Phenotypic Characterization and Gene Mapping of a Spiral Leaf and Dwarf (sld) Mutant from Tetraploid Common Tobacco (Nicotiana tabacum L.)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials and Genetic Populations
2.2. Phenotypic Investigation and Statistical Analysis
2.3. Investigation and Statistical Analysis of Agronomic Characteristics
2.4. Genomic DNA Extraction and SSR Analysis
2.5. Gene Linkage Map Construction and Genetic Distance Analysis
3. Results
3.1. Phenotypic Characteristics of the sld Mutant
3.2. Main Agronomic Characteristics of the sld Mutant
3.3. Genetic Analysis of the sld Mutant
3.4. Gene Mapping of the sld Mutant
4. Discussion
4.1. Inheritance Patterns of Visible Mutation Phenotypes Such as Spiral Leaf and Plant Dwarfing in Tobacco
4.2. Inheritance Patterns of Dwarfing/Semi-Dwarfing and Leaf-Curling Mutations in Monocotyledons and Dicotyledons
4.3. Research on Curled Leaves and Plant Height of Tobacco
4.4. Construction and Application of Tobacco SSR Marker Linkage Map
4.5. Limitations and Prospects of SSR Marker Gene Mapping for the sld Mutant in Tobacco
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Masanori, T.; Nishimura, A.; Aida, M.; Tasaka, M.; Matsuoka, M. Transgenic tobacco over-expressing a homeobox gene shows a developmental interaction between leaf morphogenesis and phyllotaxy. Plant Cell Physiol. 1999, 40, 657–667. [Google Scholar] [CrossRef]
- Johnson, K.; Lenhard, M. Genetic control of plant organ growth. New Phytol. 2011, 191, 319–333. [Google Scholar] [CrossRef]
- Powell, A.E.; Lenhard, M. Control of organ size in plants. Curr. Biol. 2012, 22, R360–R367. [Google Scholar] [CrossRef]
- Lenhard, M. All’s well that ends well: Arresting cell proliferation in leaves. Dev. Cell. 2012, 22, 9–11. [Google Scholar] [CrossRef]
- Du, F.; Guan, C.M.; Jiao, Y.L. Molecular mechanisms of leaf morphogenesis. Mol. Plant 2018, 11, 1117–1134. [Google Scholar] [CrossRef]
- Conklin, P.A.; Strable, J.; Li, S.J.; Scanlon, M.J. On the mechanisms of development in monocot and eudicot leaves. New Phytol. 2019, 221, 706–724. [Google Scholar] [CrossRef]
- Hudson, A.; Waites, R. Early events in leaf development. Semin. Cell Dev. Biol. 1998, 9, 207–211. [Google Scholar] [CrossRef]
- Nelissen, H.; Gonzalez, N.; Inzé, D. Leaf growth in dicots and monocots: So different yet so alike. Curr. Opin. Plant Biol. 2016, 33, 72–76. [Google Scholar] [CrossRef]
- Tsukaya, H. Leaf shape diversity with an emphasis on leaf contour variation, developmental background, and adaptation. Semin. Cell Dev. Biol. 2017, 79, 48–57. [Google Scholar] [CrossRef]
- Dong, J.Q.; Huang, H. Auxin polar transport flanking incipient primordium initiates leaf adaxial-abaxial polarity patterning. J. Integr. Plant Biol. 2018, 60, 455–464. [Google Scholar] [CrossRef] [PubMed]
- Parnis, A.; Cohen, O.; Gutfinger, T.; Hareven, D.; Zamir, D.; Lifschitz, E. The dominant developmental mutants of tomato, Mouse-ear and Curl, are associated with distinct modes of abnormal transcriptional regulation of a Knotted gene. Plant Cell 1997, 9, 2143–2158. [Google Scholar] [CrossRef]
- Cho, S.H.; Lee, C.H.; Gi, E.; Yim, Y.; Koh, H.-J.; Kang, K.; Paek, N.C. The Rice Rolled Fine Striped (RFS) CHD3/Mi-2 chromatin remodeling factor epigenetically regulates genes involved in oxidative stress responses during leaf development. Front. Plant Sci. 2018, 9, 364. [Google Scholar] [CrossRef]
- Zhou, Y.B.; Wang, D.; Wu, T.; Yang, Y.Z.; Liu, C.; Yan, L.; Tang, D.Y.; Zhao, X.Y.; Zhu, Y.H.; Lin, J.Z.; et al. LRRK1, a receptor-like cytoplasmic kinase, regulates leaf rolling through modulating bulliform cell development in rice. Mol. Breed. 2018, 38, 48. [Google Scholar] [CrossRef]
- Gao, L.L.; Yang, G.H.; Li, Y.F.; Fan, N.N.; Li, H.J.; Zhang, M.; Xu, R.B.; Zhang, M.Y.; Zhao, A.J.; Ni, Z.F.; et al. Fine mapping and candidate gene analysis of a QTL associated with leaf rolling index on chromosome 4 of maize (Zea mays L.). Theor. Appl. Genet. 2019, 132, 3047–3062. [Google Scholar] [CrossRef] [PubMed]
- Xiang, J.J.; Zhang, G.H.; Qian, Q.; Xue, H.W. Semi-rolled leaf1 encodes a putative glycosylphosphatidylinositol-anchored protein and modulates rice leaf rolling by regulating the formation of bulliform cells. Plant Physiol. 2012, 159, 1488–1500. [Google Scholar] [CrossRef] [PubMed]
