A Novel Isolate of Bean Common Mosaic Virus Isolated from Crownvetch (Securigera varia L. Lassen)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Artificial Infection of Plants
2.3. Immunochemical Detection
2.4. LC-MS/MS Analysis
2.5. Sequencing Analyses
3. Results
3.1. BCMV in Crownvetch
3.2. LC-MS/MS Detection of Viral Proteins
3.3. Genomic Analysis
3.4. Amino Acid Analysis
3.5. Phylogenetic Comparison of BCMV SVK
3.6. Recombination Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- FAOSTAT. Available online: https://www.fao.org/faostat/en/#home (accessed on 7 March 2023).
- OECD. Common bean (Phaseolus vulgaris). In Safety Assessment of Transgenic Organisms in the Environment; Volume 6: OECD Consensus Documents; OECD Publishing: Paris, France, 2016. [Google Scholar] [CrossRef]
- Meziadi, C.; Blanchet, S.; Geffroy, V.; Pflieger, S. Genetic resistance against viruses in Phaseolus vulgaris L.: State of the art and future prospects. Plant Sci. 2017, 265, 39–50. [Google Scholar] [CrossRef] [PubMed]
- Jones, R.A.; Naidu, R.A. Global Dimensions of plant virus diseases: Current status and future perspectives. Annu. Rev. Virol. 2019, 6, 387–409. [Google Scholar] [CrossRef] [PubMed]
- Tang, M.; Feng, X. Bean common mosaic disease: Etiology, resistance resource, and future prospects. Agronomy 2023, 13, 58. [Google Scholar] [CrossRef]
- Drijfhout, E.; Silbernagel, M.J.; Burke, D.W. Differentiation of strains of bean common mosaic virus. Neth. J. Plant Pathol. 1978, 84, 13–26. [Google Scholar] [CrossRef]
- Feng, X.; Myers, J.R.; Karasev, A.V. Bean common mosaic virus Isolate Exhibits a Novel Pathogenicity Profile in Common Bean, Overcoming the bc-3 Resistance Allele Coding for the Mutated eIF4E Translation Initiation Factor. Phytopathology 2015, 105, 1487–1495. [Google Scholar] [CrossRef] [Green Version]
- Vetten, H.J.; Lesemann, D.-E.; Maiss, E. Serotype A and B strains of bean common mosaic virus are two distinct potyviruses. In Potyvirus Taxonomy, Archives of Virology; Barnett, O.W., Ed.; Springer: Vienna, Austria, 1992; Volume 5, pp. 415–431. [Google Scholar] [CrossRef]
- Mink, G.I.; Vetten, H.J.; Ward, C.W.; Berger, P.H.; Morales, F.J.; Myers, J.M.; Silbernagel, M.J.; Barnett, O.W. Taxonomy and classification of legume-infecting potyviruses. A proposal from the Potyviridae Study Group of the Plant Virus Subcommittee of ICTV. Arch. Virol. 1994, 139, 231–235. [Google Scholar] [CrossRef]
- Revers, F.; Le Gall, O.; Candresse, T.; Le Romancer, M.; Dunez, J. Frequent occurrence of recombinant potyvirus isolates. J. Gen. Virol. 2016, 77, 1953–1965. [Google Scholar] [CrossRef]
- Feng, X.; Poplawsky, A.R.; Nikolaeva, O.V.; Myers, J.R.; Karasev, A.V. Recombinants of Bean common mosaic virus (BCMV) and Genetic Determinants of BCMV Involved in Overcoming Resistance in Common Bean. Phytopathology 2014, 104, 786–793. [Google Scholar] [CrossRef] [Green Version]
- Sharma, P.; Kapil, R.; Sharma, S.K.; Sharma, O.P. Analysis of 3′-Terminal Region of Bean common mosaic virus Strains Infecting Common Bean in India. Indian J. Virol. 2011, 22, 37–43. [Google Scholar] [CrossRef] [Green Version]
- Johary, T.; Dizadji, A.; Naderpour, M. Biological and molecular characteristics of Bean common mosaic virus isolates circulating in common bean in Iran. J. Plant Pathol. 2016, 98, 301–310. [Google Scholar] [CrossRef]
- Abadkhah, M.; Hajizadeh, M.; Koolivand, D. Global population genetic structure of Bean common mosaic virus. Arch. Phytopathol. Plant Prot. 2020, 53, 266–281. [Google Scholar] [CrossRef]
