Next Article in Journal
Veg-DenseCap: Dense Captioning Model for Vegetable Leaf Disease Images
Previous Article in Journal
Assessment of the Spatial Variability and Uncertainty of Shreddable Pruning Biomass in an Olive Grove Based on Canopy Volume and Tree Projected Area
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Transposon Polymorphism and Its Potential Impacts on Brown Planthopper (Nilaparvata lugens Stål) Resistance in Rice (Oryza sativa L.)

1
Rice Research Institute, Fujian Academy of Agricultural Sciences, Fuzhou 350018, China
2
College of Agriculture, Fujian Agriculture and Forestry University, Fuzhou 350002, China
3
Agricultural Genomics Institute at Shenzhen, Chinese Academy of Agricultural Sciences, Shenzhen 518116, China
4
College of Agriculture, Qingdao Agricultural University, Qingdao 266000, China
5
College of Horticulture, China Agricultural University, Beijing 100193, China
*
Author to whom correspondence should be addressed.
Agronomy 2023, 13(7), 1699; https://doi.org/10.3390/agronomy13071699
Submission received: 19 April 2023 / Revised: 13 June 2023 / Accepted: 23 June 2023 / Published: 25 June 2023
(This article belongs to the Section Pest and Disease Management)

Abstract

:
The brown planthopper (BPH) is a major pest in rice cultivation, significantly affecting both yield and quality; accordingly, exploring and utilizing anti-herbivory genes to enhance rice’s inherent resistance to BPH can be an effective strategy for mitigating infestation. The effects of transposon insertion polymorphisms (TIPs) on rice’s resistance to insect pests have not been reported. In this study, through the identification of transposon insertion sites in susceptible and resistant rice varieties, a total of six possible candidate insect resistance genes were potentially located. Among them, a segment of the LTR/Copia transposon insertion was verified in the promoter of LOC_Os04g02720, which carries a cis-acting element binding site in rice involved in the abscisic acid reaction. Quantitative analysis showed a significant difference of the gene expression between insect-resistant and insect-susceptible varieties (p < 0.05). This study provides insights into the functional analysis of transposons and population transposon polymorphisms, whereas the identification of candidate insect resistance genes offers a theoretical foundation for the development of insect-resistant rice varieties.

1. Introduction

Rice (Oryza sativa L.) is one of the world’s most important food crops and widely distributed throughout Asia, Africa, Oceania, and Latin America [1]. Rice maintains high nutritional value, as its nutrients are easily absorbed by the human body. More than half of the world’s population consumes rice as a staple food [2]; however, pest damage is one of the main factors affecting rice yield. Specifically, rice planthoppers, including the brown planthopper (Nilaparvata lugens (Stål)), are one such major pest. Their rapid reproduction can cause outbreaks over short periods of time, severely reducing rice yield and quality [3]. Taking the major rice-producing country China as an example, the losses caused by rice planthoppers, rice leaf rollers, and stem borers accounted for 29.51%, 17.17%, and 14.34% of the total rice loss from 2006 to 2015, respectively, equating to an average annual loss of 1.1936, 0.6942, and 0.5799 million tons, respectively [4]. Accordingly, enhancing rice resistance to pests is of great significance for maintaining production yield.
Transposons (i.e., transposable elements–TEs) are DNA fragments that can directly move from one chromosome site to another [5]. Based on the transposition mechanism of TEs, they are classified into two types: Class I elements and Class II elements [6,7]. Among Class I elements, long terminal repeat (LTR) retrotransposons have been extensively studied. Long terminal repeat retrotransposons (LTR-RTs) are capable of inserting not only within genes but across neighboring regions as well. Gene fragments associated with TEs make up > 1.2% of the entire genome of Arabidopsis thaliana and are predominantly composed of Copia LTR-RT and CACTA transposons [8]. When LTR-RTs are inserted within or near genes, they can either enhance or inhibit gene expression depending on the cis-acting regulatory elements they possess [9,10,11,12]. Additionally, the transcriptional activity of most LTR retrotransposons is activated by environmental cues [13]. For example, the expression of LTR retrotransposons, such as Tnt1 and Tto1, is influenced by various factors, including protoplast isolation, cell culture, external stress, methyl jasmonate, copper chloride, and salicylic acid [14,15,16]. TEs are a vital component of plant genomes and comprise > 35% of the rice genome [17]. The characteristic of TEs to continuously “jump” within the genome can create variations in the sequence and expression of certain genes, ultimately affecting the stress tolerance in rice. For instance, ST1 is important for the WRKY45-mediated signaling pathway of disease resistance; therefore, the insertion of a TE within the intron of WRKY45-1 can result in the generation of multiple partially overlapping small RNAs at the TE insertion site during gene expression. These RNAs can further promote the methylation of the TE inserted into the intron of the rice ST1, thereby suppressing the gene’s expression. This loss of disease resistance regulated by WRKY45 ultimately leads to the susceptibility of rice to bacterial blight infection [18]. The INDITTO2 transposon within the promoter of the DEEPER ROOTING 1 (DRO1) gene in rice can transmit auxin signals to regulate DRO1 transcription and enhance drought avoidance [19]. Additionally, a class of DNA transposons in rice can suppress the translation of the endogenous protein Ghd2, thereby regulating the rice flowering time, plant height, and grain number per panicle [20]. In rice transposon insertion polymorphism (TIP) studies, TRACKPOSON tool was developed based on genome resequencing data generated by the “3000 Rice Genome Project”. Using the database of 32 retrotransposon families, TRACKPOSON tool was employed to detect ~50,000 TIPs across 3000 sets of rice resequencing data. It was found that the frequency of TE polymorphisms in most rice varieties was low, suggesting their recent emergence in agricultural activities [21].
More than forty loci have been identified for resistance to BPH. For example, cell wall composition and structure in rice containing the Bph6 resistance gene is relatively stable, forming a physical barrier to hinder the feeding behavior of BPHs. Simultaneously, Bph6 can regulate signaling pathways, such as salicylic and jasmonic acids in rice, increasing the expression of defense-related genes [22]. Comparatively, Bph30 can enhance the stability of thick-walled tissues in rice, thus inhibiting the piercing and feeding behavior of BPHs, as it is a completely dominant insect-resistance gene and provides broad-spectrum resistance against brown and white-backed planthoppers alike [23]. Overall, there remains a need to identify novel rice genes that confer resistance to BPH. To this end, the present study aims to utilize the resequencing data of rice to investigate the correlation between transposable elements and genes related to BPH resistance via the analysis of TIPs. This study addresses the research gap in understanding the role of TIPs in BPH resistance, providing valuable insights for future research on rice pest resistance and increasing the global yield of this crop that is essential to humanity.

