.; Severe, N.; Mei, S.; Gustafsson, K.; Hirz, T.; Brouse, T.; Scadden, E.W.; Igolkina, A.A.; Kokkaliaris, K.; et al. Human prostate cancer bone metastases have an actionable immunosuppressive microenvironment. Cancer Cell 2021, 39, 1464–1478.e8. [Google Scholar] [CrossRef]
- Henry, G.H.; Malewska, A.; Joseph, D.B.; Malladi, V.S.; Lee, J.; Torrealba, J.; Mauck, R.J.; Gahan, J.C.; Raj, G.V.; Roehrborn, C.G.; et al. A Cellular Anatomy of the Normal Adult Human Prostate and Prostatic Urethra. Cell Rep. 2018, 25, 3530–3542.e5. [Google Scholar] [CrossRef]
- Barkas, N.; Petukhov, V.; Nikolaeva, D.; Lozinsky, Y.; Demharter, S.; Khodosevich, K.; Kharchenko, P.V. Joint analysis of heterogeneous single-cell RNA-seq dataset collections. Nat. Methods 2019, 16, 695–698. [Google Scholar] [CrossRef] [PubMed]
- Ferron, M.; Boudiffa, M.; Arsenault, M.; Rached, M.; Pata, M.; Giroux, S.; Elfassihi, L.; Kisseleva, M.; Majerus, P.W.; Rousseau, F.; et al. Inositol polyphosphate 4-phosphatase B as a regulator of bone mass in mice and humans. Cell Metab. 2011, 14, 466–477. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Aksoy, B.A.; Dogrusoz, U.; Dresdner, G.; Gross, B.; Sumer, S.O.; Sun, Y.; Jacobsen, A.; Sinha, R.; Larsson, E.; et al. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci. Signal 2013, 6, pl1. [Google Scholar] [CrossRef] [PubMed]
- Cerami, E.; Gao, J.; Dogrusoz, U.; Gross, B.E.; Sumer, S.O.; Aksoy, B.A.; Jacobsen, A.; Byrne, C.J.; Heuer, M.L.; Larsson, E.; et al. The cBio cancer genomics portal: An open platform for exploring multidimensional cancer genomics data. Cancer Discov. 2012, 2, 401–404. [Google Scholar] [CrossRef]
- Emadi Baygi, M.; Soheili, Z.S.; Essmann, F.; Deezagi, A.; Engers, R.; Goering, W.; Schulz, W.A. Slug/SNAI2 regulates cell proliferation and invasiveness of metastatic prostate cancer cell lines. Tumor Biol. 2010, 31, 297–307. [Google Scholar] [CrossRef]
- Perez-Mancera, P.A.; Gonzalez-Herrero, I.; Perez-Caro, M.; Gutierrez-Cianca, N.; Flores, T.; Gutierrez-Adan, A.; Pintado, B.; Sanchez-Martin, M.; Sanchez-Garcia, I. SLUG in cancer development. Oncogene 2005, 24, 3073–3082. [Google Scholar] [CrossRef]
- Sharma, A.; Yeow, W.S.; Ertel, A.; Coleman, I.; Clegg, N.; Thangavel, C.; Morrissey, C.; Zhang, X.; Comstock, C.E.; Witkiewicz, A.K.; et al. The retinoblastoma tumor suppressor controls androgen signaling and human prostate cancer progression. J. Clin. Investig. 2010, 120, 4478–4492. [Google Scholar] [CrossRef]
- Castro, E.; Eeles, R. The role of BRCA1 and BRCA2 in prostate cancer. Asian J. Androl. 2012, 14, 409–414. [Google Scholar] [CrossRef]
- Wu, Y.; Yu, H.; Zheng, S.L.; Na, R.; Mamawala, M.; Landis, T.; Wiley, K.; Petkewicz, J.; Shah, S.; Shi, Z.; et al. A comprehensive evaluation of CHEK2 germline mutations in men with prostate cancer. Prostate 2018, 78, 607–615. [Google Scholar] [CrossRef]