- Spence, N.J.; Walkey, D.G.A. Variation for pathogenicity among isolates of bean common mosaic virus in Africa and a reinterpretation of the genetic relationship between cultivars of Phaseolus vulgaris and pathotypes of BCMV. Plant Pathol. 1995, 44, 527–546. [Google Scholar] [CrossRef]
- Sengooba, T.N.; Spence, N.J.; Walkey, D.G.A.; Allen, D.J.; Lana, A.F. The occurrence of bean common mosaic necrosis virus in wild and forage legumes in Uganda. Plant Pathol. 1997, 46, 95–103. [Google Scholar] [CrossRef]
- Coutts, B.A.; Kehoe, M.A.; Webster, C.G.; Wylie, S.J.; Jones, R.A.C. Indigenous and introduced potyviruses of legumes and Passiflora spp. from Australia: Biological properties and comparison of coat protein nucleotide sequences. Arch. Virol. 2011, 156, 1757–1774. [Google Scholar] [CrossRef]
- Cejnar, P.; Kučková, Š.; Šantrůček, J.; Glasa, M.; Komínek, P.; Mihálik, D.; Slavíková, L.; Leišová-Svobodová, L.; Smirnova, T.; Hynek, R.; et al. Efficient Confirmation of Plant Viral Proteins and Identification of Specific Viral Strains by nanoLC-ESI-Q-TOF Using Single-Leaf-Tissue Samples. Pathogens 2020, 9, 966. [Google Scholar] [CrossRef] [PubMed]
- Tyanova, S.; Temu, T.; Cox, J. The MaxQuant computational platform for mass spectrometry-based shotgun proteomics. Nat. Protoc. 2016, 11, 2301–2319. [Google Scholar] [CrossRef]
- The UniProt Consortium; Bateman, A.; Martin, M.-J.; Orchard, S.; Magrane, M.; Ahmad, S.; Alpi, E.; Bowler-Barnett, E.H.; Britto, R.; Bye-A-Jee, H.; et al. UniProt: The Universal Protein Knowledgebase in 2023. Nucleic Acids Res. 2022, 51, D523–D531. Available online: https://www.uniprot.org/ (accessed on 14 April 2023). [CrossRef]
- NCBI Protein Database. Available online: https://www.ncbi.nlm.nih.gov/protein/ (accessed on 14 April 2023).
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. Available online: http://primer3plus.com/cgi-bin/dev/primer3plus.cgi (accessed on 10 March 2023). [CrossRef] [Green Version]
- Feng, X.; Orellana, G.E.; Myers, J.R.; Karasev, A.V. Recessive Resistance to Bean common mosaic virus Conferred by the bc-1 and bc-2 Genes in Common Bean (Phaseolus vulgaris) Affects Long-Distance Movement of the Virus. Phytopathology 2018, 108, 1011–1018. [Google Scholar] [CrossRef] [Green Version]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- BLAST (The Basic Local Alignment Search Tool). Available online: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome (accessed on 10 March 2023).
- Martin, D.P.; Varsani, A.; Roumagnac, P.; Botha, G.; Maslamoney, S.; Schwab, T.; Kelz, Z.; Kumar, V.; Ben Murrell, B. RDP5: A computer program for analyzing recombination in, and removing signals of recombination from, nucleotide sequence datasets. Virus Evol. 2021, 7, veaa087. [Google Scholar] [CrossRef] [PubMed]
- Worrall, E.A.; Hayward, A.C.; Fletcher, S.J.; Mitter, N. Molecular characterization and analysis of conserved potyviral motifs in bean common mosaic virus (BCMV) for RNAi-mediated protection. Arch. Virol. 2018, 164, 181–194. [Google Scholar] [CrossRef] [PubMed]
- Moradi, Z.; Mehrvar, M. Genetic variability and molecular evolution of Bean common mosaic virus populations in Iran: Comparison with the populations in the world. Eur. J. Plant Pathol. 2019, 154, 673–690. [Google Scholar] [CrossRef]
- Sangeeta, S.B.; Ramappa, H.K.; Aishwarya, P. Biological and serological confirmation of host range of bean common mosaic virus (BCMV) infecting field bean. Pharma Innov. 2022, 11, 2046–2049. [Google Scholar]
- DPV. Available online: https://www.dpvweb.net/dpv/showdpv/?dpvno=337 (accessed on 14 March 2023).
- PVD. Available online: http://47.90.94.155/PlantVirusBase/#/search?val=Bean%20common%20mosaic%20virus (accessed on 14 March 2023).