2. Materials and Methods

2.1. Materials

The materials used in this experiment were grown at the Rice Research Institute of the Fujian Academy of Agricultural Sciences, Fuzhou City, China. According to the methods of Shi et al. [24], the phenotypic data of 84 cultivated rice varieties utilized in this study, as well as their resequencing data, were obtained (Table 1). The 2007 release of the Nipponbare genome (https://genome.jgi.doe.gov/portal/pages/dynamicOrganismDownload.jsf?organism=Phytozome# (accessed on 8 October 2021)) [25] was employed as the reference genome, whereas the TE families compiled by Carpentier et al. [21] and Chen et al. [26] were selected as the reference TE database.

2.2. Methods

2.2.1. Transposon Identification

The TEs in BPH-resistant and -susceptible rice populations were identified using two software tools: TRACKPOSON [21] and RelocaTE2 [26]. To ensure the accuracy of the identified TEs, bedtools (v.2.30.0) [27] was used to extract the detected TEs in the insect-resistant and insect-susceptible rice varieties. To prevent the misalignment of read pairs in highly repetitive regions (which can lead to inaccurate insertion site identification), both ends of the identified common TE insertion sites were extended by 400 bp to avoid potential shifts. The TE matrix table was constructed using Microsoft Excel (v.2016) (https://www.microsoft.com/en-us/microsoft-365/excel (accessed on 4 May 2022)) and PyCharm (v.2022.3.2) (https://www.jetbrains.com/pycharm/download/#section=windows (accessed on 5 May 2022)). The matrix file was filtered based on a minor allele frequency > 0.02. The fold change test, specifically LOGFC > 2, was used to identify TE insertion sites that exhibited significant differences between the insect-resistant and insect-susceptible rice populations. Lastly, high-quality TIPs were identified through a screening process.

2.2.2. Identification and Functional Analysis of Novel Genes Associated with BPH Resistance

Genes overlapping with TE insertion sites were identified using bedtools [27] to serve as the target genes for insertion. Here, eggnog-master (v.2.1.10) [28] was used to functionally annotate the entire rice genome protein sequence based on a eukaryotic (euk) database using the following parameters: python emapper.py -i Osativa_323_v7.0.protein.fa -d euk --data_dir eggnog-mapper-master -o rice --dbtype hmmdb, where -i indicates the input file, -o indicates the output file prefix, -d specifies the database data, and --data_dir specifies the database location. Using TBtools (v.1.09852) [29], gene ontology (GO) enrichment analyses for the genes targeted by transposable element insertions were performed using the entire genome as background information. Finally, the enrichment results were visualized using the online tool Bioinformatics (http://www.bioinformatics.com.cn/ (accessed on 8 September 2022)). Filtering the insect-resistant related pathways and extracting the corresponding insect-resistant related genes were accomplished based on the GO enrichment results. To ensure the reliability of the screened candidate genes, the National Rice Data Center data (https://ricedata.cn (accessed on 23 September 2022)) were used to perform functional comparison of these insect-resistant related genes. If its annotated function had previously been widely studied, such as organic acid metabolism, nitrogen metabolism, etc., it was defined as a novel gene related to BPH resistance; otherwise, it was discarded. The sequences of LTR/Copia transposons were extracted, and the prediction of cis-acting elements was performed using the PlantCARE database (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/ (accessed on 16 January 2023)).

2.2.3. Quantitative Analysis

LOC_Os04g02720 is associated with potassium ion channels that enhance cell wall thickness [30]. A large number of studies on rice resistance to BPH have shown that the cell wall plays an important role as a physical barrier against BPH infesting rice [22], blocking BPH from feeding and protecting the plant from pests. Therefore, it is inferred that LOC_Os04g02720 may be associated with BPH resistance. In this study, the leaf tissues of 5 insect-susceptible cultivars and 1 insect-resistant variety were collected at the seedling stage of rice for 15 days. RNA was extracted using the Trizol method and then reverse-transcribed into cDNA using an Evo M-MLV Plus Reverse Transcription Kit (Accurate Biology), which was used as a template for real-time fluorescence quantitative PCR. The 15 μL reaction system contains the following components: 7.5 μL of SYBR® Green Realtime PCR Master Mix with a final concentration of 0.3 μL of each forward and reverse primers, 1 μL of template, and 5.9 μL of double-distilled water. The reaction program consisted of an initial denaturation step at 95 °C for 1 min, followed by 39 cycles of denaturation at 95 °C for 10 s, annealing at 55 °C for 30 s, extension at 65 °C for 5 s, and 3 biological replicates. The qPCR-specific primers were designed according to the gene sequences (Table 2), and ubiquitin (UBQ) was used as the internal reference gene (UBQ expression was stable in different rice cultivars); the samples were replicated three times between wells. The mean values were calculated from the Ct values of the fluorescent quantitative PCR results, the relative expression of LOC_Os04g02720 in different susceptible varieties was calculated using 2−ΔΔCT [31], and the data were counted using Excel v 2016 and SPSS v 22.0.