- Li, W.Q.; Zhang, M.J.; Gan, P.F.; Qiao, L.; Yang, S.Q.; Miao, H.; Wang, G.F.; Zhang, M.M.; Liu, W.T.; Li, H.F.; et al. CLD1/SRL1 modulates leaf rolling by affecting cell wall formation, epidermis integrity and water homeostasis in rice. Plant J. 2017, 92, 904–923. [Google Scholar] [CrossRef] [PubMed]
- Nath, U.; Crawford, B.C.W.; Carpenter, R.; Coen, E. Genetic control of surface curvature. Science 2003, 299, 1404–1407. [Google Scholar] [CrossRef]
- Zhang, G.F.; Zhao, H.T.; Zhang, C.G.; Li, X.Y.; Lyu, Y.Y.; Qi, D.M.; Cui, Y.W.; Hu, L.; Wang, Z.J.; Liang, Z.; et al. TCP7 functions redundantly with several Class I TCPs and regulates endoreplication in Arabidopsis. J. Integr. Plant Biol. 2019, 61, 1151–1170. [Google Scholar] [CrossRef]
- He, Z.M.; Zhou, X.M.; Chen, J.M.; Yin, L.T.; Zeng, Z.H.; Xiang, J.; Liu, S.C. Identification of a consensus DNA-binding site for the TCP domain transcription factor TCP2 and its important roles in the growth and development of Arabidopsis. Mol. Biol. Rep. 2021, 48, 2223–2233. [Google Scholar] [CrossRef]
- Zhang, G.H.; Xu, Q.; Zhu, X.D.; Qian, Q.; Xue, H.W. SHALLOT-LIKE1 is a KANADI transcription factor that modulates rice leaf rolling by regulating leaf abaxial cell development. Plant Cell 2009, 21, 719–735. [Google Scholar] [CrossRef]
- Rong, F.X.; Chen, F.F.; Huang, L.; Zhang, J.Y.; Zhang, C.W.; Hou, D.; Cheng, Z.H.; Weng, Y.Q.; Chen, P.; Li, Y.H. A mutation in class III homeodomain-leucine zipper (HD-ZIP III) transcription factor results in curly leaf (cul) in cucumber (Cucumis sativus L.). Theor. Appl. Genet. 2019, 132, 113–123. [Google Scholar] [CrossRef]
- Li, Y.Y.; Shen, A.; Xiong, W.; Sun, Q.L.; Luo, Q.; Song, T.; Li, Z.L.; Luan, W.J. Overexpression of OsHox32 results in pleiotropic effects on plant type architecture and leaf development in Rice. Rice 2016, 9, 46. [Google Scholar] [CrossRef] [PubMed]
- Juarez, M.T.; Kui, J.S.; Thomas, J.; Heller, B.A.; Timmermans, M.C.P. microRNA-mediated repression of rolled leaf1 specifies maize leaf polarity. Nature 2004, 428, 84–88. [Google Scholar] [CrossRef]
- Merelo, P.; Ram, H.; Caggiano, M.P.; Ohno, C.; Ott, F.; Straub, D.; Graeff, M.; Cho, S.K.; Yang, S.W.; Wenkel, S.; et al. Regulation of MIR165/166 by class II and class III homeodomain leucine zipper proteins establishes leaf polarity. Proc. Natl. Acad. Sci. USA 2016, 113, 11973–11978. [Google Scholar] [CrossRef] [PubMed]
- Mallory, A.C.; Vaucheret, H. Functions of microRNAs and related small RNAs in plants. Nat. Genet. 2006, 38, S31–S36. [Google Scholar] [CrossRef] [PubMed]
- Zou, L.P.; Sun, X.H.; Zhang, Z.G.; Liu, P.; Wu, J.X.; Tian, C.J.; Qiu, J.L.; Lu, T.G. Leaf rolling controlled by the homeodomain leucine zipper class IV gene Roc5 in rice. Plant Physiol. 2011, 156, 1589–1602. [Google Scholar] [CrossRef]
- Fang, J.J.; Guo, T.T.; Xie, Z.W.; Chun, Y.; Zhao, J.F.; Peng, L.X.; Zafar, S.A.; Yuan, S.J.; Xiao, L.T.; Li, X.Y. The URL1-ROC5-TPL2 transcriptional repressor complex represses the ACL1 gene to modulate leaf rolling in rice. Plant Physiol. 2021, 185, 1722–1744. [Google Scholar] [CrossRef]
- Cho, S.H.; Yoo, S.C.; Zhang, H.T.; Pandeya, D.; Koh, H.J.; Hwang, J.Y.; Kim, G.T.; Paek, N.C. The rice narrow leaf2 and narrow leaf3 loci encode WUSCHEL-related homeobox 3A (OsWOX3A) and function in leaf, spikelet, tiller and lateral root development. New Phytol. 2013, 198, 1071–1084. [Google Scholar] [CrossRef]
- Dai, M.Q.; Hu, Y.F.; Zhao, Y.; Liu, H.F.; Zhou, D.X. A WUSCHEL-LIKE HOMEOBOX gene represses a YABBY gene expression required for rice leaf development. Plant Physiol. 2007, 144, 380–390. [Google Scholar] [CrossRef]
- Iwakawa, H.; Ueno, Y.; Semiarti, E.; Onouchi, H.; Kojima, S.; Tsukaya, H.; Hasebe, M.; Soma, T.; Ikezaki, M.; Machida, C.; et al. The ASYMMETRIC LEAVES2 gene of Arabidopsis thaliana, required for formation of a symmetric flat leaf lamina, encodes a member of a novel family of proteins characterized by cysteine repeats and a leucine zipper. Plant Cell Physiol. 2002, 43, 467–478. [Google Scholar] [CrossRef]
- Shuai, B.; Reynaga-Peña, C.G.; Springer, P.S. The LATERAL ORGAN BOUNDARIES gene defines a novel, plant-specific gene family. Plant Physiol. 2002, 129, 747–761. [Google Scholar] [CrossRef] [PubMed]
- Nakazawa, M.; Ichikawa, T.; Ishikawa, A.; Kobayashi, H.; Tsuhara, Y.; Kawashima, M.; Suzuki, K.; Muto, S.; Matsui, M. Activation tagging, a novel tool to dissect the functions of a gene family. Plant J. 2003, 34, 741–750. [Google Scholar] [CrossRef] [PubMed]