- Ţîţei, V. The prospect of cultivation and utilization of Coronilla varia L. in Moldova. Oltenia-Stud. Nat. Sci. 2021, 37, 46–52. [Google Scholar]
- Shanjani, P.S.; Rasoulzadeh, L.; Javadi, H. Evaluation of morphological traits in the populations of Coronilla varia L. J. Rangel. Sci. 2023, 13, 52–71. [Google Scholar] [CrossRef]
- Worrall, E.A.; Wamonje, F.O.; Mukeshimana, G.; Harvey, J.J.W.; Carr, J.P.; Mitter, N. Bean common mosaic virus and Bean common mosaic necrosis virus: Relationships, biology, and prospects for control. Adv. Virus Res. 2015, 93, 1–46. [Google Scholar] [CrossRef]
- García-Arenal, F.; Fraile, A.; Malpica, J.M. Variability and genetic structure of plant virus populations. Annu. Rev. Phytopathol. 2001, 39, 157–186. [Google Scholar] [CrossRef]
- Roossinck, M.J. Plant RNA virus evolution. Curr. Opin. Microbiol. 2003, 6, 406–409. [Google Scholar] [CrossRef]
- Nigam, D.; LaTourrette, K.; de Souza, P.F.N.; Garcia-Ruiz, H. Genome-Wide Variation in Potyviruses. Front. Plant Sci. 2019, 10, 1439. [Google Scholar] [CrossRef] [Green Version]
- Larsen, R.C.; Miklas, P.N.; Druffel, K.L.; Wyatt, S.D. NL-3 K Strain Is a Stable and Naturally Occurring Interspecific Recombinant Derived from Bean common mosaic necrosis virus and Bean common mosaic virus. Phytopathology 2005, 95, 1037–1042. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maliogka, V.I.; Salvador, B.; Carbonell, A.; Sáenz, P.; León, D.S.; Oliveros, J.C.; Delgadillo, M.O.; García, J.A.; Simón-Mateo, C. Virus variants with differences in the P1 protein coexist in a Plum pox virus population and display particular host-dependent pathogenicity features. Mol. Plant Pathol. 2012, 13, 877–886. [Google Scholar] [CrossRef] [PubMed]
- Mao, C.; Shan, S.; Huang, Y.; Jiang, C.; Zhang, H.; Li, Y.; Chen, J.; Wei, Z.; Sun, Z. The hypervariable N-terminal of soybean mosaic virus P1 protein influences its pathogenicity and host defense responses. Phytopathol. Res. 2022, 4, 10. [Google Scholar] [CrossRef]
- Elena, S.F.; Bedhomme, S.; Carrasco, P.; Cuevas, J.M.; de la Iglesia, F.; Lafforgue, G.; Lalić, J.; Pròsper, À.; Thomas, N.; Zwart, M.P. The evolutionary genetics of emerging plant RNA viruses. Mol. Plant-Microbe Interact. 2011, 24, 287–293. [Google Scholar] [CrossRef] [Green Version]
- Fiallo-Olivé, E.; Navas-Castillo, J. Tomato chlorosis virus, a promiscuous virus with multiple host plants and whitefly vectors. Ann. Appl. Biol. 2022, 182, 29–36. [Google Scholar] [CrossRef]
- Hančinský, R.; Mihálik, D.; Mrkvová, M.; Candresse, T.; Glasa, M. Plant Viruses Infecting Solanaceae Family Members in the Cultivated and Wild Environments: A Review. Plants 2020, 9, 667. [Google Scholar] [CrossRef] [PubMed]
- Bera, S.; Fraile, A.; García-Arenal, F. Analysis of fitness trade-offs in the host range expansion of an RNA virus, tobacco mild green mosaic virus. J. Virol. 2018, 92, e01268-18. [Google Scholar] [CrossRef] [Green Version]
Fragment | Primer | Sequence of Primer (5’→3’) | Locations of Primers (Nucleotides) | Product Size (bp) |
---|---|---|---|---|
1. | F1 | AAAATAAAACAACTCATAAA | 1–20 | 826 |
R1 | ACTGAACAGCCCCCTTAGGT | 806–826 | ||
2. | F2 | TACCATCAAACAGCAACCTA | 792–811 | 718 |
R2 | TGAACTTATCACGCCATCCA | 1491–1510 | ||
3. | F3 | ATTCTCAGAGCCCTGAATTG | 1460–1479 | 727 |
R3 | ATTGGGGTTTTTCCTGATCC | 2168–2187 | ||