3. Results

3.1. Identification of Transposons in Insect-Susceptible and Insect-Resistant Rice Populations

Two methods were used to identify transposable elements across 42 insect-susceptible and 42 insect-resistant rice varieties. The results showed that the RelocaTE2 method identified a greater number of transposable elements in both insect-susceptible and insect-resistant rice varieties than the TRACKPOSON method, with this difference being statistically significant. Moreover, the total number of transposable elements identified in insect-resistant rice varieties was higher than that in susceptible insect varieties for both methods, although these differences were not significant (Figure 1a–c). The transposable elements identified by TRACKPOSON were longer in length than those identified by RelocaTE2 in both insect-susceptible and insect-resistant rice varieties, and the differences between the two were significant (Figure 1d–f). To improve the accuracy of downstream transposable element analysis, this study retained only those results shared by the two different methods for downstream analysis. A total of 2079 and 2509 transposable elements were retained in insect-susceptible and insect-resistant rice varieties, respectively (Figure 1g). The statistical results of the shared transposable elements identified in susceptible and resistant varieties showed that there was no significant difference in the total number between the insect-susceptible and insect-resistant rice populations (Figure 1h).

3.2. Analysis of Transposon Family

In terms of identified transposable elements, the Dasheng and Dagul families were the most prevalent among insect-susceptible rice varieties, with the former containing sequences that encode genes required for reverse transcription. In contrast, the Truncator family was the most prevalent among insect-resistant rice varieties with insecticide resistance. The differences in the quantity of identified transposable element families in both insect-susceptible and insect-resistant rice varieties were not significant among the various methods employed (Figure 2a). Through the classification and analysis of both DNA and RNA transposable elements shared among insect-susceptible and insect-resistant rice varieties, it was observed that the quantity of RNA transposable elements among the former was significantly higher than that of DNA transposable elements; however, little difference in the quantity of DNA and RNA transposable elements was observed among insect-resistant rice varieties (Figure 2b,c).

3.3. Detection of Transposon Insertion into Genome

By screening for differences in allele frequencies in insect-susceptible and insect-resistant rice varieties (Figure 3a), in addition to the number of TE insertions, 797 high-quality TEs were identified (Table S1) as potential transposon polymorphic loci. Screening based on the level of variation between the minimum allele frequencies and the number of insertions of TEs in susceptible and resistant varieties resulted in 797 high-quality TIPs. Further investigation of the specific locations of these TE insertions revealed that the aforementioned 797 TEs were inserted into 180 genes, including 230 coding sequences. Additionally, 397 TEs were inserted into the promoter regions of genes (Figure 3b). By performing functional enrichment analysis on genes with TE insertions in their promoter regions (Figure 3c), it was found that these genes were mainly involved in insect resistance pathways related to organic acid transport, protein metabolism, and regulation of external stressors. Based on the identified insect resistance pathways, further functional pattern screenings were performed on the genes in these pathways, revealing six possible new candidate genes for resistance to the BPH: LOC_Os01g11670, LOC_Os03g49040, LOC_Os04g02720, LOC_Os07g20360, LOC_Os10g17910, and LOC_Os12g22030 (Table 3).

3.4. Validation of Candidate Genes

Gene cloning and sequence alignment were performed on the susceptible rice cultivars ‘19w05’, ‘Yong1744’, ‘Xinyinzhan’, ‘Jinhuang1’, ‘Neihui9802’, and the resistant cultivar ‘Fuhui636’, with the results showing no difference in the coding sequence of LOC_Os04g02720 between the insect-susceptible and insect-resistant material varieties (Figure 4). The promoter sequence of LOC_Os04g02720 was further cloned, and the sequence alignment revealed the presence of only one LTR/Copia2 transposon insertion in this promoter region of the gene, which was notably not observed in other insect-susceptible rice cultivars. Prediction of cis-acting regulatory elements was performed for the inserted TE in the gene promoter region, revealing the presence of binding sites for cis-acting elements involved in abscisic acid (ABA) response in the TE sequence. Furthermore, qPCR experiments showed that the gene expression levels were significantly higher in insect-resistant than insect-susceptible rice cultivars (Figure 5).

