Characterization of flo4-6, a Novel cyOsPPDKB Allele Conferring Floury Endosperm Characteristics Suitable for Dry-Milled Rice Flour Production
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Evaluation of Agronomic Traits and Grain/Flour Physicochemical Properties
2.3. Genetic Analyses, Sequencing, and Molecular Marker Development
3. Results
3.1. Major Agronomic Traits of SK-flo3
3.2. Identification of the Causal Mutation for the Floury Endosperm of SK-flo3
3.3. Dry Milling Properties of SK-flo3
4. Discussion
5. Patents
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Fukagawa, N.K.; Ziska, L.H. Rice: Importance for Global Nutrition. J. Nutr. Sci. Vitam. 2019, 65, S2–S3. [Google Scholar] [CrossRef] [PubMed]
- Pingali, P. Westernization of Asian Diets and the Transformation of Food Systems: Implications for Research and Policy. Food Policy 2007, 32, 281–298. [Google Scholar] [CrossRef]
- KOSTAT. The 2021 Results of Grain Consumption Survey. 2021. Available online: http://kostat.go.kr/portal/korea/kor_nw/1/4/8/index.board (accessed on 24 December 2022).
- Kim, M.H. Review on Rice Flour Manufacturing and Utilization. J. Biosyst. Eng. 2013, 38, 103–112. [Google Scholar] [CrossRef]
- Jeong, O.Y.; Park, H.S.; Baek, M.K.; Kim, W.J.; Lee, G.M.; Lee, C.M.; Bombay, M.; Ancheta, M.B.; Lee, J.H. Review of Rice in Korea: Current Status, Future Prospects, and Comparisons with Rice in Other Countries. J. Crop Sci. Biotechnol. 2021, 24, 1–11. [Google Scholar] [CrossRef]
- Chiang, P.-Y.; Yeh, A.-I. Effect of Soaking on Wet-Milling of Rice. J. Cereal Sci. 2002, 35, 85–94. [Google Scholar] [CrossRef]
- Mo, Y.; Jeung, J.-U. The Use of Floury Endosperm Mutants to Develop Rice Cultivars Suitable for Dry Milling. Plant Biotechnol. Rep. 2020, 14, 185–191. [Google Scholar] [CrossRef]
- Satoh, H.; Omura, T. New Endosperm Mutations Induced by Chemical Mutagens in Rice Oryza sativa L. Jpn. J. Breed. 1981, 31, 316–326. [Google Scholar] [CrossRef]
- Araki, E.; Ashida, K.; Aoki, N.; Takahashi, M.; Hamada, S. Characteristics of Rice Flour Suitable for the Production of Rice Flour Bread Containing Gluten and Methods of Reducing the Cost of Producing Rice Flour. Jpn. Agric. Res. Q. 2016, 50, 23–31. [Google Scholar] [CrossRef]
- Won, Y.-J.; Ahn, E.-K.; Jeong, E.-G.; Chang, J.-K.; Lee, J.-H.; Jung, K.-H.; Hyun, U.-J.; Cho, Y.-C.; Oh, S.-K.; Yoon, M.-R.; et al. An Opaque Endosperm Rice Cultivar, ‘Hangaru’, Suitable for Exclusive Dry-Milling Rice Flour Production. Korean J. Breed. Sci. 2019, 51, 134–139. [Google Scholar] [CrossRef]
- Cho, Y.; Baek, M.; Park, H.; Cho, J.; Ahn, E.; Suh, J.; Jeung, J. ‘Shingil (Milyang317)’, Tongil-Type Variety Specialized for Rice Flour. Korean J. Breed. Sci. 2020, 72, 58–72. [Google Scholar] [CrossRef]