- Chalfun-Junior, A.; Franken, J.; Mes, J.J.; Marsch-Martinez, N.; Pereira, A.; Angenent, G.C. ASYMMETRIC LEAVES2-LIKE1 gene, a member of the AS2/LOB family, controls proximaldistal patterning in Arabidopsis petals. Plant Mol. Biol. 2005, 57, 559–575. [Google Scholar] [CrossRef] [PubMed]
- Alabadí, D.; Blázquez, M.A.; Carbonell, J.; Ferrándiz, C.; Pérez-Amador, M.A. Instructive roles for hormones in plant development. Int. J. Dev. Biol. 2009, 53, 1597–1608. [Google Scholar] [CrossRef] [PubMed]
- Murray, J.A.H.; Jones, A.; Godin, C.; Traas, J. Systems analysis of shoot apical meristem growth and development: Integrating hormonal and mechanical signaling. Plant Cell 2012, 24, 3907–3919. [Google Scholar] [CrossRef]
- Liu, S.D.; Hu, Q.N.; Luo, S.; Li, Q.Q.; Yang, X.Y.; Wang, X.L.; Wang, S.C. Expression of wild-type PtrIAA14.1, a poplar Aux/IAA gene causes morphological changes in Arabidopsis. Front. Plant Sci. 2015, 6, 388. [Google Scholar] [CrossRef]
- Hou, Y.M.; Li, H.X.; Zhai, L.L.; Xie, X.; Li, X.Y.; Bian, S.M. Identification and functional characterization of the Aux/IAA gene VcIAA27 in blueberry. Plant Signal. Behav. 2020, 15, 1700327. [Google Scholar] [CrossRef]
- Pekker, I.; Alvarez, J.P.; Eshed, Y. Auxin response factors mediate Arabidopsis organ asymmetry via modulation of KANADI activity. Plant Cell 2005, 17, 2899–2910. [Google Scholar] [CrossRef]
- Cheng, M.L.; Lo, S.F.; Hsiao, A.S.; Hong, Y.F.; Yu, S.M.; Ho, T.H.D. Ectopic expression of WINDING 1 leads to asymmetrical distribution of auxin and a spiral phenotype in rice. Plant Cell Physiol. 2017, 58, 1494–1506. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.I.; Sharkhuu, A.; Jin, J.B.; Li, P.; Jeong, J.C.; Baek, D.; Lee, S.Y.; Blakeslee, J.J.; Murphy, A.S.; Bohnert, H.J.; et al. yucca6, a dominant mutation in Arabidopsis, affects auxin accumulation and auxin-related phenotypes. Plant Physiol. 2007, 145, 722–735. [Google Scholar] [CrossRef]
- Cao, X.; Yang, H.L.; Shang, C.Q.; Ma, S.; Liu, L.; Cheng, J.L. The Roles of Auxin Biosynthesis YUCCA Gene Family in Plants. Int. J. Mol. Sci. 2019, 20, 6343. [Google Scholar] [CrossRef]
- Liu, F.; Wang, P.D.; Zhang, X.B.; Li, X.F.; Yan, X.H.; Fu, D.H.; Wu, G. The genetic and molecular basis of crop height based on a rice model. Planta 2018, 247, 1–26. [Google Scholar] [CrossRef]
- Kieffer, M.; Master, V.; Waites, R.; Davies, B. TCP14 and TCP15 affect internode length and leaf shape in Arabidopsis. Plant J. 2011, 68, 147–158. [Google Scholar] [CrossRef]
- Bae, K.D.; Um, T.Y.; Yang, W.T.; Park, T.H.; Hong, S.Y.; Kim, K.M.; Chung, Y.S.; Yun, D.J.; Kim, D.H. Characterization of dwarf and narrow leaf (dnl-4) mutant in rice. Plant Signal. Behav. 2020, 16, 1849490. [Google Scholar] [CrossRef]
- Liu, C.; Wang, J.L.; Huang, T.D.; Wang, F.; Yuan, F.; Cheng, X.M.; Zhang, Y.; Shi, S.W.; Wu, J.S.; Liu, K.D. A missense mutation in the VHYNP motif of a DELLA protein causes a semi-dwarf mutant phenotype in Brassica napus. Theor. Appl. Genet. 2010, 121, 249–258. [Google Scholar] [CrossRef]
- Wu, J.; Kong, X.Y.; Wan, J.M.; Liu, X.Y.; Zhang, X.; Guo, X.P.; Zhou, R.H.; Zhao, G.Y.; Jing, R.L.; Fu, X.D.; et al. Dominant and pleiotropic effects of a GAI gene in wheat results from a lack of interaction between DELLA and GID1. Plant Physiol. 2011, 157, 2120–2130. [Google Scholar] [CrossRef]
- Zhao, M.C.; Zhi, H.; Zhang, X.; Jia, G.Q.; Diao, X.M. Retrotransposon-mediated DELLA transcriptional reprogramming underlies semi-dominant dwarfism in foxtail millet. Crop J. 2019, 007, 458–468. [Google Scholar] [CrossRef]
- Fambrini, M.; Mariotti, L.; Parlanti, S.; Picciarelli, P.; Salvini, M.; Ceccarelli, N.; Pugliesi, C. The extreme dwarf phenotype of the GA-sensitive mutant of sunflower, dwarf2, is generated by a deletion in the ent-kaurenoic acid oxidase1 (HaKAO1) gene sequence. Plant Mol. Biol. 2011, 75, 431–450. [Google Scholar] [CrossRef]
- Tamaoki, M.; Kusaba, S.; Kano-Murakami, Y.; Matsuoka, M. Ectopic expression of a tobacco homeobox gene, NTH15, dramatically alters leaf morphology and hormone levels in transgenic tobacco. Plant Cell Physiol. 1997, 38, 917–927. [Google Scholar] [CrossRef]
- Tanaka-Ueguchi, M.; Itoh, H.; Oyama, N.; Koshioka, M.; Matsuoka, M. Over-expression of a tobacco homeobox gene, NTH15, decreases the expression of a gibberellin biosynthetic gene encoding GA 20-oxidase. Plant J. 1998, 15, 391–400. [Google Scholar] [CrossRef]