4. Discussion

The frequent occurrence of rice pests and diseases and the extensive use of insecticides have seriously affected the yield and quality of rice [4]. The polymorphism of transposable elements in plant genomes has significant effects on the agronomic traits, gene transcription, and genetic evolution of species. Recently, the first TIP map was constructed based on resequencing data from 3000 different rice varieties, providing valuable genetic variation resources for the study of rice gene function, molecular-assisted breeding, and other important characteristics [32]. It can be seen that the study of pests and diseases from the point of view of TIPs is of some reference value.
In the early stages of the present study, whole-genome resequencing was performed on 123 rice varieties and combined with genome-wide association studies (GWAS) analysis methods to reveal a new quantitative trait locus (QTL) containing 13 candidate genes on chromosome 2 of rice. Among these candidates, two contained both leucine-rich repeat sequences and coiled-coil nucleotide-binding site leucine-rich repeat (CC-NBS-LRR) or nucleotide-binding adaptor shared by Apaf1, certain R genes, and CED4 (NB-ARC) domains, which are associated with BPH resistance in rice [33]. Based on this, this study examined the effect of TIP on BPH resistance in rice based on different methods of population TIPs, using resequencing data of rice insect-susceptible and insect-resistant populations, and explored the effect of rice TIPs on BPH resistance.
In this paper, a relatively high number of TIPs were found in the resistant group compared with the susceptible group. A total of 398 genes were found to overlap with high-confidence TEs in the promoter region of the gene; 230 and 180 genes overlapped with TEs in the CDS and gene regions, respectively. The number of TEs and their associated genes in the 3′ UTR and 5′ UTR regions was low. This indicates that the high-quality transposable polymorphic loci in these 84 rice populations are more likely to be concentrated in the promoter regions of the genes. A large number of studies have found that TE insertion into the promoter region affects gene expression [19]; therefore, the present study enriched the genes with TE insertion in the promoter region for function and showed that genes with TE insertion in the promoter region were mainly enriched in pathways related to organic acid transport, protein metabolism, enzyme regulatory activity, ion transport, and regulation of external stress. There are relevant research reports that indicate that the concentration of organic acids such as ABA and salicylic acid (SA) increases in BPH-resistant varieties in the mid to late stages of infestation. It has also been found that ABA, SA, and jasmonic acid (JA) interact to regulate signal transduction pathways [34] and play an important role in regulating the signaling network of plant defense against insect pests. When insects attack plants, they may produce defense proteins such as phenylalanine (PAL) and peroxidase (PO), affecting the insect’s normal growth [35]. Rice rapidly responds to insect herbivores during infestation to defend the plant’s normal growth and development. This suggests a strong correlation between the above pathways and BPH resistance, and presumably, TE insertion plays a role in the development of BPH resistance in rice. Meanwhile, a reported BPH resistance (LOC_Os06g03500) was also enriched in the rice genome [36], indicating that the TIP approach adopted in this paper is feasible. To make the identified candidate insect resistance genes more accurate, the functions of genes whose gene promoter regions overlapped with TEs were queried in the rice database. LOC_Os10g32600 was associated with an early spike; LOC_Os08g07740 was associated with rice grain yield, plant height, and tassel stage, but apparently, none of these genes were related to insect resistance.
In this study, we selected and focused on six candidate genes that might be related to insect resistance: LOC_Os10g17910 (cell stress, signal transduction related); LOC_Os01g11670 and LOC_Os12g22030 (serine metabolism related); LOC_Os03g49040 and LOC_Os07g20360 (transporter protein related); and LOC_Os04g02720 (potassium ion channel related). One of these genes, LOC_Os04g02720, may be related to potassium channels, which enhance the thickness of the cell wall [30]. The cell wall plays a vital role in the resistance to BPH attacking rice [22]. Thus, this study continued the experimental validation of LOC_Os04g02720. First, it was confirmed that there is a TE sequence of exactly 284 bp in length present in the promoter region of LOC_Os04g02720 in insect-resistant cultivars, but no TE insertions were found in susceptible cultivars. The CDS sequence of LOC_Os04g02720 was verified to be almost identical between the insect-susceptible and insect-resistant varieties by cloning the CDS sequence of LOC_Os04g02720. Secondly, LOC_Os04g02720 was found to be differentially expressed in insect-susceptible varieties, leading to the conclusion that the expression of LOC_Os04g02720 was affected by TE insertion in this study. Then, this study combined predictive analysis with a database of plant cis-acting elements, which ultimately predicted cis-acting element binding sites involved in the ABA response to abscisic acid, a key phytohormone in the BPH resistance pathway [37], on transposon sequences inserted in insect-resistant species. It is therefore hypothesized that the sequences left over from the translocation are likely to confer specific insect resistance traits to plant species in response to insect stress. However, this hypothesis has not been experimentally proven, and further research is needed. Previous studies have also shown that the absence of ABA in plants increases their susceptibility to herbivores [38,39,40]. Callose is a plant cell wall polysaccharide that can form a physical barrier when deposited, thereby increasing plant resistance [41]. Therefore, when plants are subjected to external stimuli, ABA can induce the accumulation of callose to form a physical barrier at the site of the stimulus, thus hindering the invasion of external substances [42,43,44].
The present study utilized 42 representative transposable element families in the rice genome. Short-length transposable element families, such as short interspersed elements (SINEs) and miniature inverted-repeat transposable elements (MITEs), may also affect the phenotypes of BPHs but, considering their size, high copy number, and other characteristics, are unsuitable for short sequence alignment [45]. Next-generation sequencing also possesses some notable drawbacks, such as short read length and poor end quality, which can cause misalignment in highly repetitive regions and result in the misidentification of insertion sites [46]. Therefore, in the present study, a left–right amplification method was used to reduce the prevalence of this issue when detecting shared TE insertion sites in susceptible and resistant rice varieties. Coincidently, the accuracy of TE prediction also heavily depends on the quality of the whole-genome assembly; thus, in the study here, a high-quality rice reference genome was selected to maximize the accuracy of TE detection. Based on the candidate genes for insect resistance identified in the present study, further transgenic experiments can be conducted to validate the actual impact of TEs on rice resistance to BPHs. To further enhance the accuracy of the screened anti-herbivory candidate genes, other biological methods, such as GWAS or QTL analysis, can be combined in the future to explore favorable functional genes from different perspectives. Moreover, in-depth analysis of TE mutations is crucial, which includes examining their effects on chromatin and determining the underlying causes, as well as differential effects of TE mutations between distinct subgroups during the rice domestication process.
In conclusion, this study provides an important reference for TIPs and functional studies in rice populations. Meanwhile, the new possible candidate insect resistance genes identified in this study provide potential molecular targets for rice insect resistance breeding research to further secure rice yield.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy13071699/s1, Table S1: 797 transposon polymorphic sites of high quality.