- Mo, Y.; Jeung, J.-U.; Shin, Y.-S.; Park, C.S.; Kang, K.-H.; Kim, B.-K. Agronomic and Genetic Analysis of Suweon 542, a Rice Floury Mutant Line Suitable for Dry Milling. Rice 2013, 6, 37. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Mo, Y.; Im, D.E.; Jang, S.G.; Ham, T.H.; Lee, J.; Jeung, J.U.; Kwon, S.W. A New SNP in CyOsPPDK Gene is Associated with Floury Endosperm in Suweon 542. Mol. Genet. Genom. 2018, 293, 1151–1158. [Google Scholar] [CrossRef] [PubMed]
- Ha, S.K.; Kim, B.-K.; Hwang, W.-H.; Mo, Y.; Jeong, J.-M.; Lee, D.-K.; Kim, W.-J.; Kim, J.-J.; Jeong, J.-U. Early Maturing Rice Variety “Baromi2” with a Floury Endosperm and Suitable for Dry-Milling of Rice Grain. Korean J. Breed. Sci. 2022, 54, 433–441. [Google Scholar] [CrossRef]
- Ha, S.K.; Mo, Y.; Jeong, J.-M.; Lee, H.-S.; Kim, J.; Seo, W.-D.; Jeong, J.-U. Agronomic and End-Use Quality Analysis of “AromaT”, a Black Rice (Oryza sativa L.) Variety with Floury Endosperm. Korean J. Crop Sci. 2022, 67, 9–16. [Google Scholar] [CrossRef]
- Yang, H.; Wang, Y.; Tian, Y.; Teng, X.; Lv, Z.; Lei, J.; Duan, E.; Dong, H.; Yang, X.; Zhang, Y.; et al. Rice FLOURY ENDOSPERM22, Encoding a Pentatricopeptide Repeat Protein, Is Involved in Both Mitochondrial RNA Splicing and Editing and Is Crucial for Endosperm Development. J. Integr. Plant Biol. 2023, 65, 755–771. [Google Scholar] [CrossRef]
- Ryoo, N.; Yu, C.; Park, C.S.; Baik, M.Y.; Park, I.M.; Cho, M.H.; Bhoo, S.H.; An, G.; Hahn, T.R.; Jeon, J.S. Knockout of a Starch Synthase Gene OsSSIIIa/Flo5 Causes White-Core Floury Endosperm in Rice (Oryza satva L.). Plant Cell Rep. 2007, 26, 1083–1095. [Google Scholar] [CrossRef]
- Zhang, D.; Wu, J.; Zhang, Y.; Shi, C. Phenotypic and Candidate Gene Analysis of a New Floury Endosperm Mutant (Osagpl2-3) in Rice. Plant Mol. Biol. Report. 2012, 30, 1303–1312. [Google Scholar] [CrossRef]
- Long, W.; Dong, B.; Wang, Y.; Pan, P.; Wang, Y.; Liu, L.; Chen, X.; Liu, X.; Liu, S.; Tian, Y.; et al. FLOURY ENDOSPERM8, Encoding the UDP-Glucose Pyrophosphorylase 1, Affects the Synthesis and Structure of Starch in Rice Endosperm. J. Plant Biol. 2017, 60, 513–522. [Google Scholar] [CrossRef]
- You, X.; Zhang, W.; Hu, J.; Jing, R.; Cai, Y.; Feng, Z.; Kong, F.; Zhang, J.; Yan, H.; Chen, W.; et al. FLOURY ENDOSPERM15 Encodes a Glyoxalase I Involved in Compound Granule Formation and Starch Synthesis in Rice Endosperm. Plant Cell Rep. 2019, 38, 345–359. [Google Scholar] [CrossRef]
- RDA. Manual for Standard Evaluation Method in Agricultural Experiment and Research; RDA Press: Suweon, Republic of Korea, 2012; pp. 317–338. ISBN 978-8-948-01649-9. [Google Scholar]
- Neff, M.M.; Turk, E.; Kalishman, M. Web-Based Primer Design for Single Nucleotide Polymorphism Analysis. Trends Genet. 2002, 18, 613–615. [Google Scholar] [CrossRef]
- Kang, H.G.; Park, S.; Matsuoka, M.; An, G. White-Core Endosperm floury endosperm-4 in Rice Is Generated by Knockout Mutations in the C4-Type Pyruvate Orthophosphate Dikinase Gene (OsPPDKB). Plant J. 2005, 42, 901–911. [Google Scholar] [CrossRef]