- Sharad, S.; Allemang, T.C.; Li, H.; Nousome, D.; Ku, A.T.; Whitlock, N.C.; Sowalsky, A.G.; Cullen, J.; Sesterhenn, I.A.; McLeod, D.G.; et al. Age and Tumor Differentiation-Associated Gene Expression Based Analysis of Non-Familial Prostate Cancers. Front. Oncol. 2020, 10, 584280. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.D.; Welsbie, D.S.; Tran, C.; Baek, S.H.; Chen, R.; Vessella, R.; Rosenfeld, M.G.; Sawyers, C.L. Molecular determinants of resistance to antiandrogen therapy. Nat. Med. 2004, 10, 33–39. [Google Scholar] [CrossRef] [PubMed]
- Oliveira, D.S.; Dzinic, S.; Bonfil, A.I.; Saliganan, A.D.; Sheng, S.; Bonfil, R.D. The mouse prostate: A basic anatomical and histological guideline. Bosn. J. Basic Med. Sci. 2016, 16, 8–13. [Google Scholar] [CrossRef] [PubMed]
- Garcia, A.J.; Ruscetti, M.; Arenzana, T.L.; Tran, L.M.; Bianci-Frias, D.; Sybert, E.; Priceman, S.J.; Wu, L.; Nelson, P.S.; Smale, S.T.; et al. Pten null prostate epithelium promotes localized myeloid-derived suppressor cell expansion and immune suppression during tumor initiation and progression. Mol. Cell. Biol. 2014, 34, 2017–2028. [Google Scholar] [CrossRef]
- Revandkar, A.; Perciato, M.L.; Toso, A.; Alajati, A.; Chen, J.; Gerber, H.; Dimitrov, M.; Rinaldi, A.; Delaleu, N.; Pasquini, E.; et al. Inhibition of Notch pathway arrests PTEN-deficient advanced prostate cancer by triggering p27-driven cellular senescence. Nat. Commun. 2016, 7, 13719. [Google Scholar] [CrossRef]
- Martin, P.; Liu, Y.N.; Pierce, R.; Abou-Kheir, W.; Casey, O.; Seng, V.; Camacho, D.; Simpson, R.M.; Kelly, K. Prostate epithelial Pten/TP53 loss leads to transformation of multipotential progenitors and epithelial to mesenchymal transition. Am. J. Pathol. 2011, 179, 422–435. [Google Scholar] [CrossRef]
- Gewinner, C.; Wang, Z.C.; Richardson, A.; Teruya-Feldstein, J.; Etemadmoghadam, D.; Bowtell, D.; Barretina, J.; Lin, W.M.; Rameh, L.; Salmena, L.; et al. Evidence that inositol polyphosphate 4-phosphatase type II is a tumor suppressor that inhibits PI3K signaling. Cancer Cell 2009, 16, 115–125. [Google Scholar] [CrossRef]
- Vander Haar, E.; Lee, S.I.; Bandhakavi, S.; Griffin, T.J.; Kim, D.H. Insulin signalling to mTOR mediated by the Akt/PKB substrate PRAS40. Nat. Cell Biol. 2007, 9, 316–323. [Google Scholar] [CrossRef]
- Cancer Genome Atlas Research, N. The Molecular Taxonomy of Primary Prostate Cancer. Cell 2015, 163, 1011–1025. [Google Scholar] [CrossRef]
- Hieronymus, H.; Schultz, N.; Gopalan, A.; Carver, B.S.; Chang, M.T.; Xiao, Y.; Heguy, A.; Huberman, K.; Bernstein, M.; Assel, M.; et al. Copy number alteration burden predicts prostate cancer relapse. Proc. Natl. Acad. Sci. USA 2014, 111, 11139–11144. [Google Scholar] [CrossRef]
- Carver, B.S.; Chapinski, C.; Wongvipat, J.; Hieronymus, H.; Chen, Y.; Chandarlapaty, S.; Arora, V.K.; Le, C.; Koutcher, J.; Scher, H.; et al. Reciprocal feedback regulation of PI3K and androgen receptor signaling in PTEN-deficient prostate cancer. Cancer Cell 2011, 19, 575–586. [Google Scholar] [CrossRef] [PubMed]
- Kofuji, S.; Kimura, H.; Nakanishi, H.; Nanjo, H.; Takasuga, S.; Liu, H.; Eguchi, S.; Nakamura, R.; Itoh, R.; Ueno, N.; et al. INPP4B Is a PtdIns(3,4,5)P3 Phosphatase That Can Act as a Tumor Suppressor. Cancer Discov. 2015, 5, 730–739. [Google Scholar] [CrossRef] [PubMed]