Author Contributions

Conceptualization, L.S.; methodology, H.W.; validation, H.W., Z.L., Y.G., L.Z. and H.H.; formal analysis, H.W.; investigation, H.W., W.L., S.L., M.J. and S.C.; resources, L.S.; writing—original draft preparation, H.W. and L.S.; writing—review and editing, L.S.; visualization, H.W.; supervision, L.S.; project administration, L.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the special project of the research institutes of basic research and public service in Fujian, China, grant number 2020R1023006; Fujian Provincial Science and Technology Key Project, China, grant number 2022NZ030014; a project of the Fujian Academy of Agricultural Sciences in Fujian, China, grant number YC2021016.

Data Availability Statement

The data that support the findings of this study are available from the authors upon reasonable request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Bao, Y.; Song, G.E. Historical retrospect and the perplexity on the studies of the Oryza polyploids. J. Syst. Evol. 2008, 46, 3–12. [Google Scholar]
  2. Fageria, N. Yield Physiology of Rice. J. Plant Nutr. 2007, 30, 843–879. [Google Scholar] [CrossRef]
  3. Iamba, K.; Dono, D. A review on brown planthopper (Nilaparvata lugens Stål), a major pest of rice in Asia and Pacific. Asian J. Res. Crop Sci. 2021, 6, 7–19. [Google Scholar] [CrossRef]
  4. Liu, W.; Liu, Z.; Huang, C.; Lu, M.; Liu, J.; Yang, Q. Statistics and analysis of crop yield losses caused by main diseases and insect pests in recent 10 years. Plant Prot. 2016, 42, 1–9+46. [Google Scholar]
  5. Feuillet, C.; Leach, J.; Rogers, J.; Schnable, P.; Eversole, K. Crop genome sequencing: Lessons and rationales. Trends Plant Sci. 2010, 16, 77–88. [Google Scholar] [CrossRef]
  6. Sabot, F.; Hua-Van, A.; Bennetzen, J.; Capy, P.; Chalhoub, B.; Flavell, A.; Leroy, P.; Morgante, M.; Panaud, O.; Paux, E.; et al. A Unified Classification System for Eukaryotic Transposbale Elments. Nat. Rev. Genet. 2007, 8, 973–982. [Google Scholar]
  7. Lisch, D. How important are transposons for plant evolution? Nat. Rev. Genet. 2012, 14, 49–61. [Google Scholar] [CrossRef] [PubMed]
  8. Lockton, S.; Gaut, B.S. The contribution of transposable elements to expressed coding sequence in Arabidopsis thaliana. J. Mol. Evol. 2009, 68, 80–89. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Fedoroff, N. Plant Transposons and Genome Dynamics in Evolution; John Wilely & Sons: Hoboken, NJ, USA, 2013. [Google Scholar]
  10. Fernandez, L.; Torregrosa, L.; Segura, V.; Bouquet, A.; Martínez-Zapater, J.M. Transposon-induced gene activation as a mechanism generating cluster shape somatic variation in grapevine. Plant J. 2009, 61, 545–557. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  11. Hayashi, K.; Yoshida, H. Refunctionalization of the ancient rice blast disease resistance gene pit by the recruitment of a retrotransposon as a promoter. Plant J. 2008, 57, 413–425. [Google Scholar] [CrossRef]
  12. Rebollo, R.; Romanish, M.; Mager, D. Transposable elements: An abundant and natural source of regulatory sequences for host genes. Annu. Rev. Genet. 2012, 46, 21–42. [Google Scholar] [CrossRef]
  13. Grandbastien, M.-A. Activation of plant retrotransposons under stress conditions. Trends Plant Sci. 1998, 3, 181–187. [Google Scholar] [CrossRef]
  14. Kimura, Y.; Tosa, Y.; Shimada, S.; Sogo, R.; Kusaba, M.; Sunaga, T.; Betsuyaku, S.; Eto, Y.; Nakayashiki, H.; Mayama, S. OARE-1, a Ty1-copia retrotransposon in oat activated by abiotic and biotic stresses. Plant Cell Physiol. 2002, 42, 1345–1354. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Okamoto, H.; Hirochika, H. Efficient insertion mutagenesis of arabidopsis by tissue culture-induced activation of the tobacco retrotransposon Tto1. Plant J. 2000, 23, 291–304. [Google Scholar] [CrossRef]
  16. Sakamoto, K.; Ohmido, N.; Fukui, K.; Kamada, H.; Satoh, S. Site-specific accumulation of a LINE-like retrotransposon in a sex chromosome of the dioecious plant Cannabis sativa. Plant Mol. Biol. 2000, 44, 723–732. [Google Scholar] [CrossRef] [PubMed]
  17. McCarthy, E.; Liu, J.; Gao, L.-Z.; Mcdonald, J. Long terminal repeat retrotransposons of Oryza sativa. Genome Biol. 2002, 3, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Zhang, H.; Tao, Z.; Hong, H.; Chen, Z.; Wu, C.; Li, X.; Xiao, J.; Wang, S. Transposon-derived small RNA is responsible for modified function of WRKY45 locus. Nat. Plants 2016, 2, 16016. [Google Scholar] [CrossRef]
  19. Zhao, Y.; Wu, L.; Fu, Q.; Wang, D.; Li, J.; Yao, B.; Yu, S.; Jiang, L.; Qian, J.; Zhou, X.; et al. INDITTO2 transposon conveys auxin-mediated DRO1 transcription for rice drought avoidance. Plant Cell Environ. 2021, 44, 1846–1857. [Google Scholar] [CrossRef]
  20. Shen, J.; Liu, J.; Xie, K.; Xing, F.; Xiong, F.; Xiao, J.; Li, X.; Xiong, L. Translational repression by a miniature inverted-repeat transposable element in the 3′ untranslated region. Nat. Commun. 2017, 8, 14651. [Google Scholar] [CrossRef] [Green Version]
  21. Carpentier, M.-C.; Manfroi, E.; Wei, F.-J.; Wu, H.-P.; Lasserre, E.; Llauro, C.; Debladis, E.; Akakpo, R.; Hsing, Y.-I.; Panaud, O. Retrotranspositional landscape of Asian rice revealed by 3000 genomes. Nat. Commun. 2019, 10, 24. [Google Scholar] [CrossRef] [Green Version]
  22. Guo, J.; Xu, C.; Wu, D.; Zhao, Y.; Qiu, Y.; Wang, X.; Ouyang, Y.; Cai, B.; Liu, X.; Jing, S.; et al. Bph6 encodes an exocyst-localized protein and confers broad resistance to planthoppers in Rice. Nat. Genet. 2018, 50, 297–306. [Google Scholar] [CrossRef] [PubMed]
  23. Shi, S.; Wang, H.; Nie, L.; Tan, D.; Zhou, C.; Zhang, Q.; Li, Y.; Bo, D.; Guo, J.; Jin, H.; et al. Bph30 confers resistance to brown planthopper by fortifying sclerenchyma in rice leaf sheath. Mol. Plant 2021, 14, 1714–1732. [Google Scholar] [CrossRef] [PubMed]
  24. Liu, G.; Fu, Z.H. Comparative study on identification methods of resistance of rice varieties to Planthopper. Chin. J. Rice Sci. 2002, 16, 52–56. [Google Scholar]
