Hormone Profiles and Antioxidant Activity of Cultivated and Wild Tomato Seedlings under Low-Temperature Stress
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material and Temperature Treatments
2.2. Hormone Analysis
2.3. RNA Extraction and Real-Time PCR Analysis
2.4. Lipid Peroxidation Analysis and the Membrane Stability Index (MSI)
2.5. Catalase and Glutathione Peroxidase Activities
2.6. Statistical Analyses
3. Results
3.1. Effects of Low Temperature on Endogenous Hormones
3.2. Effects of Low Temperature on Gene Expression
3.3. Effects of Low Temperature on Lipid Peroxidation and the Membrane Stability Index
3.4. Effects of Low Temperature on Antioxidant Activities
4. Discussion
4.1. CKs Are Responsive to Low-Temperature Stress
4.2. ABA Regulates Cold Responses in Tomato Seedlings
4.3. Effects of Low-Temperature Stress on IAA Content
4.4. Effects of Low-Temperature Stress on GA Content
4.5. Interactions between Hormones in Response to Low-Temperature Stress
4.6. Effects of Low Temperature on Lipid Peroxidation and Antioxidant Activity
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Liu, H.; Ouyang, B.; Zhang, J.; Wang, T.; Li, H.; Zhang, Y.; Yu, C.; Ye, Z. Differential modulation of photosynthesis, signaling, and transcriptional regulation between tolerant and sensitive tomato genotypes under cold stress. PLoS ONE 2012, 7, e50785. [Google Scholar] [CrossRef] [PubMed]
- Miura, K.; Furumoto, T. Cold signaling and cold response in plants. Int. J. Mol. Sci. 2013, 14, 5312–5337. [Google Scholar] [CrossRef] [Green Version]
- Ahmadizadeh, M.; Heidari, P. Bioinformatics study of transcription factors involved in cold stress. Biharean Biol. 2014, 8, 83–86. [Google Scholar]
- Venema, J.H.; Linger, P.; Van Heusden, A.W.; Van Hasselt, P.R.; Brüggemann, W. The inheritance of chilling tolerance in tomato (Lycopersicon spp.). Plant Biol. 2005, 7, 118–130. [Google Scholar] [CrossRef]
- Sevillano, L.; Sanchez-Ballesta, M.T.; Romojaro, F.; Flores, F.B. Physiological, hormonal and molecular mechanisms regulating chilling injury in horticultural species. Postharvest technologies applied to reduce its impact. J. Sci. Food Agric. 2009, 89, 555–573. [Google Scholar] [CrossRef]
- Lado, J.; Manzi, M.; Sainz, M.M.; Sotelo, M.; Zacarías, L. Involvement of plant hormones in cold stress tolerance. In Plant Hormones under Challenging Environmental Factors; Springer: Dordrecht, The Netherlands, 2016; pp. 23–49. [Google Scholar]
- Musavizadeh, Z.; Najafi-zarrini, H.; Kazemitabar, S.K.; Hashemi, S.H. Genome-Wide Analysis of Potassium Channel Genes in Rice: Expression of the OsAKT and OsKAT Genes under Salt Stress. Genes 2021, 12, 784. [Google Scholar] [CrossRef] [PubMed]
- Faraji, S.; Ahmadizadeh, M.; Heidari, P. Genome-wide comparative analysis of Mg transporter gene family between Triticum turgidum and Camelina sativa. BioMetals 2021, 34, 639–660. [Google Scholar] [CrossRef] [PubMed]
- Heidari, P.; Faraji, S.; Ahmadizadeh, M.; Ahmar, S.; Mora-Poblete, F. New insights into structure and function of TIFY genes in Zea mays and Solanum lycopersicum: A genome-wide comprehensive analysis. Front. Genet. 2021, 12, 534. [Google Scholar] [CrossRef]
