The Change of Bacterial Spectrum after Storage of X. campestris pv. campestris Inoculated Cabbage Heads (Brassica oleracea var. capitata L.)
Abstract
:1. Introduction
2. Material and Methods
2.1. Plant Material and Sampling
2.2. Isolation of Bacteria From Cabbage Heads
2.3. Detection of the Bacterial Group, PCR, and Sequencing
2.4. Statistical Analysis
3. Results
3.1. Persistence of Xcc on Cabbage Heads after Storage
3.2. Changes of Bacterial Spectra Present in Cabbage Heads Inoculated and Non-Inoculated with Xcc
3.3. Effect of Bacillus and Pseudomonas Species to Xcc Incidence
4. Discussion
4.1. Persistence of Xcc on Cabbage Heads during Storage and Potential Antagonistic Effect of Bacillus Species
4.2. Changes of Bacterial Spectra Presented in Cabbage Heads Inoculated and Non-Inoculated by Xcc
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Coates, L.M.; Johnson, G.I.; Dale, M. Postharvest Pathology of Fruit and Vegetables. In Plant Pathogens and Plant Diseases, 1st ed.; Brown, J., Ogle, H., Eds.; Rockvale Publications: Armidale, Australia, 1997; pp. 533–548. [Google Scholar]
- Bhat, K.A. Management of post-harvest Pectobacterium soft rot of cabbage (Brassica oleracea var capitata L.) by biocides and packing material. Afr. J. Agric. Res. 2012, 7, 4066–4074. [Google Scholar]
- Bayogan, E.; Jimenez, E.; Boteng, J.; Bautista, O.; Macario, C. Improving Postharvest Cabbage (Brassica oleracea L. var. capitata) Quality Using Alum and Newspaper Wrap. Banwa 2011, 6, 76–86. [Google Scholar] [CrossRef]
- Griesbach, E.; Löptien, H.; Miersch, U. Resistance to Xanthomonas campestris pv. campestris (Pammel) Dowson in cabbage Brassica oleracea L. J. Plant Dis. Protect. 2003, 110, 461–475. [Google Scholar] [CrossRef]
- Agrios, G.N. Bacterial Soft Rots, 5th ed.; Academic Press: San Diego, CA, USA, 2006. [Google Scholar]
- Larka, B.S. Integrated approach for the management of soft rot (Pectobacterium carotovorum sub-sp. carotovorum) of radish (Raphanus sativus) seed crop. Haryana J. Agron. 2004, 20, 128–129. [Google Scholar]
- Schaad, N.W.; White, W.C. Survival of Xanthomonas campestris in soil. Phytopathology 1974, 64, 1518–1520. [Google Scholar] [CrossRef]
- Dane, F.; Shaw, J.J. Endophytic growth of Xanthomonas campestris pv. campestris on susceptible and resistant host plants in the field environment, detection by bioluminescence. Microb. Releases 1994, 2, 223–229. [Google Scholar]
- Dzhalilov, F.S.; Tiwari, R.D. Soil and cabbage plant debris as infection sources of black rot. Arch. Phytopathol. Plant Protect. 1995, 29, 383–386. [Google Scholar] [CrossRef]
- Arias, R.; Nelson, S.; Alvarez, A. Effect of soil-matric potential and phylloplanes of rotation-crops on the survival of a bioluminescent Xanthomonas campestris pv. campestris. Eur. J. Plant Pathol. 2000, 106, 109–116. [Google Scholar] [CrossRef]
- Yuen, G.Y.; Alvarez, A.M.; Benedict, A.A.; Trotter, K.J. Use of monoclonal antibodies to monitor the dissemination of Xanthomonas campestris pv. Campestris. Phytopathology 1987, 77, 366–370. [Google Scholar] [CrossRef] [Green Version]