- Wen, S.; Tian, J.; Niu, Y.; Li, L.; Yeh, S.; Chang, C. ASC-J9((R)), and not Casodex or Enzalutamide, suppresses prostate cancer stem/progenitor cell invasion via altering the EZH2-STAT3 signals. Cancer Lett. 2016, 376, 377–386. [Google Scholar] [CrossRef] [PubMed]
- Kunderfranco, P.; Mello-Grand, M.; Cangemi, R.; Pellini, S.; Mensah, A.; Albertini, V.; Malek, A.; Chiorino, G.; Catapano, C.V.; Carbone, G.M. ETS transcription factors control transcription of EZH2 and epigenetic silencing of the tumor suppressor gene Nkx3.1 in prostate cancer. PLoS ONE 2010, 5, e10547. [Google Scholar] [CrossRef] [PubMed]
- Mulholland, D.J.; Tran, L.M.; Li, Y.; Cai, H.; Morim, A.; Wang, S.; Plaisier, S.; Garraway, I.P.; Huang, J.; Graeber, T.G.; et al. Cell autonomous role of PTEN in regulating castration-resistant prostate cancer growth. Cancer Cell 2011, 19, 792–804. [Google Scholar] [CrossRef]
- Gan, L.; Yang, Y.; Li, Q.; Feng, Y.; Liu, T.; Guo, W. Epigenetic regulation of cancer progression by EZH2: From biological insights to therapeutic potential. Biomark. Res. 2018, 6, 10. [Google Scholar] [CrossRef]
- Wu, X.; Liu, D.; Tao, D.; Xiang, W.; Xiao, X.; Wang, M.; Wang, L.; Luo, G.; Li, Y.; Zeng, F.; et al. BRD4 Regulates EZH2 Transcription through Upregulation of C-MYC and Represents a Novel Therapeutic Target in Bladder Cancer. Mol. Cancer Ther. 2016, 15, 1029–1042. [Google Scholar] [CrossRef]
- Ding, L.; Chen, S.; Liu, P.; Pan, Y.; Zhong, J.; Regan, K.M.; Wang, L.; Yu, C.; Rizzardi, A.; Cheng, L.; et al. CBP loss cooperates with PTEN haploinsufficiency to drive prostate cancer: Implications for epigenetic therapy. Cancer Res. 2014, 74, 2050–2061. [Google Scholar] [CrossRef]
siRNA | Sense | Antisense |
---|---|---|
INPP4B | GAGCCUGAACUGCAUUAUU | AAUAAUGCAGUUCAGGCUC |
INPP4B | CGAUGUCAGUGACACUUGA | UCAAGUGUCACUGACAUCG |
PTEN | CCAUUACAAGAUAUACAAU | AUUGUAUAUCUUGUAAUGG |
PTEN | AAACAUUAUUGCUAUGGGA | UCCCAUAGCAAUAAUGUUU |
Gene name | Forward primer | Reverse primer | Probe |
---|---|---|---|
INPP4B (human) | tgtctgatgctgacgctaaga | ccacaaaccaatccagcaa | 41 |
PTEN (human) | ggggaagtaaggaccagaga | tccagatgattctttaacaggtagc | 48 |
EZH2 (human) | tgtggatactcctccaaggaa | gaggagccgtcctttttca | 35 |
Ezh2 (mouse) | gaataacagtagcagacccagca | gcttctctgtcactgtctgtatcc | 109 |
Pml (mouse) | cccaacctgtggctatggta | ccttgcattgaaaaggcatac | 1 |
Trp53 (mouse) | gcaactatggcttccacctg | ttattgaggggaggagagtacg | 4 |
18S | gcaattattccccatgaacg | gggacttaatcaacgcaagc | 48 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, M.; Ceyhan, Y.; Mei, S.; Hirz, T.; Sykes, D.B.; Agoulnik, I.U. Regulation of EZH2 Expression by INPP4B in Normal Prostate and Primary Prostate Cancer. Cancers 2023, 15, 5418. https://doi.org/10.3390/cancers15225418
Zhang M, Ceyhan Y, Mei S, Hirz T, Sykes DB, Agoulnik IU. Regulation of EZH2 Expression by INPP4B in Normal Prostate and Primary Prostate Cancer. Cancers. 2023; 15(22):5418. https://doi.org/10.3390/cancers15225418
Chicago/Turabian StyleZhang, Manqi, Yasemin Ceyhan, Shenglin Mei, Taghreed Hirz, David B. Sykes, and Irina U. Agoulnik. 2023. "Regulation of EZH2 Expression by INPP4B in Normal Prostate and Primary Prostate Cancer" Cancers 15, no. 22: 5418. https://doi.org/10.3390/cancers15225418