- Park, S.; Lee, C.; Doherty, C.J.; Gilmour, S.J.; Kim, Y.; Thomashow, M.F. Regulation of the Arabidopsis CBF regulon by a complex low-temperature regulatory network. Plant J. 2015, 82, 193–207. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, B.; Henderson, D.A.; Zhu, J.-K. The Arabidopsis cold-responsive transcriptome and its regulation by ICE1. Plant Cell 2005, 17, 3155–3175. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Heidari, P. Comparative analysis of C-repeat binding factors (CBFs) in tomato and Arabidopsis. Braz. Arch. Biol. Technol. 2019, 62, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Faraji, S.; Filiz, E.; Kazemitabar, S.K.; Vannozzi, A.; Palumbo, F.; Barcaccia, G.; Heidari, P. The AP2/ERF Gene Family in Triticum durum: Genome-Wide Identification and Expression Analysis under Drought and Salinity Stresses. Genes 2020, 11, 1464. [Google Scholar] [CrossRef] [PubMed]
- Chinnusamy, V.; Ohta, M.; Kanrar, S.; Lee, B.; Hong, X.; Agarwal, M.; Zhu, J.-K. ICE1: A regulator of cold-induced transcriptome and freezing tolerance in Arabidopsis. Genes Dev. 2003, 17, 1043–1054. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Fowler, S.G.; Cheng, H.; Lou, Y.; Rhee, S.Y.; Stockinger, E.J.; Thomashow, M.F. Freezing-sensitive tomato has a functional CBF cold response pathway, but a CBF regulon that differs from that of freezing-tolerant Arabidopsis. Plant J. 2004, 39, 905–919. [Google Scholar] [CrossRef] [PubMed]
- Tognetti, V.B.; Mühlenbock, P.E.R.; Van Breusegem, F. Stress homeostasis–the redox and auxin perspective. Plant. Cell Environ. 2012, 35, 321–333. [Google Scholar] [CrossRef]
- Rezaee, S.; Ahmadizadeh, M.; Heidari, P. Genome-wide characterization, expression profiling, and post- transcriptional study of GASA gene family. Gene Rep. 2020, 20, 100795. [Google Scholar] [CrossRef]
- Llanes, A.; Andrade, A.; Masciarelli, O.; Alemano, S.; Luna, V. Drought and salinity alter endogenous hormonal profiles at the seed germination phase. Seed Sci. Res. 2016, 26, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Peleg, Z.; Blumwald, E. Hormone balance and abiotic stress tolerance in crop plants. Curr. Opin. Plant Biol. 2011, 14, 290–295. [Google Scholar] [CrossRef]
- Ahmadizadeh, M.; Chen, J.-T.; Hasanzadeh, S.; Ahmar, S.; Heidari, P. Insights into the genes involved in the ethylene biosynthesis pathway in Arabidopsis thaliana and Oryza sativa. J. Genet. Eng. Biotechnol. 2020, 18, 1–20. [Google Scholar] [CrossRef]
- Heidari, P.; Entazari, M.; Ebrahimi, A.; Ahmadizadeh, M.; Vannozzi, A.; Palumbo, F.; Barcaccia, G. Exogenous EBR Ameliorates Endogenous Hormone Contents in Tomato Species under Low-Temperature Stress. Horticulturae 2021, 7, 84. [Google Scholar] [CrossRef]
- Xue-Xuan, X.; Hong-Bo, S.; Yuan-Yuan, M.; Gang, X.; Jun-Na, S.; Dong-Gang, G.; Cheng-Jiang, R. Biotechnological implications from abscisic acid (ABA) roles in cold stress and leaf senescence as an important signal for improving plant sustainable survival under abiotic-stressed conditions. Crit. Rev. Biotechnol. 2010, 30, 222–230. [Google Scholar] [CrossRef]