- Wang, H.; Ham, T.H.; Im, D.E.; Lar, S.M.; Jang, S.G.; Lee, J.; Mo, Y.; Jeung, J.U.; Kim, S.T.; Kwon, S.W. A New SNP in Rice Gene Encoding Pyruvate Phosphate Dikinase (PPDK) Associated with Floury Endosperm. Genes 2020, 11, 465. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Zhao, L.; Lin, L.; Zhao, L.; Liu, Q.; Wei, C. A Novel Mutation of OsPPDKB, Encoding Pyruvate Orthophosphate Dikinase, Affects Metabolism and Structure of Starch in the Rice Endosperm. Int. J. Mol. Sci. 2018, 19, 2268. [Google Scholar] [CrossRef] [PubMed]
- Muroyama, R.; Ito, H.; Takahashi, S.; Kang, D.J.; Hamada, S. Biochemical Analysis of a Novel Allele of the OsPPDKB Gene Associated with Floury Endosperm. J. Cereal Sci. 2022, 107, 103529. [Google Scholar] [CrossRef]
- Matsuba, S.; Maruyama-Funatsuki, W.; Umemoto, T.; Kato, H.; Kuroki, M.; Yokogami, N.; Ikegaya, T.; Shimizu, H.; Iriki, N. The Induced Mutant Allele flo4-303 Confers Floury Characteristics on the Japonica Rice Cultivar ‘Hoshinoko’. Breed. Sci. 2022, 72, 383–388. [Google Scholar] [CrossRef] [PubMed]
- Jeong, J.-U.; Kim, B.-K.; Hwang, W.-H.; Mo, Y.; Jeong, J.-M.; Lee, D.-K.; Ha, S.K.; Kim, W.-J.; Kim, J.-J. New Rice Cultivar, Garumi1 and Garumi2 Suitable for Dry Milling. Korea Intellectual Property Rights Information Service. 2019. Available online: http://kpat.kipris.or.kr/kpat/biblioa.do?method=biblioFrame&link=Y&applno=1020200066078&pub_reg= (accessed on 7 February 2023).
- Ashida, K.; Iida, S.; Yasui, T. Morphological, Physical, and Chemical Properties of Grain and Flour from Chalky Rice Mutants. Cereal Chem. 2009, 86, 225–231. [Google Scholar] [CrossRef]
- Jeong, J.-U.; Shin, Y.-S. Evaluations on the Namil(SA)-Flo1, a Floury Japonica Rice Line, for Dry Milling Process to Produce Rice Flour. Korean J. Crop Sci. 2011, 56, 57–63. [Google Scholar] [CrossRef]
- Korea Seed & Variety Service. Available online: https://www.seed.go.kr/sites/seed_eng/index..do (accessed on 2 January 2023).
- Lee, S.K.; Jeon, J.S. Review: Crucial Role of Inorganic Pyrophosphate in Integrating Carbon Metabolism from Sucrose Breakdown to Starch Synthesis in Rice Endosperm. Plant Sci. 2020, 298, 110572. [Google Scholar] [CrossRef]
Trial | Location | Variety | HD (mm/dd) | CL (cm) | PL (cm) | TN (No.) | SN (No.) | TGW (g) | BRY (kg/10 a) | Yield Decrease (%) |
---|---|---|---|---|---|---|---|---|---|---|
PYT | Wanju | SK-flo3 | 8/14 | 76 ± 1.7 | 19 ± 0.7 | 15 ± 1.8 | 87 ± 20.6 * | 18.5 ± 0.62 * | 445 ± 24.0 * | –17.7 |
SK | 8/13 | 77 ± 2.1 | 20 ± 0.3 | 14 ± 2.9 | 101 ± 12.5 | 21.3 ± 0.52 | 541 ± 19.6 | |||
LAT | Suweon | SK-flo3 | 8/15 | 86 ± 5.1 | 19 ± 0.6 | 14 ± 1.3 | 119 ± 13.4 | 18.9 ± 0.56 ** | 591 ± 49.6 * | –13.0 |
SK | 8/16 | 88 ± 4.1 | 20 ± 1.6 | 15 ± 1.8 | 121 ± 13.8 | 21.9 ± 0.70 | 679 ± 66.3 | |||
Hwaseong | SK-flo3 | 8/16 | 80 ± 5.4 | 17 ± 1.3 * | 13 ± 1.5 | 94 ± 15.9 | 21.9 ± 2.66 | 491 ± 44.6 * | –17.5 | |
SK | 8/15 | 81 ± 3.5 | 19 ± 1.2 | 13 ± 0.9 | 109 ± 16.8 | 23.4 ± 0.77 | 595 ± 94.9 |
Primer Sequence (5′ to 3′) | Restriction Enzyme | Fragment Size |
---|---|---|
F: GATTTGAAACGTCTTGATCATGC R: AGCATGAACTTGGTCACCTTCTGTCTACAGCAATCTTTACAGTA | RsaI | SK-flo3: 218 bp (intact) |
SK: 175 bp and 43 bp (digested) |
Variety | Grain Hardness (kg) | Dry-Milled Rice Flour | |||||
---|---|---|---|---|---|---|---|
Mean Particle Size (μm) | Damaged Starch (%) | Amylose (%) | Protein (%) | Lightness (CIE Value) | Ash (%) | ||
SK-flo3 | 3.0 ± 0.34 a | 65.3 ± 0.86 a | 6.0 ± 0.09 a | 15.6 ± 0.55 a | 6.2 ± 0.06 a | 92.6 ± 1.82 a | 0.64 ± 0.01 a |
SK | 9.2 ± 0.82 b | 91.1 ± 0.73 b | 12.0 ± 0.13 b | 18.0 ± 1.08 b | 6.4 ± 0.10 a | 93.2 ± 1.49 a | 0.67 ± 0.01 a |
Baromi2 | 3.1 ± 0.33 a | 61.5 ± 1.36 a | 4.9 ± 0.02 c | 17.0 ± 1.33 b | 6.5 ± 0.45 a | 91.2 ± 0.03 a | 0.58 ± 0.01 a |
Mutant | Mutagen (Wild-Type) | Effect (Position z) | GW | AC | PC | LC | HD | PS | DS | Ref. |
---|---|---|---|---|---|---|---|---|---|---|
flo4-1 | T-DNA (Dongjin) | insertional (intron 3) | 6%↓ | 15%↓ | ~5%↑ y | ~30%↑ y | - | - | - | [17,23] |
flo4-2 | Tos17 (Hwayoung) | insertional (exon 8) | 7%↓ | 15%↓ | ~5%↑ y | ~35%↑ y | - | - | - | [17,23] |
flo4-3 | T-DNA (Hwayoung) | insertional (intron 3) | - | - | - | - | - | - | - | [23] |
flo4-4 [flo7(t)] | sodium azide (Namil) | Gly→Asp (exon 8) | 16%↓ | 5%↑ | 18%↓ | - | 56%↓ | 25%↓ | 47%↓ | [12,13] |
flo4-5 | sodium azide (Namil) | Ser→Phe (exon 2) | 11%↓ | = | 15%↓ | 107%↑ | 55%↓ | 21%↓ | 45%↓ | [24,31] |
M14 | gamma-ray (Kitaake) | Leu→Phe (exon 13) | 11%↓ | 13%↓ | = | - | - | - | - | [25] |
floTR1 | sodium azide (Tsugaruroman) | Gly→Asp (exon 17) | 11%↓ | 46%↓ | 16%↑ | - | - | 50%↓ x | 27%↓ | [26] |
flo4-303 | gamma-ray (Hoshinoyume) | frame-shift (exon 7) | 10%↓ | 14%↓ | - | - | - | 38%↓ x | 40%↓ | [27] |
flo4-6 | sodium azide (Samkwang) | Gly→Asp (exon 7) | 6–14%↓ | 13%↓ | = | - | 67%↓ | 28%↓ | 50%↓ | this study |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ha, S.-K.; Lee, H.-S.; Lee, S.Y.; Lee, C.-M.; Mo, Y.; Jeung, J.-U. Characterization of flo4-6, a Novel cyOsPPDKB Allele Conferring Floury Endosperm Characteristics Suitable for Dry-Milled Rice Flour Production. Agronomy 2023, 13, 1306. https://doi.org/10.3390/agronomy13051306
Ha S-K, Lee H-S, Lee SY, Lee C-M, Mo Y, Jeung J-U. Characterization of flo4-6, a Novel cyOsPPDKB Allele Conferring Floury Endosperm Characteristics Suitable for Dry-Milled Rice Flour Production. Agronomy. 2023; 13(5):1306. https://doi.org/10.3390/agronomy13051306
Chicago/Turabian StyleHa, Su-Kyung, Hyun-Sook Lee, Seung Young Lee, Chang-Min Lee, Youngjun Mo, and Ji-Ung Jeung. 2023. "Characterization of flo4-6, a Novel cyOsPPDKB Allele Conferring Floury Endosperm Characteristics Suitable for Dry-Milled Rice Flour Production" Agronomy 13, no. 5: 1306. https://doi.org/10.3390/agronomy13051306