4. | F4 | CATTCCTTCAGAGGGTTACA | 2139–2158 | 759 |
R4 | TCTTTTGGGCTTGAAGATGC | 2879–2898 | ||
5. | F5 | CTCAAGAGCCCGACTAAGAG | 2378–2396 | 691 |
R5 | CTTGATGAGCTGTTCCAGCA | 3050–3069 | ||
6. | F6 | TGGATCCAAAGGGATCAAAG | 3010–3029 | 726 |
R6 | TGGGCATAACTGGCTTTTCT | 3717–3736 | ||
7. | F7 | CAAAGCTTTTGTGAAGCGAG | 3681–3700 | 906 |
R7 | GAATGCAATTGCCGAAGAAT | 4568–4587 | ||
8. | F8 | TCATCATTTTTGATGAGTGC | 4538–4557 | 651 |
R8 | AACGCTGCCTCTGTTGCTAT | 5170–5189 | ||
9. | F9 | GATGGGAGAACGATGCAGAT | 4864–4883 | 778 |
R9 | GGATCAGTGCTGAGCGTGTA | 5623–5642 | ||
10. | F10 | CACCAATACACCAGCCAATG | 5419–5438 | 622 |
R10 | ATCCAGCCACCACCAAGTAG | 6022–6041 | ||
11. | F11 | GGGTCTCAAAGGAAAGTGGG | 5958–5977 | 703 |
R11 | TCTCAACGGCCACCTCCTCA | 6642–6661 | ||
12. | F12 | GCGTATCAAGAGAAGTGAGG | 6609–6628 | 829 |
R12 | GCTTTGTCACCAACGCACTA | 7452–7471 | ||
13. | F13 | GGGCTCCCATTAGTTTCAGT | 7114–7133 | 653 |
R13 | TGCTGCTTTCAGGTTCAATG | 7748–7767 | ||
14. | F14 | TATGTCACGGATCCAGAAGA | 7717–7736 | 762 |
R14 | CCCACAAGTCCACTTCCTGT | 8460–8479 | ||
15. | F15 | ACAACAGTGGGCAACCTTCC | 8309–8328 | 541 |
R15 | TCTTGTCCTTCCCAGTGTCC | 8982–9001 | ||
16. | F16 | ATCTGTGCACCTACAATCAG | 8922–8941 | 763 |
R16 | TGCTGTTAACGTTGCTGAGG | 9666–9685 | ||
17. | F17 | CAATGGCACTTCACCAGATG | 9357–9376 | 693 |
R17 | AAACAAACATTGCCGTAGCT | 10,031–10,050 |
Nucleotide Position | Amino Acid in BCMV SVK | Amino Acid in BCMV PV 0915 | Protein of BCMV |
---|---|---|---|
829–831 | S | R | P1 |
832–834 | L | P | |
856–858 | E | K | |
862–864 | V | A | |
868–870 | L | S | |
871–873 | T | A | |
880–882 | K | R | |
883–885 | H | Q | |
895–897 | K | D | |
898–900 | A | S | |
904–906 | L | F | |
907–909 | Q | R | |
913–915 | K | R | |
919–921 | E | Q | |
958–960 | V | S | |
961–963 | I | F | |
1156–1158 | L | V | |
1192–1194 | M | L | |
1198–1200 | L | H | |
1216–1218 | Q | K | |
1234–1236 | L | I | |
1237–1239 | P | N | |
1240–1242 | C | I | |
1243–1245 | F | Y | |
1246–1248 | T | K | |
1249–1251 | H | Q | |
1252–1254 | G | C | |
1255–1257 | D | L | |
1258–1260 | P | A | |
1261–1263 | V | A | |
1264–1266 | F | L | |
1267–1269 | G | C | |
1279–1281 | H | T | |
1282–1284 | L | Y | |
1285–1287 | L | R | |
1288–1290 | Y | H | |
1291–1293 | A | L | |
1297–1299 | S | N | |
1300–1302 | R | G | |
2581–2583 | V | M | Hc-pro |
2584–2586 | P | L | |
5755–5757 | L | F | CI |
8515–8517 | V | G | Nib |
9001–9003 | N | K | CP |
9139–9141 | R | K | |
9151–9153 | I | R | |
9169–9171 | E | V | |
9184–9186 | M | I | |
9190–9192 | I | N | |
9790–9792 | S | P |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mihálik, D.; Grešíková, S.; Hančinský, R.; Cejnar, P.; Havrlentová, M.; Kraic, J. A Novel Isolate of Bean Common Mosaic Virus Isolated from Crownvetch (Securigera varia L. Lassen). Agronomy 2023, 13, 1677. https://doi.org/10.3390/agronomy13071677
Mihálik D, Grešíková S, Hančinský R, Cejnar P, Havrlentová M, Kraic J. A Novel Isolate of Bean Common Mosaic Virus Isolated from Crownvetch (Securigera varia L. Lassen). Agronomy. 2023; 13(7):1677. https://doi.org/10.3390/agronomy13071677
Chicago/Turabian StyleMihálik, Daniel, Simona Grešíková, Richard Hančinský, Pavel Cejnar, Michaela Havrlentová, and Ján Kraic. 2023. "A Novel Isolate of Bean Common Mosaic Virus Isolated from Crownvetch (Securigera varia L. Lassen)" Agronomy 13, no. 7: 1677. https://doi.org/10.3390/agronomy13071677