- Sakamoto, T.; Kamiya, N.; Ueguehi-Tanaka, M.; Iwahori, S.; Matsuoka, M. KNOX homeodomain protein directly suppresses the expression of a gibberellin biosynthetic gene in the tobacco shoot apical meristem. Genes Dev. 2001, 15, 581–590. [Google Scholar] [CrossRef] [PubMed]
- Mori, M.; Nomura, T.; Ooka, H.; Ishizaka, M.; Yokota, T.; Sugimoto, K.; Okabe, K.; Kajiwara, H.; Satoh, K.; Yamamoto, K.; et al. Isolation and characterization of a rice dwarf mutant with a defect in brassinosteroid biosynthesis. Plant Physiol. 2002, 130, 1152–1161. [Google Scholar] [CrossRef] [PubMed]
- Hong, Z.; Ueguchi-Tanaka, M.; Shimizu-Sato, S.; Inukai, Y.; Fujioka, S.; Shimada, Y.; Takatsuto, S.; Agetsuma, M.; Yoshida, S.; Watanabe, Y.; et al. Loss-of-function of a rice brassinosteroid biosynthetic enzyme, C-6 oxidase, prevents the organized arrangement and polar elongation of cells in the leaves and stem. Plant J. 2002, 32, 495–508. [Google Scholar] [CrossRef] [PubMed]
- Hong, Z.; Ueguchi-Tanaka, M.; Umemura, K.; Uozu, S.; Fujioka, S.; Takatsuto, S.; Yoshida, S.; Ashikari, M.; Kitano, H.; Matsuoka, M. A rice brassinosteroid-deficient mutant, ebisu dwarf (d2), is caused by a loss of function of a new member of cytochrome P450. Plant Cell 2003, 15, 2900–2910. [Google Scholar] [CrossRef]
- Hong, Z.; Ueguchi-Tanaka, M.; Fujioka, S.; Takatsuto, S.; Yoshida, S.; Hasegawa, Y.; Ashikari, M.; Kitano, H.; Matsuoka, M. The Rice brassinosteroid-deficient dwarf2 mutant, defective in the rice homolog of Arabidopsis DIMINUTO/DWARF1, is rescued by the endogenously accumulated alternative bioactive brassinosteroid, dolichosterone. Plant Cell 2005, 17, 2243–2254. [Google Scholar] [CrossRef]
- Tanabe, S.; Ashikari, M.; Fujioka, S.; Takatsuto, S.; Yoshida, S.; Yano, M.; Yoshimura, A.; Kitano, H.; Matsuoka, M.; Fujisawa, Y.; et al. A novel cytochrome P450 is implicated in brassinosteroid biosynthesis via the characterization of a rice dwarf mutant, dwarf11, with reduced seed length. Plant Cell 2005, 17, 776–790. [Google Scholar] [CrossRef]
- Sakamoto, T.; Morinaka, Y.; Ohnishi, T.; Sunohara, H.; Fujioka, S.; Ueguchi-Tanaka, M.; Mizutani, M.; Sakata, K.; Takatsuto, S.; Yoshida, S.; et al. Erect leaves caused by brassinosteroid deficiency increase biomass production and grain yield in rice. Nat. Biotechnol. 2006, 24, 105–109. [Google Scholar] [CrossRef]
- Yamamuro, C.; Ihara, Y.; Wu, X.; Noguchi, T.; Fujioka, S.; Takatsuto, S.; Ashikari, M.; Kitano, H.; Matsuoka, M. Loss of function of a rice brassinosteroid insensitive1 homolog prevents internode elongation and bending of the lamina joint. Plant Cell 2000, 12, 1591–1606. [Google Scholar] [CrossRef]
- Bai, M.Y.; Zhang, L.Y.; Gampala, S.S.; Zhu, S.W.; Song, W.Y.; Chong, K.; Wang, Z.Y. Functions of OsBZR1 and 14-3-3 proteins in brassinosteroid signaling in rice. Proc. Natl. Acad. Sci. USA 2007, 104, 13839–13844. [Google Scholar] [CrossRef]
- Tong, H.N.; Jin, Y.; Liu, W.B.; Li, F.; Fang, J.; Yin, Y.H.; Qian, Q.; Zhu, L.H.; Chu, C.C. DWARF AND LOW-TILLERING, a new member of the GRAS family, plays positive roles in brassinosteroid signaling in rice. Plant J. 2009, 58, 803–816. [Google Scholar] [CrossRef]
- Hu, X.M.; Qian, Q.; Xu, T.; Zhang, Y.; Dong, G.J.; Gao, T.; Xie, Q.; Xue, Y.B. The U-box E3 ubiquitin ligase TUD1 functions with a heterotrimeric G α subunit to regulate Brassinosteroid-mediated growth in rice. PLoS Genet. 2013, 9, e1003391. [Google Scholar] [CrossRef]
- Sui, P.F.; Jin, J.; Ye, S.; Mu, C.; Gao, J.; Feng, H.Y.; Shen, W.H.; Yu, Y.; Dong, A.W. H3K36 methylation is critical for brassinosteroid-regulated plant growth and development in rice. Plant J. 2012, 70, 340–347. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Li, W.Q.; Qin, Y.G.; Pan, Y.P.; Wang, X.F.; Weng, Y.Q.; Chen, P.; Li, Y.H. The cytochrome P450 gene CsCYP85A1 is a Putative Candidate for Super Compact-1 (Scp-1) plant architecture mutation in Cucumber (Cucumis sativus L.). Front. Plant Sci. 2017, 8, 266. [Google Scholar] [CrossRef]
- Hou, S.S.; Niu, H.H.; Tao, Q.Y.; Wang, S.H.; Gong, Z.H.; Li, S.; Weng, Y.Q.; Li, Z. A mutant in the CsDET2 gene leads to a systemic brassinosteriod deficiency and super compact phenotype in cucumber (Cucumis sativus L.). Theor. Appl. Genet. 2017, 130, 1693–1703. [Google Scholar] [CrossRef]
- Zhang, M.R.; Song, M.F.; Cheng, F.; Yang, Z.G.; Davoudi, M.; Chen, J.F.; Lou, Q.F. Identification of a putative candidate gene encoding 7-dehydrocholesterol reductase involved in brassinosteroids biosynthesis for compact plant architecture in Cucumber (Cucumis sativus L.). Theor. Appl. Genet. 2021, 134, 2023–2034. [Google Scholar] [CrossRef]
- Lin, H.; Wang, R.X.; Qian, Q.; Yan, M.X.; Meng, X.B.; Fu, Z.M.; Yan, C.Y.; Jiang, B.; Su, Z.; Li, J.Y.; et al. DWARF27, an iron-containing protein required for the biosynthesis of strigolactones, regulates rice tiller bud outgrowth. Plant Cell 2009, 21, 1512–1525. [Google Scholar] [CrossRef]
- Jiang, L.; Liu, X.; Xiong, G.S.; Liu, H.H.; Chen, F.L.; Wang, L.; Meng, X.B.; Liu, G.F.; Yu, H.; Yuan, Y.D.; et al. DWARF 53 acts as a repressor of strigolactone signalling in rice. Nature 2013, 504, 401–405. [Google Scholar] [CrossRef]
- Zhou, H.; Yang, M.; Zhao, L.; Zhu, Z.F.; Liu, F.X.; Sun, H.Y.; Sun, C.Q.; Tan, L.B. HIGH-TILLERING AND DWARF 12 regulates photosynthesis and plant architecture by affecting carotenoid biosynthesis in rice. J. Exp. Bot. 2021, 72, 1212–1224. [Google Scholar] [CrossRef] [PubMed]
- Sazuka, T.; Kamiya, N.; Nishimura, T.; Ohmae, K.; Sato, Y.; Imamura, K.; Nagato, Y.; Koshiba, T.; Nagamura, Y.; Ashikari, M.; et al. A rice tryptophan deficient dwarf mutant, tdd1, contains a reduced level of indole acetic acid and develops abnormal flowers and organless embryos. Plant J. 2009, 60, 227–241. [Google Scholar] [CrossRef]
- Wu, Q.Z.; Wu, X.R.; Zhang, X.F.; Jiang, C.H.; Xiao, B.G.; Zhang, Y.Y.; Wang, Y.Y.; Liu, G.S. Mapping of two white stem genes in tetraploid common tobacco (Nicotiana tabacum L.). Mol. Breed. 2014, 34, 1065–1074. [Google Scholar] [CrossRef]
- Wang, D.W.; Wang, S.M.; Chao, J.T.; Wu, X.R.; Sun, Y.H.; Li, F.X.; Lv, J.; Gao, X.M.; Liu, G.S.; Wang, Y.Y. Morphological phenotyping and genetic analyses of a new chemical-mutagenized population of tobacco (Nicotiana tabacum L.). Planta 2017, 246, 149–163. [Google Scholar] [CrossRef]
- Rogers, S.O.; Bendich, A.J. Extraction of DNA from plant tissues. In Plant Molecular Biology Manual; Gelvin, S.B., Schilperoort, R.A., Verma, D.P.S., Eds.; Springer: Dordrecht, The Netherlands, 1989; Volume A6, pp. 1–10. [Google Scholar] [CrossRef]
- Bindler, G.; Plieske, J.; Bakaher, N.; Gunduz, I.; Ivanov, N.; Hoeven, R.V.D.; Ganal, M.; Donini, P. A high density genetic map of tobacco (Nicotiana tabacum L.) obtained from large scale microsatellite marker development. Theor. Appl. Genet. 2011, 123, 219–230. [Google Scholar] [CrossRef] [PubMed]
- Gao, X.M.; Wu, X.R.; Liu, G.S.; Zhang, Z.L.; Chao, J.T.; Li, Z.Y.; Guo, Y.F.; Sun, Y.G. Characterization and mapping of a novel Premature Leaf Senescence mutant in common Tobacco (Nicotiana tabacum L.). Plants 2019, 8, 415. [Google Scholar] [CrossRef]
- Li, H.H.; Ribaut, J.M.; Li, Z.L.; Wang, J.K. Inclusive composite interval mapping (ICIM) for digenic epistasis of quantitative traits in biparental populations. Theor. Appl. Genet. 2008, 116, 243–260. [Google Scholar] [CrossRef]
- Kosambi, D.D. The estimation of map distance from recombination values. Ann. Eugen. 1944, 12, 172–175. [Google Scholar] [CrossRef]
- Zhang, S.P.; Liu, S.L.; Miao, H.; Wang, M.; Liu, P.N.; Wehner, T.C.; Gu, X.F. Molecular mapping and candidate gene analysis for Numerous Spines on the Fruit of Cucumber. J. Hered. 2016, 107, 471–477. [Google Scholar] [CrossRef]
- Bindler, G.; Hoeven, R.V.D.; Gunduz, I.; Plieske, J.; Ganal, M.; Rossi, L.; Gadani, F.; Donini, P. A microsatellite marker based linkage map of tobacco. Theor. Appl. Genet. 2007, 114, 341–349. [Google Scholar] [CrossRef]
- Yang, B.Z.; Zhou, S.D.; Ou, L.J.; Liu, F.; Yang, L.Y.; Zheng, J.Y.; Chen, W.C.; Zhang, Z.Q.; Yang, S.; Ma, Y.Q.; et al. A novel single-base mutation in CaBRI1 confers dwarf phenotype and brassinosteroid accumulation in pepper. Mol. Genet. Genom. 2020, 295, 343–356. [Google Scholar] [CrossRef]
- Miao, H.M.; Li, C.; Duan, Y.H.; Wei, L.B.; Ju, M.; Zhang, H.Y. Identification of a Sidwf1 gene controlling short internode length trait in the sesame dwarf mutant dw607. Theor. Appl. Genet. 2020, 133, 73–86. [Google Scholar] [CrossRef]
- Sang, X.C.; Du, C.; Wang, X.W.; Yang, Z.L.; Ling, Y.H.; Zhao, F.M.; Li, Y.F.; He, G.H. Identification and gene mapping of dwarf and brittle culm mutant dbc1 in Oryza Sativa. Acta Agron. Sin. 2013, 39, 626–631. [Google Scholar] [CrossRef]