- Ku, Y.-S.; Sintaha, M.; Cheung, M.-Y.; Lam, H.-M. Plant hormone signaling crosstalks between biotic and abiotic stress responses. Int. J. Mol. Sci. 2018, 19, 3206. [Google Scholar] [CrossRef] [Green Version]
- Edel, K.H.; Kudla, J. Integration of calcium and ABA signaling. Curr. Opin. Plant Biol. 2016, 33, 83–91. [Google Scholar] [CrossRef] [PubMed]
- Dar, T.A.; Uddin, M.; Khan, M.M.A.; Hakeem, K.R.; Jaleel, H. Jasmonates counter plant stress: A review. Environ. Exp. Bot. 2015, 115, 49–57. [Google Scholar] [CrossRef]
- Kazan, K. Diverse roles of jasmonates and ethylene in abiotic stress tolerance. Trends Plant Sci. 2015, 20, 219–229. [Google Scholar] [CrossRef] [PubMed]
- Dong, C.-J.; Li, L.; Shang, Q.-M.; Liu, X.-Y.; Zhang, Z.-G. Endogenous salicylic acid accumulation is required for chilling tolerance in cucumber (Cucumis sativus L.) seedlings. Planta 2014, 240, 687–700. [Google Scholar] [CrossRef]
- Shi, Y.; Tian, S.; Hou, L.; Huang, X.; Zhang, X.; Guo, H.; Yang, S. Ethylene signaling negatively regulates freezing tolerance by repressing expression of CBF and type-A ARR genes in Arabidopsis. Plant Cell 2012, 24, 2578–2595. [Google Scholar] [CrossRef] [Green Version]
- Hu, Y.; Jiang, L.; Wang, F.; Yu, D. Jasmonate regulates the inducer of CBF expression–c-repeat binding factor/DRE binding factor1 cascade and freezing tolerance in Arabidopsis. Plant Cell 2013, 25, 2907–2924. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shibasaki, K.; Uemura, M.; Tsurumi, S.; Rahman, A. Auxin response in Arabidopsis under cold stress: Underlying molecular mechanisms. Plant Cell 2009, 21, 3823–3838. [Google Scholar] [CrossRef] [Green Version]
- Kurepin, L.V.; Dahal, K.P.; Savitch, L.V.; Singh, J.; Bode, R.; Ivanov, A.G.; Hurry, V.; Huener, N. Role of CBFs as integrators of chloroplast redox, phytochrome and plant hormone signaling during cold acclimation. Int. J. Mol. Sci. 2013, 14, 12729–12763. [Google Scholar] [CrossRef] [PubMed]
- Achard, P.; Gong, F.; Cheminant, S.; Alioua, M.; Hedden, P.; Genschik, P. The cold-inducible CBF1 factor–dependent signaling pathway modulates the accumulation of the growth-repressing DELLA proteins via its effect on gibberellin metabolism. Plant Cell 2008, 20, 2117–2129. [Google Scholar] [CrossRef] [Green Version]
- Bloom, A.J.; Zwieniecki, M.A.; Passioura, J.B.; Randall, L.B.; Holbrook, N.M.; St. Clair, D.A. Water relations under root chilling in a sensitive and tolerant tomato species. Plant. Cell Environ. 2004, 27, 971–979. [Google Scholar] [CrossRef]
- Chen, H.; Chen, X.; Chen, D.; Li, J.; Zhang, Y.; Wang, A. A comparison of the low temperature transcriptomes of two tomato genotypes that differ in freezing tolerance: Solanum lycopersicum and Solanum habrochaites. BMC Plant Biol. 2015, 15, 132. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, J.; Guan, P.; Gu, J.; Yang, X.; Wang, F.; Qi, M.; Li, T.; Liu, Y. Exogenous DA-6 improves the low night temperature tolerance of tomato through regulating cytokinin. Front. Plant Sci. 2020, 11, 2290. [Google Scholar]
- Wang, F.; Chen, X.; Dong, S.; Jiang, X.; Wang, L.; Yu, J.; Zhou, Y. Crosstalk of PIF4 and DELLA modulates CBF transcript and hormone homeostasis in cold response in tomato. Plant Biotechnol. J. 2020, 18, 1041–1055. [Google Scholar] [CrossRef]