- Grimm, R.; Vogelsanger, J. Black Rot Disease on Cabbage, Irrigation and Spreading. In Proceedings of the 7th International Conference on Plant Pathology Bacteria, Budapest, Hungary, 11–16 June 1989. [Google Scholar]
- Kocks, C.G.; Zadoks, J.C.; Ruissen, M.A. Spatio-temporal development of black rot (X. campestris pv. campestris) in cabbage in relation to initial inoculum levels in field plots in The Netherlands. Plant Pathol. 1999, 48, 176–188. [Google Scholar] [CrossRef]
- Cook, A.A.; Walker, J.C.; Larson, R.H. Studies on the disease cycle of black rot of crucifers. Phytopathology 1952, 42, 162–167. [Google Scholar]
- Schaad, N.W.; Thaveechai, N. Black rot of crucifers in Thailand. Plant Dis. 1983, 67, 1231–1234. [Google Scholar] [CrossRef]
- Farrar, J.; Nunez, J.; Davis, R. Losses due to lenticel rot are an increasing concern for Kern County potato growers. Calif. Agric. 2008, 63, 127–130. [Google Scholar] [CrossRef]
- Miura, K. Shinpen Yasai Engei Handbook. In Vegetable Gardening Handbook, 1st ed.; Nishi, S., Ed.; Yokendo Co. Ltd.: Tokyo, Japan, 2001; pp. 163–173. [Google Scholar]
- Mills, A.A.S.; Hurta, R.A.R. Sensitivity of Erwinia spp. to salt compounds in vitro and their effect on the development of soft rot in potato tubers in storage. Postharvest Biol. Technol. 2006, 41, 208–214. [Google Scholar] [CrossRef]
- Higashio, H.; Yamada, M. Control of Soft Rot after Harvest of Cabbage in Indonesia. JARQ-Jpn. Agric. Res. Q. 2004, 38, 175–178. [Google Scholar] [CrossRef] [Green Version]
- Galati, A.; McKay, A.; Soon, C.T. Minimising Postharvest Losses of Carrots; Farm note No.75/95; Department of Agriculture and Food, Government of Western Australia: South Perth, Australia, 2005.
- Eichmeier, A.; Peňázová, E.; Pečenka, J.; Čechová, J.; Pokluda, R.; Tekielska, D.; Baránek, M. Rapid Communication. Monitoring the occurrence of bacteria in stored cabbage heads. J. Plant Protect. Res. 2016, 57, 56–61. [Google Scholar] [CrossRef] [Green Version]
- Mikiciński, A.; Sobiczewski, P.; Puławska, J.; Malusa, E. Antagonistic potential of Pseudomonas graminis 49M against Erwinia amylovora, the causal agent of fire blight. Arch. Microbiol. 2016, 198, 531–539. [Google Scholar] [CrossRef] [Green Version]
- Mondal, K.; Dureja, P.; Prakash Verma, J. Management of Xanthomonas campestris pv. malvacearum-Induced Blight of Cotton Through Phenolics of Cotton Rhizobacterium. Curr. Microbiol. 2001, 43, 336–339. [Google Scholar] [CrossRef]
- Wulff, E.G.; Mguni, C.M.; Mortensen, C.N.; Keswani, C.; Hockenhull, J. Biological Control of Black Rot (Xanthomonas Campestris Pv. campestris) of Brassicas with an Antagonistic Strain of Bacillus Subtilis in Zimbabwe. Eur. J. Plant Pathol. 2002, 108, 317–325. [Google Scholar] [CrossRef]
- Júnior, T.S.; Silva, J.C.; Gonçalves, R.M.; Soman, J.M.; Passos, J.R.S.; Maringoni, A.C. Survival of Xanthomonas campestris pv. campestris associated with soil and cauliflower crop debris under Brazilian conditions. Eur. J. Plant Pathol. 2020, 156, 399–411. [Google Scholar]
- Silva, J.C.; Silva Júnior, T.A.F.; Soman, J.M.; Tomasini, T.D.; Sartori, M.M.P.; Maringoni, A.C. Survival of Xanthomonas campestris pv. campestris in the phyllosphere and rhizosphere of weeds. Plant Pathol. 2017, 66, 1517–1526. [Google Scholar] [CrossRef]
- Van der Wolf, J.; Kastelein, P.; da Silva Júnior, T.A.F.; Lelis, F.V.; van der Zouwen, P. Colonization of siliques and seeds of rapid cycling Brassica oleracea plants by Xanthomonas campestris pv. campestris after spray-inoculation of flower clusters. Eur. J. Plant Pathol. 2019, 154, 445–461. [Google Scholar] [CrossRef] [Green Version]
- Vicente, J.G.; Holub, E.B. Xanthomonas campestris pv. campestris (cause of black rot of crucifers) in the genomic era is still a worldwide threat to brassica crops. Mol. Plant Pathol. 2013, 14, 2–18. [Google Scholar] [CrossRef] [PubMed]
- Roberts, S.; Brough, J.; Hunter, P. Modelling the spread of Xanthomonas campestris pv. campestris in module-raised brassica transplants. Plant Pathol. 2006, 56, 391–401. [Google Scholar] [CrossRef]
- Eichmeier, A.; Peňázová, E.; Pokluda, R.; Vicente, J.G. Detection of Xanthomonas campestris pv. campestris through a real-time PCR assay targeting the Zur gene and comparison with detection targeting the hrpF gene. Eur. J. Plant Pathol. 2019, 155, 891–902. [Google Scholar] [CrossRef]
- Eichmeier, A.; Baránek, M.; Pidra, M. Analysis of genetic diversity and phylogeny of partial coat protein domain in Czech and Italian GFLV isolates. Plant Protect. Sci. 2010, 46, 145–148. [Google Scholar] [CrossRef] [Green Version]
- Chang, C.J.; Donaldson, R.; Crowley, M.; Pinnow, D. A new semiselective medium for the isolation of Xanthomonas campestris pv. campestris from crucifer seeds. Phytopathology 1991, 81, 449–453. [Google Scholar] [CrossRef]
- Oliwa-Stasiak, K.; Molnar, C.; Arshak, K.; Bartoszcze, M.; Adley, C. Development of a PCR assay for identification of the Bacillus cereus group species. J. Appl. Microbiol. 2010, 108, 266–273. [Google Scholar] [CrossRef]
- Roberts, M.; Nakamura, L.; Cohan, F. Bacillus mojavensis sp. nov., Distinguishable from Bacillus subtilis by Sexual Isolation, Divergence in DNA Sequence, and Differences in Fatty Acid Composition. Int. J. Syst. Bacteriol. 1994, 44, 256–264. [Google Scholar] [CrossRef] [Green Version]
- Purohit, H.; Raje, D.; Kapley, A. Identification of signature and primers specific to genus Pseudomonas using mismatched patterns of 16S rDNA sequences. BMC Bioinform. 2003, 4, 19. [Google Scholar] [CrossRef] [Green Version]
- Berg, T.; Tesoriero, L.; Hailstones, D. PCR-based detection of Xanthomonas campestris pathovars in Brassica seed. Plant Pathol. 2005, 54, 416–427. [Google Scholar] [CrossRef]
- Roohie, R.K.; Umesha, S. Development of multiplex PCR for the specific detection of Xanthomonas campestris pv. campestris in cabbage and correlation with disease incidence. J. Plant Pathol. Microbiol. 2012, 3, 2. [Google Scholar] [CrossRef]
- Klindworth, A.; Pruesse, E.; Schweer, T.; Peplies, J.; Quast, C.; Horn, M.; Glöckner, F. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res. 2012, 41, e1. [Google Scholar] [CrossRef] [PubMed]
- Past 4—The Past of the Future. Available online: http://folk.uio.no/ohammer/past/ (accessed on 13 February 2020).
- Ter Braak, C.J.F.; Šmilauer, P. Canoco Reference Manual and User’s Guide: Software for Ordination (Version 5.0); Microcomputer Power: Ithaca, NY, USA, 2012. [Google Scholar]
- Nuñez, A.; Rodríguez, G.; Monteiro, F.; Faria, A.; Silva, J.; Monteiro, A.; Carvalho, C.; Gomes, L.; Souza, R.; de Souza, J.; et al. Bio-based products control black rot (Xanthomonas campestris pv. campestris) and increase the nutraceutical and antioxidant components in kale. Sci. Rep. 2018, 8, 1–11. [Google Scholar]
- Ruissen, M.; Vossen, R.; Kocks, C. Growth of Xanthomonas campestris pv. campestris populations at constant and variable temperatures. Neth. J. Plant Pathol. 1993, 99, 173–179. [Google Scholar] [CrossRef]
- Mabagala, R.B. Epiphytic bacteria from various bean genotypes and their potential for biocontrol of Xanthomonas axonopodis pv. Phaseoli. Tanz. J. Agric. Sci. 1999, 2, 19–26. [Google Scholar]
- Liao, C.; Wells, J. Association of Pectolytic Strains of Xanthomonas campestris with Soft Rots of Fruits and Vegetables at Retail Markets. Phytopathology 1987, 77, 418–422. [Google Scholar] [CrossRef] [Green Version]
- King, A.D.; Bolin, H.R. Physiological and microbiological storage stability of minimally processed fruits and vegetables. Food Technol. 1989, 43, 132–139. [Google Scholar]
- Afsharmanesh, H.; Ahmadzadeh, M.; Javan-Nikkhah, M.; Behboudi, K. Characterization of the antagonistic activity of a new indigenous strain of Pseudomonas fluorescens isolated from onion rhizosphere. J. Plant Pathol. 2010, 92, 187–194. [Google Scholar]
- Zhao, Y.; Li, P.; Huang, K.; Wang, Y.; Hu, H.; Sun, Y. Control of postharvest soft rot caused by Erwinia carotovora of vegetables by a strain of Bacillus amyloliquefaciens and its potential modes of action. World J. Microb. Biot. 2012, 29, 411–420. [Google Scholar] [CrossRef]
- Zhao, Y.; Selvaraj, J.; Xing, F.; Zhou, L.; Wang, Y.; Song, H.; Tan, X.; Sun, L.; Sangare, L.; Folly, Y.; et al. Antagonistic Action of Bacillus subtilis Strain SG6 on Fusarium graminearum. PLoS ONE 2014, 9, e92486. [Google Scholar] [CrossRef] [PubMed]
- Helgason, E.; Caugant, D.A.; Lecadet, M.M.; Chen, Y.; Mahillon, J.; Lovgren, A.; Hegna, I.; Kvaloy, K.; Kolsto, A.B. Genetic diversity of Bacillus cereus/B. thuringiensis isolates from natural sources. Curr. Microbiol. 1998, 37, 80–87. [Google Scholar] [CrossRef] [PubMed]
- Magnusson, M.; Christiansson, A.; Svensson, B. Bacillus cereus spores during housing of dairy cows: Factors affecting contamination of raw milk. J. Dairy Sci. 2007, 90, 2745–2754. [Google Scholar] [CrossRef] [PubMed]
- Andersson, A.; Rönner, U.; Granum, P.E. What problems does the food industry have with the spore-forming pathogens Bacillus cereus and Clostridium perfringens? Int. J. Food Microbiol. 1995, 28, 145–155. [Google Scholar] [CrossRef]
- Bottone, E.J. Bacillus cereus, a volatile human pathogen. Clin. Microbiol. Rev. 2010, 23, 382–398. [Google Scholar] [CrossRef] [Green Version]
- Nicholson, W.; Munakata, N.; Horneck, G.; Melosh, H.; Setlow, P. Resistance of Bacillus Endospores to Extreme Terrestrial and Extraterrestrial Environments. Microbiol. Mol. Biol. Rev. 2000, 64, 548–572. [Google Scholar] [CrossRef] [Green Version]
- Valero, M.; Fernández, P.; Salmerón, M. Influence of pH and temperature on growth of Bacillus cereus in vegetable substrates. Int. J. Food Microbiol. 2003, 82, 71–79. [Google Scholar] [CrossRef]
- Brown, K. Control of bacterial spores. Br. Med. Bull. 2000, 56, 158–171. [Google Scholar] [CrossRef] [Green Version]
- Daelman, J.; Vermeulen, A.; Willemyns, T.; Ongenaert, R.; Jacxsens, L.; Uyttendaele, M.; Devlieghere, F. Growth/no growth models for heat-treated psychrotrophic Bacillus cereus spores under cold storage. Int. J. Food Microbiol. 2013, 161, 7–15. [Google Scholar] [CrossRef]
- Arzanlou, M.; Mousavi, S.; Bakhshi, M.; Khakvar, R.; Bandehagh, A. Inhibitory effects of antagonistic bacteria inhabiting the rhizosphere of the sugar beet plants, on Cercospora beticola Sacc., the causal agent of Cercospora leaf spot disease on sugarbeet. J. Plant Protect. Res. 2016, 56, 6–14. [Google Scholar] [CrossRef]
Genus | Primer Pair | Sequence 5′-3′ | Product Size | Gene | AT * | Ref. |
---|---|---|---|---|---|---|
Bacillus cereus group | BCFomp1 | ATCGCCTCGTTGGATGACGA | 575 pb | motB | 55 °C | [33] |
BCRomp1 | CTGCATATCCTACCGCAGCTA | |||||
Bacillus subtilis group | gyrA-f | CAGTCAGGAAATGCGTACGTCCTT | 1024 pb | gyrA | 54 °C | [34] |
gyrA-r | CAAGGTAATGCTCCAGGCATTGCT | |||||
Pseudomonas sp. | Pseudomonas_F | CTACGGGAGGCAGCAGTGG | 150 pb | 16S rRNA | 62 °C | [35] |
Pseudomonas_R | TCGGTAACGTCAAAACAGCAAAGT | |||||
Xanthomonas campestris pv. campestris | DLH 120 | CCGTAGCACTTAGTGCAATG | 618 pb | hrpF | 63 °C | [36] |
DLH 125 | GCATTTCCATCGGTCACGATTG |
Before Storage | After Storage | |
---|---|---|
Xcc inoculated | 5 | 7 |
Non-inoculated | 1 | 3 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ragasová, L.; Peňázová, E.; Gazdík, F.; Pečenka, J.; Čechová, J.; Pokluda, R.; Baránek, M.; Grzebelus, D.; Eichmeier, A. The Change of Bacterial Spectrum after Storage of X. campestris pv. campestris Inoculated Cabbage Heads (Brassica oleracea var. capitata L.). Agronomy 2020, 10, 443. https://doi.org/10.3390/agronomy10030443
Ragasová L, Peňázová E, Gazdík F, Pečenka J, Čechová J, Pokluda R, Baránek M, Grzebelus D, Eichmeier A. The Change of Bacterial Spectrum after Storage of X. campestris pv. campestris Inoculated Cabbage Heads (Brassica oleracea var. capitata L.). Agronomy. 2020; 10(3):443. https://doi.org/10.3390/agronomy10030443
Chicago/Turabian StyleRagasová, Lucia, Eliška Peňázová, Filip Gazdík, Jakub Pečenka, Jana Čechová, Robert Pokluda, Miroslav Baránek, Dariusz Grzebelus, and Aleš Eichmeier. 2020. "The Change of Bacterial Spectrum after Storage of X. campestris pv. campestris Inoculated Cabbage Heads (Brassica oleracea var. capitata L.)" Agronomy 10, no. 3: 443. https://doi.org/10.3390/agronomy10030443