- Adedze, Y.M.N.; Wei, X.J.; Sheng, Z.H.; Jiao, G.A.; Tang, S.Q.; Hu, P.S. Characterization of a rice dwarf and narrow leaf 2 mutant. Biol. Plant 2017, 61, 85–94. [Google Scholar] [CrossRef]
- Hua, W.; Tan, C.; Xie, J.Z.; Zhu, J.H.; Shang, Y.; Yang, J.M.; Zhang, X.Q.; Wu, X.J.; Wang, J.M.; Li, C.D. Alternative splicing of a barley gene results in an excess-tillering and semi-dwarf mutant. Theor. Appl. Genet. 2020, 133, 163–177. [Google Scholar] [CrossRef] [PubMed]
- Li, J.P.; Soomro, A.A.; Xiao, G.; Chen, F.J.; Yuan, L.X.; Gu, R.L. Phenotypic characterization and genetic mapping of the dwarf mutant m34 in maize. J. Integr. Agric. 2019, 18, 14–23. [Google Scholar] [CrossRef]
- Li, Y.H.; Yang, L.M.; Pathak, M.; Li, D.W.; He, X.M.; Weng, Y.Q. Fine genetic mapping of cp: A recessive gene for compact (dwarf) plant architecture in cucumber, Cucumis sativus L. Theor. Appl. Genet. 2011, 123, 973–983. [Google Scholar] [CrossRef]
- Zeng, X.H.; Zhu, L.X.; Chen, Y.L.; Qi, L.P.; Pu, Y.Y.; Wen, J.; Yi, B.; Shen, J.X.; Ma, C.Z.; Tu, J.X.; et al. Identification, fine mapping and characterisation of a dwarf mutant (bnac.dwf) in Brassica napus. Theor. Appl. Genet. 2011, 122, 421–428. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Xiang, F.J.; Zhang, W.; Yan, J.D.; Li, X.M.; Zhong, M.; Yang, P.; Chen, C.Y.; Liu, X.M.; Mao, D.H.; et al. Characterization and fine mapping of a new dwarf mutant in Brassica napus. BMC Plant Biol. 2021, 21, 117. [Google Scholar] [CrossRef]
- Zhao, B.; Wang, B.; Li, Z.H.; Guo, T.; Zhao, J.W.; Guan, Z.L.; Liu, K.D. Identification and characterization of a new dwarf locus DS-4 encoding an aux/IAA7 protein in Brassica napus. Theor. Appl. Genet. 2019, 132, 1435–1449. [Google Scholar] [CrossRef]
- Li, H.T.; Li, J.J.; Song, J.R.; Zhao, B.; Guo, C.C.; Wang, B.; Zhang, Q.H.; Wang, J.; King, G.J.; Liu, K.D. An auxin signaling gene BnaA3.IAA7 contributes to improved plant architecture and yield heterosis in rapeseed. New Phytol. 2019, 222, 837–851. [Google Scholar] [CrossRef]
- Zheng, M.; Hu, M.L.; Yang, H.L.; Tang, M.; Zhang, L.; Liu, H.F.; Li, X.K.; Liu, J.L.; Sun, X.C.; Fan, S.H.; et al. Three BnaIAA7 homologs are involved in auxin/brassinosteroid-mediated plant morphogenesis in rapeseed (Brassica napus L.). Plant Cell Rep. 2019, 38, 883–897. [Google Scholar] [CrossRef]
- Wang, X.D.; Zheng, M.; Liu, H.F.; Zhang, L.; Chen, F.; Zhang, W.; Fan, S.H.; Peng, M.L.; Hu, M.L.; Wang, H.Z.; et al. Fine-mapping and transcriptome analysis of a candidate gene controlling plant height in Brassica napus L. Biotechnol Biofuels. 2020, 13, 42. [Google Scholar] [CrossRef]
- Wang, Y.K.; Chen, W.J.; Chu, P.; Wan, S.B.; Yang, M.; Wang, M.M.; Guan, R.Z. Mapping a major QTL responsible for dwarf architecture in Brassica napus using a single-nucleotide polymorphism marker approach. BMC Plant Biol. 2016, 16, 178. [Google Scholar] [CrossRef]
- Cheng, H.T.; Jin, F.W.; Zaman, Q.U.; Ding, B.L.; Hao, M.Y.; Wang, Y.; Huang, Y.; Wells, R.; Dong, Y.; Hu, Q. Identification of Bna.IAA7.C05 as allelic gene for dwarf mutant generated from tissue culture in oilseed rape. BMC Plant Biol. 2019, 19, 500. [Google Scholar] [CrossRef]
- Yang, M.; Huang, C.W.; Wang, M.M.; Fan, H.; Wan, S.B.; Wang, Y.M.; He, J.B.; Guan, R.Z. Fine mapping of an up-curling leaf locus (BnUC1) in Brassica napus. BMC Plant Biol. 2019, 19, 324. [Google Scholar] [CrossRef]
- Huang, C.W.; Yang, M.; Shao, D.L.; Wang, Y.M.; Wan, S.B.; He, J.B.; Meng, Z.Q.; Guan, R.Z. Fine mapping of the BnUC2 locus related to leaf up-curling and plant semi-dwarfing in Brassica napus. BMC Genom. 2020, 21, 530. [Google Scholar] [CrossRef]
- Wang, M.L.; Zhao, Y.; Chen, F.; Yin, X.C. Inheritance and potentials of a mutated dwarfing gene ndf1 in Brassica napus. Plant Breed. 2004, 123, 449–453. [Google Scholar] [CrossRef]
- Mei, D.S.; Wang, H.Z.; Li, Y.C.; Hu, Q.; Li, Y.D.; Xu, Y.S. The discovery and genetic analysis of dwarf mutation 99CDAM in Brassica napus L. Hereditas 2006, 28, 851–857. (In Chinese) [Google Scholar] [CrossRef]
- Nishimura, A.; Tamaoki, M.; Sakamoto, T.; Matsuoka, M. Over-expression of tobacco knotted1-type class1 homeobox genes alters various leaf morphology. Plant Cell Physiol. 2000, 41, 583–590. [Google Scholar] [CrossRef]