- Zhou, R.; Yu, X.; Zhao, T.; Ottosen, C.-O.; Rosenqvist, E.; Wu, Z. Physiological analysis and transcriptome sequencing reveal the effects of combined cold and drought on tomato leaf. BMC Plant Biol. 2019, 19, 377. [Google Scholar] [CrossRef] [PubMed]
- Li, X.-J.; Yang, M.-F.; Chen, H.; Qu, L.-Q.; Chen, F.; Shen, S.-H. Abscisic acid pretreatment enhances salt tolerance of rice seedlings: Proteomic evidence. Biochim. Biophys. Acta (BBA) Proteins Proteom. 2010, 1804, 929–940. [Google Scholar] [CrossRef]
- Tang, Y.; Wang, L.; Ma, C.; Liu, J.; Liu, B.; Li, H. The use of HPLC in determination of endogenous hormones in anthers of bitter melon. J. Life Sci. 2011, 5, 139–142. [Google Scholar]
- Heidari, P.; Mazloomi, F.; Nussbaumer, T.; Barcaccia, G. Insights into the SAM Synthetase Gene Family and Its Roles in Tomato Seedlings under Abiotic Stresses and Hormone Treatments. Plants 2020, 9, 586. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Campos, P.S.; nia Quartin, V.; chicho Ramalho, J.; Nunes, M.A. Electrolyte leakage and lipid degradation account for cold sensitivity in leaves of Coffea sp. plants. J. Plant Physiol. 2003, 160, 283–292. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sairam, R.K.; Deshmukh, P.S.; Shukla, D.S. Tolerance of drought and temperature stress in relation to increased antioxidant enzyme activity in wheat. J. Agron. Crop Sci. 1997, 178, 171–178. [Google Scholar] [CrossRef]
- Aebi, H. Catalase in vitro. Methods Enzymol. 1984, 105, 121–126. [Google Scholar] [PubMed]
- Elia, A.C.; Galarini, R.; Taticchi, M.I.; Dörr, A.J.M.; Mantilacci, L. Antioxidant responses and bioaccumulation in Ictalurus melas under mercury exposure. Ecotoxicol. Environ. Saf. 2003, 55, 162–167. [Google Scholar] [CrossRef]
- Nakashima, K.; Yamaguchi-Shinozaki, K. ABA signaling in stress-response and seed development. Plant Cell Rep. 2013, 32, 959–970. [Google Scholar] [CrossRef] [PubMed]
- Eremina, M.; Rozhon, W.; Poppenberger, B. Hormonal control of cold stress responses in plants. Cell. Mol. Life Sci. 2016, 73, 797–810. [Google Scholar] [CrossRef]
- Li, S.; An, Y.; Hailati, S.; Zhang, J.; Cao, Y.; Liu, Y.; Geng, J.; Hu, T.; Yang, P. Overexpression of the cytokinin oxidase/dehydrogenase (CKX) from Medicago sativa enhanced salt stress tolerance of Arabidopsis. J. Plant Biol. 2019, 62, 374–386. [Google Scholar] [CrossRef]
- Banerjee, A.; Roychoudhury, A. The regulatory signaling of gibberellin metabolism and its crosstalk with phytohormones in response to plant abiotic stresses. In Plant Signaling Molecules; Woodhead Publishing (Elsevier): Cambridge, UK, 2019; pp. 333–339. [Google Scholar]
- Shah, S.H.; Ali, S.; Jan, S.A.; Ali, G.M. Piercing and incubation method of in planta transformation producing stable transgenic plants by overexpressing DREB1A gene in tomato (Solanum lycopersicum Mill.). Plant Cell Tissue Organ Cult. 2015, 120, 1139–1157. [Google Scholar] [CrossRef]
- Zwack, P.J.; Rashotte, A.M. Interactions between cytokinin signalling and abiotic stress responses. J. Exp. Bot. 2015, 66, 4863–4871. [Google Scholar] [CrossRef] [Green Version]