  25. Ouyang, S.; Zhu, W.; Hamilton, J.; Lin, H.; Campbell, M.; Childs, K.; Thibaud-Nissen, F.; Malek, R.; Lee, Y.; Zheng, L.; et al. The TIGR rice genome annotation resource: Improvements and new features. Nucleic Acids Res. 2007, 35, D883–D887. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Chen, J.; Wrightsman, T.; Wessler, S.R.; Stajich, J.E. RelocaTE2: A high resolution transposable element insertion site mapping tool for population resequencing. PeerJ. 2017, 5, e2942. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Quinlan, A.R.; Hall, I.M. BEDTools: A Flexible Suite of Utilities for Comparing Genomic Features. Bioinformatics 2010, 26, 841–842. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Cantalapiedra, C.P.; Hernández-Plaza, A.; Letunic, I.; Bork, P.; Huerta-Cepas, J. EggNOG-Mapper v2: Functional annotation, orthology assignments, and domain prediction at the metagenomic scale. Mol. Biol. Evol. 2021, 38, 5825–5829. [Google Scholar] [CrossRef]
  29. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
  30. Peng, W.; Dong, Z.; Ning, Y. Studies on the role of potassium and calcium channels in plant disease resistance. Highlights Sci. Online 2018, 11, 204–211. [Google Scholar]
  31. Livak, K.; Schmittgen, T. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  32. Liu, Z.; Wang, T.; Wang, L.; Zhao, H.; Yue, E.; Yan, Y.; Irshad, F.; Ling, Z.; Duan, M.; Xu, J.-H. RTRIP: A comprehensive profile of transposon insertion polymorphisms in rice. Plant Biotechnol. J. 2020, 18, 2379–2381. [Google Scholar] [CrossRef]
  33. Longqing, S.; Meng, D.; Lian, L.; Zhang, J.; Zhu, Y.; Kong, W.; Qiu, L.; Liu, D.; Xie, Z.; Zhan, Z.; et al. Genome-wide association study reveals a new quantitative trait locus in rice related to resistance to brown planthopper Nilaparvata lugens (Stål). Insects 2021, 12, 836. [Google Scholar]
  34. Fan, J.; Hill, L.; Crooks, C.; Doerner, P.; Lamb, C. Abscisic Acid Has a Key Role in Modulating Diverse Plant-Pathogen Interactions. Plant Physiol. 2009, 150, 1750–1761. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Howe, G.; Jander, G. Plant immunity to insect herbivores. Annu. Rev. Plant Biol. 2008, 59, 41–66. [Google Scholar] [CrossRef] [Green Version]
  36. Zhou, C.; Zhang, Q.; Chen, Y.; Huang, J.; Guo, Q.; Li, Y.; Wang, W.; Qiu, Y.; Guan, W.; Zhang, J.; et al. Balancing selection and wild gene pool contribute to resistance in global rice germplasm against planthopper. J. Integr. Plant Biol. 2021, 63, 1695–1711. [Google Scholar] [CrossRef] [PubMed]
  37. Ding, X.; Huang, Q.; Deng, Q.; Wu, J.; Liu, J. Advances in research on the role of abscisic acid in plant-insect resistance. J. Environ. Entomol. 2019, 41, 808–813. [Google Scholar]
  38. Thaler, J.; Bostock, R. Interactions between abscisic-acid-mediated responses and plant resistance to pathogens and insects. Ecology 2004, 85, 48–58. [Google Scholar] [CrossRef]
  39. Bodenhausen, N.; Reymond, P. Signaling pathways controlling induced resistance to insect herbivores in Arabidopsis. Mol. Plant-Microbe Interact. 2007, 20, 1406–1420. [Google Scholar] [CrossRef] [Green Version]
  40. Dinh, S.; Baldwin, I.; Galis, I. The HERBIVORE ELICITOR-REGULATED1 gene enhances abscisic acid levels and defenses against herbivores in Nicotiana attenuata Plants. Plant Physiol. 2013, 162, 2106–2124. [Google Scholar] [CrossRef] [Green Version]
  41. Aist, J.R. Papillae and related wound plugs of plant cells. Annu. Rev. Phytopathol. 1976, 14, 145–163. [Google Scholar] [CrossRef]
  42. Flors, V.; Ton, J.; Jakab, G.; Mauch-Mani, B. Abscisic acid and callose: Team players in defence against pathogens? J. Phytopathol. 2005, 153, 377–383. [Google Scholar] [CrossRef] [Green Version]
  43. Asselbergh, B.; Höfte, M. Basal tomato defences to Botrytis Cinerea include abscisic acid-dependent callose formation. Physiol. Mol. 2007, 71, 33–40. [Google Scholar] [CrossRef]
  44. Alazem, M.; He, M.-H.; Moffett, P.; Lin, N.-S. Abscisic acid induces resistance against bamboo mosaic virus through argonaute 2 and 3. Plant Physiol. 2017, 174, 339–355. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Domínguez, M.; Dugas, E.; Benchouaia, M.; Leduque, B.; Jiménez-Gómez, J.M.; Colot, V.; Quadrana, L. The impact of transposable elements on tomato diversity. Nat. Commun. 2020, 11, 4058. [Google Scholar] [CrossRef] [PubMed]
  46. Midha, M.K.; Wu, M.; Chiu, K.P. Long-read sequencing in deciphering human genetics to a greater depth. Hum. Genet. 2019, 138, 1201–1215. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Identification of transposons in insect-susceptible and insect-resistant rice populations. (a) Number distribution of transposable elements identified by TRACKPOSON and RelocaTE2 software in susceptible insect species on each chromosome. (b) Number distribution of transposable elements identified by TRACKPOSON and RelocaTE2 in insect-resistant rice varieties on each chromosome. (c) Significance analysis of the number of transposable elements identified by TRACKPOSON and RelocaTE2 in insect-susceptible and insect-resistant rice varieties. (**): p < 0.01, (ns): non-significant difference, p > 0.05. (d) Length distribution of transposable elements identified by TRACKPOSON and RelocaTE2 in insect-susceptible rice varieties on each chromosome. (e) Length distribution of transposable elements identified by TRACKPOSON and RelocaTE2 in insect-resistant rice varieties on each chromosome. Note: “TRACKPOSON-susceptible” represents the transposable elements detected by TRACKPOSON in insect-susceptible rice species, while all other terms have similar meanings. (f) Significance analysis of the length of transposable elements identified by TRACKPOSON and RelocaTE2 in insect-susceptible and insect-resistant rice varieties. (**): p < 0.01, (ns): non-significant difference, p > 0.05. (g) Venn diagram showing the transposable elements identified by TRACKPOSON and RelocaTE2 in insect-susceptible and insect-resistant rice varieties. (ns): non-significant difference, p > 0.05. (h) TRACKPOSON and RelocaTE2 were used to perform significant analyses of shared transposon quantities in insect-susceptible and insect-resistant rice varieties.