- Srinivasan, C.; Liu, Z.R.; Scorza, R. Ectopic expression of class 1 KNOX genes induce adventitious shoot regeneration and alter growth and development of tobacco (Nicotiana tabacum L.) and European plum (Prunus domestica L.). Plant Cell Rep. 2011, 30, 655–664. [Google Scholar] [CrossRef]
- Xu, Q.L.; Gao, N.; Ruan, M.Y.; Ding, W.Q.; Hu, X.; Wang, C.Y.; Wang, X.Y. Ectopic expression of the PttKN1 gene induced altered leaf morphology and hormonal levels in transgenic tobacco. J. Plant Biochem. Biotechnol. 2015, 24, 197–203. [Google Scholar] [CrossRef]
- Cheng, L.R.; Yang, A.G.; Jiang, C.H.; Ren, M.; Zhang, Y.; Feng, Q.F.; Wang, S.M.; Guan, Y.S.; Luo, C.G. Quantitative trait loci mapping for plant height in tobacco using linkage and association mapping methods. Crop Sci. 2015, 55, 641–664. [Google Scholar] [CrossRef]
- Zhao, L.; Yang, X.; Du, H.L.; Li, M.M.; Ding, F.Q.; Lv, Q.X.; Wang, C.; Wang, P.P.; Zhang, K.X.; Nie, T.K.; et al. Reduced GA biosynthesis in GmRAV-transgenic tobacco causes the dwarf phenotype. Russ. J. Plant Physiol. 2016, 63, 690–694. [Google Scholar] [CrossRef]
- Wang, N.; Sang, X.C.; Li, Y.F.; Yang, Z.L.; Zhao, F.M.; Ling, Y.H.; Zhang, Z.S.; He, G.H. Identification and gene mapping of a novel mutant supernumerary lodicules (snl) in rice. J. Integr. Plant Biol. 2010, 52, 265–272. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.W.; He, H.L.; Yuan, G.; Du, H.; Yuan, L.H.; Li, Z.; Yao, D.Q.; Pan, J.S.; Cai, R. Identification and mapping of molecular markers linked to the tuberculate fruit gene in the cucumber (Cucumis sativus L.). Theor. Appl. Genet. 2010, 120, 645–654. [Google Scholar] [CrossRef]
- Miao, H.; Zhang, S.P.; Wang, X.W.; Zhang, Z.H.; Li, M.; Mu, S.Q.; Cheng, Z.C.; Zhang, R.W.; Huang, S.W.; Xie, B.Y.; et al. A linkage map of cultivated cucumber (Cucumis sativus L.) with 248 microsatellite marker loci and seven genes for horticulturally important traits. Euphytica 2011, 182, 167–176. [Google Scholar] [CrossRef]
- Piquemal, J.; Cinquin, E.; Couton, F.; Rondeau, C.; Seignoret, E.; Doucet, I.; Perret, D.; Villeger, M.J.; Vincourt, P.; Blanchard, P. Construction of an oilseed rape (Brassica napus L.) genetic map with SSR markers. Theor. Appl. Genet. 2005, 111, 1514–1523. [Google Scholar] [CrossRef] [PubMed]
- Cheng, X.M.; Xu, J.S.; Xia, S.; Gu, J.X.; Yang, Y.; Fu, J.; Qian, X.J.; Zhang, S.C.; Wu, J.S.; Liu, K.D. Development and genetic mapping of microsatellite markers from genome survey sequences in Brassica napus. Theor. Appl. Genet. 2009, 118, 1121–1131. [Google Scholar] [CrossRef]
- Kenton, A.; Parokonny, A.S.; Gleba, Y.Y.; Bennett, M.D. Characterization of the Nicotiana tabacum L. genome by molecular cytogenetics. Mol. Gen. Genet. 1993, 240, 159–169. [Google Scholar] [CrossRef]
- Lim, K.Y.; Matyasek, R.; Kovarik, A.; Leitch, A.R. Genome evolution in allotetraploid Nicotiana. Biol. J. Linn. Soc. 2004, 82, 599–606. [Google Scholar] [CrossRef]
- Röder, M.S.; Korzun, V.; Wendehake, K.; Plaschke, J.; Tixier, M.H.; Leroy, P.; Ganal, M.W. A microsatellite map of wheat. Genetics 1998, 149, 2007–2023. [Google Scholar] [CrossRef]
- Tong, Z.J.; Yang, Z.M.; Chen, X.J.; Jiao, F.C.; Li, X.Y.; Wu, X.F.; Gao, Y.L.; Xiao, B.G.; Wu, W.R. Large-scale development of microsatellite markers in Nicotiana tabacum and construction of a genetic map of flue-cured tobacco. Plant Breed. 2012, 131, 674–680. [Google Scholar] [CrossRef]
- Tong, Z.J.; Xiao, B.G.; Jiao, F.C.; Fang, D.H.; Zeng, J.M.; Wu, X.F.; Chen, X.J.; Yang, J.K.; Li, Y.P. Large-scale development of SSR markers in tobacco and construction of a linkage map in flue-cured tobacco. Breed. Sci. 2016, 66, 381–390. [Google Scholar] [CrossRef]
- Michel, V.; Julio, E.; Candresse, T.; Cotucheau, J.; Decorps, C.; Volpatti, R.; Moury, B.; Glais, L.; Dorlhac de Borne, F.; Decroocq, V.; et al. NtTPN1: A RPP8-like R gene required for Potato virus Y-induced veinal necrosis in tobacco. Plant J. 2018, 95, 700–714. [Google Scholar] [CrossRef]
- Bao, Y.G.; Ding, N.; Qin, Q.L.; Wu, X.; Martinez, N.; Miller, R.; Zaitlin, D.; Li, D.D.; Yang, S.M. Genetic mapping of the Ph gene conferring disease resistance to black shank in tobacco. Mol. Breed. 2019, 39, 122–131. [Google Scholar] [CrossRef]
- Sierro, N.; Battey, J.N.D.; Ouadi, S.; Bovet, L.; Goepfert, S.; Bakaher, N.; Peitsch, M.C.; Ivanov, N.V. Reference genomes and transcriptomes of Nicotiana sylvestris and Nicotiana tomentosiformis. Genome. Biol. 2013, 14, R60. [Google Scholar] [CrossRef] [PubMed]