- Pospisilova, J.; Vagner, M.; Malbeck, J.; Travnickova, A.; Batkova, P. Interactions between abscisic acid and cytokinins during water stress and subsequent rehydration. Biol. Plant. 2005, 49, 533–540. [Google Scholar] [CrossRef]
- Alvarez, S.; Marsh, E.L.; Schroeder, S.G.; Schachtman, D.P. Metabolomic and proteomic changes in the xylem sap of maize under drought. Plant. Cell Environ. 2008, 31, 325–340. [Google Scholar] [CrossRef]
- Caers, M.; Rudelsheim, P.; Van Onckelen, H.; Horemans, S. Effect of heat stress on photosynthetic activity and chloroplast ultrastructure in correlation with endogenous cytokinin concentration in maize seedlings. Plant cell Physiol. 1985, 26, 47–52. [Google Scholar]
- Kudoyarova, G.R.; Vysotskaya, L.B.; Cherkozyanova, A.; Dodd, I.C. Effect of partial rootzone drying on the concentration of zeatin-type cytokinins in tomato (Solanum lycopersicum L.) xylem sap and leaves. J. Exp. Bot. 2007, 58, 161–168. [Google Scholar] [CrossRef] [PubMed]
- Albacete, A.; Ghanem, M.E.; Martínez-Andújar, C.; Acosta, M.; Sánchez-Bravo, J.; Martínez, V.; Lutts, S.; Dodd, I.C.; Pérez-Alfocea, F. Hormonal changes in relation to biomass partitioning and shoot growth impairment in salinized tomato (Solanum lycopersicum L.) plants. J. Exp. Bot. 2008, 59, 4119–4131. [Google Scholar] [CrossRef]
- Jeon, J.; Kim, N.Y.; Kim, S.; Kang, N.Y.; Novák, O.; Ku, S.-J.; Cho, C.; Lee, D.J.; Lee, E.-J.; Strnad, M. A subset of cytokinin two-component signaling system plays a role in cold temperature stress response in Arabidopsis. J. Biol. Chem. 2010, 285, 23371–23386. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nishiyama, R.; Watanabe, Y.; Fujita, Y.; Le, D.T.; Kojima, M.; Werner, T.; Vankova, R.; Yamaguchi-Shinozaki, K.; Shinozaki, K.; Kakimoto, T. Analysis of cytokinin mutants and regulation of cytokinin metabolic genes reveals important regulatory roles of cytokinins in drought, salt and abscisic acid responses, and abscisic acid biosynthesis. Plant Cell 2011, 23, 2169–2183. [Google Scholar] [CrossRef] [Green Version]
- Macková, H.; Hronková, M.; Dobrá, J.; Turečková, V.; Novák, O.; Lubovská, Z.; Motyka, V.; Haisel, D.; Hájek, T.; Prášil, I.T. Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression. J. Exp. Bot. 2013, 64, 2805–2815. [Google Scholar] [CrossRef] [PubMed]
- Prerostova, S.; Dobrev, P.I.; Gaudinova, A.; Knirsch, V.; Körber, N.; Pieruschka, R.; Fiorani, F.; Brzobohatý, B.; Spichal, L.; Humplik, J. Cytokinins: Their impact on molecular and growth responses to drought stress and recovery in Arabidopsis. Front. Plant Sci. 2018, 9, 655. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ha, S.; Vankova, R.; Yamaguchi-Shinozaki, K.; Shinozaki, K.; Tran, L.-S.P. Cytokinins: Metabolism and function in plant adaptation to environmental stresses. Trends Plant Sci. 2012, 17, 172–179. [Google Scholar] [CrossRef] [PubMed]
- Fernando, V.C.D.; Schroeder, D.F. Role of ABA in Arabidopsis salt, drought, and desiccation tolerance. In Abiotic and Biotic Stress in Plants-Recent Advances and Future Perspectives; IntechOpen: London, UK, 2016; Chapter 22. [Google Scholar]
- Huang, X.; Shi, H.; Hu, Z.; Liu, A.; Amombo, E.; Chen, L.; Fu, J. ABA is involved in regulation of cold stress response in bermudagrass. Front. Plant Sci. 2017, 8, 1613. [Google Scholar] [CrossRef] [Green Version]
- Huang, X.; Chen, M.-H.; Yang, L.-T.; Li, Y.-R.; Wu, J.-M. Effects of exogenous abscisic acid on cell membrane and endogenous hormone contents in leaves of sugarcane seedlings under cold stress. Sugar Tech 2015, 17, 59–64. [Google Scholar] [CrossRef]
- Shinozaki, K.; Yamaguchi-Shinozaki, K. Molecular responses to dehydration and low temperature: Differences and cross-talk between two stress signaling pathways. Curr. Opin. Plant Biol. 2000, 3, 217–223. [Google Scholar] [CrossRef]
- Nakashima, K.; Yamaguchi-Shinozaki, K.; Shinozaki, K. The transcriptional regulatory network in the drought response and its crosstalk in abiotic stress responses including drought, cold, and heat. Front. Plant Sci. 2014, 5, 170. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mustilli, A.-C.; Merlot, S.; Vavasseur, A.; Fenzi, F.; Giraudat, J. Arabidopsis OST1 protein kinase mediates the regulation of stomatal aperture by abscisic acid and acts upstream of reactive oxygen species production. Plant Cell 2002, 14, 3089–3099. [Google Scholar] [CrossRef] [Green Version]
- Emamverdian, A.; Ding, Y.; Mokhberdoran, F.; Xie, Y. Heavy metal stress and some mechanisms of plant defense response. Sci. World J. 2015, 2015, 756120. [Google Scholar] [CrossRef]
- Du, H.; Liu, H.; Xiong, L. Endogenous auxin and jasmonic acid levels are differentially modulated by abiotic stresses in rice. Front. Plant Sci. 2013, 4, 397. [Google Scholar] [CrossRef] [Green Version]
- Kumar, R.; Agarwal, P.; Pareek, A.; Tyagi, A.K.; Sharma, A.K. Genomic survey, gene expression, and interaction analysis suggest diverse roles of ARF and Aux/IAA proteins in Solanaceae. Plant Mol. Biol. Rep. 2015, 33, 1552–1572. [Google Scholar] [CrossRef]
- Shani, E.; Salehin, M.; Zhang, Y.; Sanchez, S.E.; Doherty, C.; Wang, R.; Mangado, C.C.; Song, L.; Tal, I.; Pisanty, O. Plant stress tolerance requires auxin-sensitive Aux/IAA transcriptional repressors. Curr. Biol. 2017, 27, 437–444. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dharmasiri, N.; Dharmasiri, S.; Estelle, M. The F-box protein TIR1 is an auxin receptor. Nature 2005, 435, 441–445. [Google Scholar] [CrossRef] [PubMed]
- Zhou, M.; Xu, M.; Wu, L.; Shen, C.; Ma, H.; Lin, J. CbCBF from Capsella bursa-pastoris enhances cold tolerance and restrains growth in Nicotiana tabacum by antagonizing with gibberellin and affecting cell cycle signaling. Plant Mol. Biol. 2014, 85, 259–275. [Google Scholar] [CrossRef]
- Shan, D.; Huang, J.; Yang, Y.; Guo, Y.; Wu, C.; Yang, G.; Gao, Z.; Zheng, C. Cotton GhDREB1 increases plant tolerance to low temperature and is negatively regulated by gibberellic acid. New Phytol. 2007, 176, 70–81. [Google Scholar] [CrossRef] [PubMed]
- Alonso-Ramírez, A.; Rodríguez, D.; Reyes, D.; Jiménez, J.A.; Nicolás, G.; López-Climent, M.; Gómez-Cadenas, A.; Nicolás, C. Evidence for a role of gibberellins in salicylic acid-modulated early plant responses to abiotic stress in Arabidopsis seeds. Plant Physiol. 2009, 150, 1335–1344. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lantzouni, O.; Alkofer, A.; Falter-Braun, P.; Schwechheimer, C. GROWTH-REGULATING FACTORS interact with DELLAs and regulate growth in cold stress. Plant Cell 2020, 32, 1018–1034. [Google Scholar] [CrossRef]