Figure 1. Identification of transposons in insect-susceptible and insect-resistant rice populations. (a) Number distribution of transposable elements identified by TRACKPOSON and RelocaTE2 software in susceptible insect species on each chromosome. (b) Number distribution of transposable elements identified by TRACKPOSON and RelocaTE2 in insect-resistant rice varieties on each chromosome. (c) Significance analysis of the number of transposable elements identified by TRACKPOSON and RelocaTE2 in insect-susceptible and insect-resistant rice varieties. (**): p < 0.01, (ns): non-significant difference, p > 0.05. (d) Length distribution of transposable elements identified by TRACKPOSON and RelocaTE2 in insect-susceptible rice varieties on each chromosome. (e) Length distribution of transposable elements identified by TRACKPOSON and RelocaTE2 in insect-resistant rice varieties on each chromosome. Note: “TRACKPOSON-susceptible” represents the transposable elements detected by TRACKPOSON in insect-susceptible rice species, while all other terms have similar meanings. (f) Significance analysis of the length of transposable elements identified by TRACKPOSON and RelocaTE2 in insect-susceptible and insect-resistant rice varieties. (**): p < 0.01, (ns): non-significant difference, p > 0.05. (g) Venn diagram showing the transposable elements identified by TRACKPOSON and RelocaTE2 in insect-susceptible and insect-resistant rice varieties. (ns): non-significant difference, p > 0.05. (h) TRACKPOSON and RelocaTE2 were used to perform significant analyses of shared transposon quantities in insect-susceptible and insect-resistant rice varieties.
Agronomy 13 01699 g001
Figure 2. Transposon family analysis. (a) Transposon families identified by TRACKPOSON and RelocaTE2 software in insect-susceptible and insect-resistant rice varieties. (b) Distribution of the number of insertions of the main types of transposons in (b) insect-susceptible and (c) insect-resistant rice varieties.
Figure 2. Transposon family analysis. (a) Transposon families identified by TRACKPOSON and RelocaTE2 software in insect-susceptible and insect-resistant rice varieties. (b) Distribution of the number of insertions of the main types of transposons in (b) insect-susceptible and (c) insect-resistant rice varieties.
Agronomy 13 01699 g002
Figure 3. Identification and functional analysis of transposon insertion genes. (a) Density plot of allelic frequencies in insect-susceptible and insect-resistant rice varieties after excluding non-significant transposon loci. (b) Distribution and quantity of transposons in the genome. (c) Gene ontology enrichment analysis of genes with transposon insertions at their promoters.
Figure 3. Identification and functional analysis of transposon insertion genes. (a) Density plot of allelic frequencies in insect-susceptible and insect-resistant rice varieties after excluding non-significant transposon loci. (b) Distribution and quantity of transposons in the genome. (c) Gene ontology enrichment analysis of genes with transposon insertions at their promoters.
Agronomy 13 01699 g003
Figure 4. Multiple sequence alignment of LOC_Os04g02720 in different rice varieties.
Figure 4. Multiple sequence alignment of LOC_Os04g02720 in different rice varieties.
Agronomy 13 01699 g004
Figure 5. Identification and expression analysis of transposon insertion in potential rice resistance against brown planthopper. (a) Graphical representation of the locations for transposon insertion sites and associated genes. (b) Relative expression levels of LOC_Os04g02720 gene across various rice varieties. Different lowercase letters indicate significant differences (p < 0.05): FH636, Fuhui 636; Y1744, Yong 1744; XYZ, Xinyinzhan; JH1H, Jinhuang 1; NH9802, Neihui 9802.
Figure 5. Identification and expression analysis of transposon insertion in potential rice resistance against brown planthopper. (a) Graphical representation of the locations for transposon insertion sites and associated genes. (b) Relative expression levels of LOC_Os04g02720 gene across various rice varieties. Different lowercase letters indicate significant differences (p < 0.05): FH636, Fuhui 636; Y1744, Yong 1744; XYZ, Xinyinzhan; JH1H, Jinhuang 1; NH9802, Neihui 9802.
Agronomy 13 01699 g005
Table 1. BPH-resistant phenotypic information of 84 rice varieties.
Table 1. BPH-resistant phenotypic information of 84 rice varieties.
Sample IDResistance LevelSample IDResistance LevelSample IDResistance Level
R019R779R1181–5
R049R809R865
R059R859R233
R119R939R1123
R129R1169R580–5
R169R1229R611–3
R209R1239R1091–3
R219R1199R1010–3
R289R1219R1200–1
R319R1027R270–5
R329R1147R080–3
R369R337–9R630–3
R379R357–9R660–3
R389R1137–9R840–3
R409R033–5R960–3
R419R063–5R970–3
R439R133–5R990–3
R479R143–5R190–1
R489R303–5R250–1
R499R593–5R870–1
R509R643–5R890–1
R519R733–5R1100–1
R659R833–5R1150–1
R679R1033–5R171
R719R1053–5R291
R729R181–5R150
R749R1071–5R240
R769R1081–5R260
Resistance level: 0—immune; 1—highly resistant; 3—resistant; 5—moderately resistant; 7—moderately susceptible; 9—susceptible; others—insect resistant. The numbers following R in the table represent the numerical number corresponding to each variable name to facilitate the collation of each variety.
Table 2. Internal reference gene and specific primers for qPCR.
Table 2. Internal reference gene and specific primers for qPCR.
Gene NameForward Primer Sequence (5′–3′)Reverse Primer Sequence (5′–3′)
UBQACCCTGGCTGACTACAACATCAGTTGACAGCCCTAGGGTG
LOC_Os04g02720CTCCATTGCTCTTGTTGTCATTAG CAGTGACAAGGTGACGAAGAA
Table 3. Annotation of candidate rice genes overlapped with TEs at the gene promoter.
Table 3. Annotation of candidate rice genes overlapped with TEs at the gene promoter.
Gene IDAnnotation
LOC_Os01g11670OsSCP2—Putative serine carboxypeptidase homologue, expressed
LOC_Os03g49040Transposon protein, putative, CACTA, En/Spm sub-class, expressed
LOC_Os04g02720Potassium channel KAT 2, Putative, expressed
LOC_Os07g20360Retrotransposon protein, putative, unclassified, expressed
LOC_Os10g17910OsWAK114–OsWak receptor-like cytoplasmic kinase OsWAK-RLCK, expressed
LOC_Os12g22030Serine hydroxymethyltransferase, SHMT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, H.; Liao, Z.; Gao, Y.; Zhang, L.; Lei, W.; Huang, H.; Lei, S.; Jiang, M.; Chen, S.; Shi, L. Transposon Polymorphism and Its Potential Impacts on Brown Planthopper (Nilaparvata lugens Stål) Resistance in Rice (Oryza sativa L.). Agronomy 2023, 13, 1699. https://doi.org/10.3390/agronomy13071699