- Sierro, N.; Battey, J.N.D.; Ouadi, S.; Bakaher, N.; Bovet, L.; Willig, A.; Goepfert, S.; Peitsch, M.C.; Ivanov, N.V. The tobacco genome sequence and its comparison with those of tomato and potato. Nat. Commun. 2014, 5, 3833. [Google Scholar] [CrossRef] [PubMed]
- Xiao, B.G.; Tan, Y.T.; Long, N.; Chen, X.J.; Tong, Z.J.; Dong, Y.; Li, Y.P. SNP-based genetic linkage map of tobacco (Nicotiana tabacum L.) using next-generation RAD sequencing. J. Biol. Res. 2015, 22, 11. [Google Scholar] [CrossRef] [PubMed]
- Gong, D.P.; Huang, L.; Xu, X.H.; Wang, C.Y.; Ren, M.; Wang, C.K.; Chen, M.L. Construction of a high-density SNP genetic map in flue-cured tobacco based on SLAF-seq. Mol. Breed. 2016, 36, 100. [Google Scholar] [CrossRef]
- Thimmegowda, G.C.; Ramadoss, S.K.; Kaikala, V.; Rathinavelu, R.; Thamalampudi, V.R.; Dhavala, V.N.C.; Saiprasad, G.V.S. Whole genome resequencing of tobacco (Nicotiana tabacum L.) genotypes and high-throughput SNP discovery. Mol. Breed. 2018, 38, 121. [Google Scholar] [CrossRef]
- Cheng, L.R.; Chen, X.C.; Jiang, C.H.; Ma, B.; Ren, M.; Cheng, Y.Z.; Liu, D.; Geng, R.M.; Yang, A.G. High-density SNP genetic linkage map construction and quantitative trait locus mapping for resistance to cucumber mosaic virus in tobacco (Nicotiana tabacum L.). Crop J. 2019, 7, 539–547. [Google Scholar] [CrossRef]
- Greene, E.A.; Codomo, C.A.; Taylor, N.E.; Henikoff, J.G.; Till, B.J.; Reynolds, S.H.; Enns, L.C.; Burtner, C.; Johnson, J.E.; Odden, A.R.; et al. Spectrum of chemically induced mutations from a large-scale reverse-genetic screen in Arabidopsis. Genetics 2003, 164, 731–740. [Google Scholar] [CrossRef]
- Henikoff, S.; Comai, L. Single-nucleotide mutations for plant functional genomics. Annu. Rev. Plant Biol. 2003, 54, 375–401. [Google Scholar] [CrossRef] [PubMed]
- Zan, Y.J.; Chen, S.; Ren, M.; Liu, G.X.; Liu, Y.T.; Si, H.; Liu, Z.W.; Liu, D.; Zhang, X.W.; Tong, Y.; et al. GenBank genomics highlight the genomic features, genetic diversity and regulation of morphological, metabolic and disease-resistance traits in Nicotiana tabacum. bioRxiv 2023, 529366. [Google Scholar] [CrossRef]
Parents and Populations | No. of Plants | No. of sld Mutant Phenotypes | No. of Wild-Type Phenotypes | Observed Separation Ratio | Expected Ratio | χ2 < χ20.05 = 3.841 |
---|---|---|---|---|---|---|
HD | 15 | 0 | 15 | - | - | - |
G3 | 15 | 0 | 15 | - | - | - |
sld | 15 | 15 | 0 | - | - | - |
(HD × sld) F1 | 15 | 0 | 15 | - | - | - |
(HD × sld) F2 | 167 | 40 | 127 | 1:3.18 | 1:3 | 0.098 |
(G3 × sld) F1 | 15 | 0 | 15 | - | - | - |
(G3 × sld) F2 | 503 | 112 | 391 | 1:3.49 | 1:3 | 2.005 |
((G3 × sld) × sld) BC1F1 | 392 | 193 | 199 | 1:1.03 | 1:1 | 0.092 |
Marker Name | Forward Primer (5′→3′) | Reverse Primer (5′→3′) | Repeat Motif | Repeat Number | Number of Detected Loci | Genome |
---|---|---|---|---|---|---|
PT60855 | TTCCTATCTTTCAATCTTAGATGTGTT | TCCCTCTCATCGTCGCTATC | GA | 33 | 1 | B |
PT40040 | CGCCGTCTCTCTCTACTCCA | TGGAAACTCTTTCCGTTTGA | TA | 1 | ||
PT51778 | AATGATCCAACAGAGCCCAG | CACTTGCTGTCCATCTTCCA | CA | 12 | 1 | S |
PT54913 | TACCGACCAAACATTCATCG | GAACAAATCCAGAAGTTGGGA | TA | 9 | 1 | S |
PT61414 | AAAGAAAGGAGGCATGCAAA | CAATGACTAATAGAATCGGTTACAGG | GA | 11 | 1 | S |
PT60933 | AACGCATGTTAATTATGAGTTCAA | TCGGAAGATTGAAATACGCC | TA | 17 | 1 | B |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, S.; Wu, X.; Guo, Y.; Wang, D.; Cheng, L.; Wang, Y.; Yang, A.; Liu, G. Phenotypic Characterization and Gene Mapping of a Spiral Leaf and Dwarf (sld) Mutant from Tetraploid Common Tobacco (Nicotiana tabacum L.). Agronomy 2023, 13, 2354. https://doi.org/10.3390/agronomy13092354
Wang S, Wu X, Guo Y, Wang D, Cheng L, Wang Y, Yang A, Liu G. Phenotypic Characterization and Gene Mapping of a Spiral Leaf and Dwarf (sld) Mutant from Tetraploid Common Tobacco (Nicotiana tabacum L.). Agronomy. 2023; 13(9):2354. https://doi.org/10.3390/agronomy13092354
Chicago/Turabian StyleWang, Shaomei, Xinru Wu, Yongfeng Guo, Dawei Wang, Lirui Cheng, Yuanying Wang, Aiguo Yang, and Guanshan Liu. 2023. "Phenotypic Characterization and Gene Mapping of a Spiral Leaf and Dwarf (sld) Mutant from Tetraploid Common Tobacco (Nicotiana tabacum L.)" Agronomy 13, no. 9: 2354. https://doi.org/10.3390/agronomy13092354