- Wang, L.; Mu, C.; Du, M.; Chen, Y.; Tian, X.; Zhang, M.; Li, Z. The effect of mepiquat chloride on elongation of cotton (Gossypium hirsutum L.) internode is associated with low concentration of gibberellic acid. Plant Sci. 2014, 225, 15–23. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Cheng, H.; King, K.E.; Wang, W.; He, Y.; Hussain, A.; Lo, J.; Harberd, N.P.; Peng, J. Gibberellin regulates Arabidopsis seed germination via RGL2, a GAI/RGA-like gene whose expression is up-regulated following imbibition. Genes Dev. 2002, 16, 646–658. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- O’Brien, J.A.; Benková, E. Cytokinin cross-talking during biotic and abiotic stress responses. Front. Plant Sci. 2013, 4, 451. [Google Scholar] [CrossRef] [Green Version]
- Kosová, K.; Prášil, I.T.; Vítámvás, P.; Dobrev, P.; Motyka, V.; Floková, K.; Novák, O.; Turečková, V.; Rolčik, J.; Pešek, B. Complex phytohormone responses during the cold acclimation of two wheat cultivars differing in cold tolerance, winter Samanta and spring Sandra. J. Plant Physiol. 2012, 169, 567–576. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.; Ding, Y.; Yang, S. Cold signal transduction and its interplay with phytohormones during cold acclimation. Plant Cell Physiol. 2015, 56, 7–15. [Google Scholar] [CrossRef]
- Lee, H.G.; Seo, P.J. The MYB 96–HHP module integrates cold and abscisic acid signaling to activate the CBF–COR pathway in Arabidopsis. Plant J. 2015, 82, 962–977. [Google Scholar] [CrossRef]
- Wang, D.-Z.; Jin, Y.-N.; Ding, X.-H.; Wang, W.-J.; Zhai, S.-S.; Bai, L.-P.; Guo, Z.-F. Gene regulation and signal transduction in the ICE–CBF–COR signaling pathway during cold stress in plants. Biochemistry 2017, 82, 1103–1117. [Google Scholar] [CrossRef]
- Wang, L.; Hua, D.; He, J.; Duan, Y.; Chen, Z.; Hong, X.; Gong, Z. Auxin Response Factor2 (ARF2) and its regulated homeodomain gene HB33 mediate abscisic acid response in Arabidopsis. PLoS Genet. 2011, 7, e1002172. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tanaka, Y.; Sano, T.; Tamaoki, M.; Nakajima, N.; Kondo, N.; Hasezawa, S. Cytokinin and auxin inhibit abscisic acid-induced stomatal closure by enhancing ethylene production in Arabidopsis. J. Exp. Bot. 2006, 57, 2259–2266. [Google Scholar] [CrossRef]
- İşeri, Ö.D.; Körpe, D.A.; Sahin, F.I.; Haberal, M. Hydrogen peroxide pretreatment of roots enhanced oxidative stress response of tomato under cold stress. Acta Physiol. Plant. 2013, 35, 1905–1913. [Google Scholar] [CrossRef]
- Öktem, H.A.; Eyidoðan, F.; Demirba, D.; Bayraç, A.T.; Öz, M.T.; Özgür, E.; Selçuk, F.; Yücel, M. Antioxidant responses of lentil to cold and drought stress. J. Plant Biochem. Biotechnol. 2008, 17, 15–21. [Google Scholar] [CrossRef]
- Kamran, M.; Parveen, A.; Ahmar, S.; Malik, Z.; Hussain, S.; Chattha, M.S.; Saleem, M.H.; Adil, M.; Heidari, P.; Chen, J.-T. An Overview of Hazardous Impacts of Soil Salinity in Crops, Tolerance Mechanisms, and Amelioration through Selenium Supplementation. Int. J. Mol. Sci. 2020, 21, 148. [Google Scholar] [CrossRef] [Green Version]
- Park, E.-J.; Jeknic, Z.; Chen, T.H.H. Exogenous application of glycinebetaine increases chilling tolerance in tomato plants. Plant Cell Physiol. 2006, 47, 706–714. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ntatsi, G.; Savvas, D.; Ntatsi, G.; Kläring, H.P.; Schwarz, D. Growth, yield, and metabolic responses of temperature-stressed tomato to grafting onto rootstocks differing in cold tolerance. J. Am. Soc. Hortic. Sci. 2014, 139, 230–243. [Google Scholar] [CrossRef] [Green Version]
- Munir, S.; Liu, H.; Xing, Y.; Hussain, S.; Ouyang, B.; Zhang, Y.; Li, H.; Ye, Z. Overexpression of calmodulin-like (ShCML44) stress-responsive gene from Solanum habrochaites enhances tolerance to multiple abiotic stresses. Sci. Rep. 2016, 6, 31772. [Google Scholar] [CrossRef] [PubMed]
- Guan, L.M.; Zhao, J.; Scandalios, J.G. Cis-elements and trans-factors that regulate expression of the maize Cat1 antioxidant gene in response to ABA and osmotic stress: H2O2 is the likely intermediary signaling molecule for the response. Plant J. 2000, 22, 87–95. [Google Scholar] [CrossRef]
- Aydin, S.S.; Büyük, I.; Aras, S. Relationships among lipid peroxidation, SOD enzyme activity, and SOD gene expression profile in Lycopersicum esculentum L. exposed to cold stress. Genet. Mol. Res 2013, 12, 3220–3229. [Google Scholar] [CrossRef]
- Berwal, M.K.; Ram, C. Superoxide Dismutase: A stable biochemical marker for abiotic stress tolerance in higher plants. In Abiotic and Biotic Stress in Plants; IntechOpen: London, UK, 2018; pp. 1–10. [Google Scholar]
Gene Name | Gene ID | Primer (5′-3′) | Product Size (bp) |
---|---|---|---|
CKX6 | Solyc04g016430 | F: TTCCATTAGGGGACAAGCCA | 229 |
R: ACCACCAACGGTAAGGTACA | |||
DELLA-like | Solyc10g086380 | F: ATGGCCAGCACTTTTACAGG | 70 |
R: AATTCCTGTGAGCCGAAGAG | |||
CAT1 | Solyc12g094620 | F: CCTCTAAGTATCGCCCATCAAG | 100 |
R: GGTCCAACAGTCAAGGAAGAA | |||
SOD | Solyc11g066390 | F: AGGGCAACTCTAATGTTGAGG | 94 |
R: CCAGGAGCAAGTCCAGTTATAC | |||
ICE1 | Solyc03g118310 | F: ATGGAGGAACTGGTTCTTGG | 139 |
R: TCCACACCTCCATCATCAAC | |||
CBF1 | Solyc03g026280 | F: CCTGCTTCCTCCAACTCTAAA | 135 |
R: CTCATCCACGAAGTCACTACTC | |||
EF-1-α | Solyc06g005060 | F: GGAACTTGAGAAGGAGCCTAAG | 158 |
R: CAACACCAACAGCAACAGTCT |
GA3 | ZT | ABA | IAA | |
---|---|---|---|---|
GA3 | −0.45 | −0.62 | 0.74 | |
ZT | 0.85 | 0.91 | −0.83 | |
ABA | −0.79 | −0.73 | −0.77 | |
IAA | 0.87 | 0.75 | −0.98 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Heidari, P.; Reza Amerian, M.; Barcaccia, G. Hormone Profiles and Antioxidant Activity of Cultivated and Wild Tomato Seedlings under Low-Temperature Stress. Agronomy 2021, 11, 1146. https://doi.org/10.3390/agronomy11061146
Heidari P, Reza Amerian M, Barcaccia G. Hormone Profiles and Antioxidant Activity of Cultivated and Wild Tomato Seedlings under Low-Temperature Stress. Agronomy. 2021; 11(6):1146. https://doi.org/10.3390/agronomy11061146
Chicago/Turabian StyleHeidari, Parviz, Mohammad Reza Amerian, and Gianni Barcaccia. 2021. "Hormone Profiles and Antioxidant Activity of Cultivated and Wild Tomato Seedlings under Low-Temperature Stress" Agronomy 11, no. 6: 1146. https://doi.org/10.3390/agronomy11061146