AMA Style

Wang H, Liao Z, Gao Y, Zhang L, Lei W, Huang H, Lei S, Jiang M, Chen S, Shi L. Transposon Polymorphism and Its Potential Impacts on Brown Planthopper (Nilaparvata lugens Stål) Resistance in Rice (Oryza sativa L.). Agronomy. 2023; 13(7):1699. https://doi.org/10.3390/agronomy13071699

Chicago/Turabian Style

Wang, Huanhuan, Zhenyang Liao, Yingying Gao, Lingge Zhang, Wenlong Lei, Hantang Huang, Siru Lei, Mengwei Jiang, Shuai Chen, and Longqing Shi. 2023. "Transposon Polymorphism and Its Potential Impacts on Brown Planthopper (Nilaparvata lugens Stål) Resistance in Rice (Oryza sativa L.)" Agronomy 13, no. 7: 1699. https://doi.org/10.3390/agronomy13071699

APA Style

Wang, H., Liao, Z., Gao, Y., Zhang, L., Lei, W., Huang, H., Lei, S., Jiang, M., Chen, S., & Shi, L. (2023). Transposon Polymorphism and Its Potential Impacts on Brown Planthopper (Nilaparvata lugens Stål) Resistance in Rice (Oryza sativa L.). Agronomy, 13(7), 1699. https://doi.org/10.3390/agronomy13071699

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop