Next Article in Journal
Valorisation of Deinking Paper Sludge for Fertiliser Purposes: New Perspective in Sustainable Agriculture
Previous Article in Journal
Rapid Identification of Tropical Important Mealybugs Based on a Multiplex PCR Assay
Previous Article in Special Issue
Weighted Gene Co-Expression Network Analysis Uncovers Critical Genes and Pathways Involved in Soybean Response to Soybean Mosaic Virus
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Implications of the STAT5B and C1QBP Genes of Grain Aphid Sitobion avenae in the Transmission of Barley Yellow Dwarf Virus

State Key Laboratory for Crop Stress Resistance and High-Efficiency Production, Key Laboratory of Plant Protection Resources and Pest Management of Ministry of Education, Key Laboratory of Integrated Pest Management on the Loess Plateau of Ministry of Agriculture and Rural Affairs, College of Plant Protection, Northwest A&F University, Yangling 712100, China
*
Author to whom correspondence should be addressed.
Agronomy 2024, 14(12), 2787; https://doi.org/10.3390/agronomy14122787
Submission received: 24 October 2024 / Revised: 14 November 2024 / Accepted: 21 November 2024 / Published: 23 November 2024

Abstract

:
Many plant viruses are transmitted by insect vectors, and the transmission process is regulated by key genes within the vector. However, few of these genes have been reported. Previous studies in our laboratory have shown that the expression of the signal transducer and activator of transcription 5B (STAT5B) in viruliferous vector aphids carrying barley yellow dwarf virus (BYDV) was upregulated, and the complement component 1 Q subcomponent binding protein (C1QBP) within the aphid interacted with the coat protein (CP) and aphid transmission protein (ATP) of BYDV. In this study, we examined the expression levels of STAT5B and C1QBP in the vector aphid Sitobion avenae (Fabricius) (Hemiptera: Aphididae) using the qPCR method. We conducted this analysis during the acquisition accession periods (AAPs) and inoculation accession periods (IAPs) of the BYDV species GAV (BYDV-GAV). Furthermore, the effects of STAT5B and C1QBP on the acquisition, retention, and transmission of BYDV-GAV in S. avenae were verified using the RNA interference (RNAi) method. The results show the following: (1) the expression levels of STAT5B and C1QBP were significantly upregulated during the AAPs and IAPs of BYDV-GAV; (2) the silencing of STAT5B led to a significant increase in BYDV-GAV retention during IAPs; and (3) the silencing of C1QBP resulted in a notable decrease in BYDV-GAV acquisition during the AAPs, as well as a significant increase in BYDV-GAV retention during the IAPs. These results suggest that STAT5B and C1QBP in S. avenae play a role in BYDV-GAV transmission. These findings highlight the functions of the STAT5B and C1QBP genes and identify C1QBP as a potential target gene for further RNAi-based studies to control the transmission of BYDV-GAV.

1. Introduction

Plant viruses transmitted by insect vectors are one of the challenges agriculture faces today [1]. The dissemination of these viruses occurs through non-persistent, semi-persistent, or persistent transmission mechanisms, which are classified based on the duration between the acquisition access periods (AAPs) and the inoculation access periods (IAPs) [2,3]. Non-persistent viruses can be effectively acquired in seconds, while semi-persistent viruses can be acquired in minutes to hours. Both non-persistent and semi-persistent viruses are inoculated within seconds or minutes [4,5,6,7]. These two types of viruses are also called non-circulating viruses because virus particles cannot circulate in insect vectors [8,9,10]. The AAPs and IAPs of persistent viruses are longer than those of non-circulative viruses. Persistent viruses are also known as circulating viruses because the virus particles usually enter the intestinal tract through the mouth and esophagus of vectors along with the plant juices they feed on, then overcome the intestinal barrier to enter the hemolymph, and finally, are transported to various tissues. The virus particles break through the saliva glands barrier of vectors and are inoculated into healthy host plants during subsequent feeding [11,12,13].
Circulating viruses mainly rely on the receptors in vector insects to be acquired, circulated, and inoculated. For example, the cubilin protein (CUBN) in the vector Bemisia tabaci interacts with the coat protein (CP) of the tomato yellow leaf curl virus (TYLCV) to help it enter epithelial cells in the midgut [14,15]. Hemocyte-produced vitellogenin (Vg) can bind to rice stripe virus (RSV) in the vector Laodelphax striatellus to help the virus survive in hemolymphs and promote virus transmission [16]. The membrane-bound ephrin receptor (Eph) binds to the CP of turnip yellows virus (TuYV) in the vector Myzus persicae to aid in the intestinal absorption of the virus particles [17]. The binding of the Ras-related protein Rab-1A (RAB1) of L. striatellus to the nucleocapsid protein (NP) of RSV can lead to its transmission [18]. Discovering the receptors in vectors can help us understand the transmission mechanisms of plant viruses and provide an effective strategy for controlling the spread of the virus by intervening with these receptors [19,20,21,22]. Therefore, the study of identified and functionally validated receptors in vectors is particularly important.
Previous studies have found that the signal transducer and activator of transcription (STAT) regulates TYLCV accumulation in the vector B. tabaci [23], and the complement component 1 Q subcomponent binding protein (C1QBP) in the vector M. persicae regulates the acquisition of potato leaf roll virus (PLRV) and the transmission efficiency of the virus to host plants [24]. Additionally, previous studies in our laboratory using transcriptome data have shown that the expression of STAT5B was upregulated in viruliferous vector aphids carrying barley yellow dwarf virus (BYDV) [25], and yeast two-hybrid screening showed that C1QBP within the aphid interacted with the CP and aphid transmission protein (ATP) of BYDV [26]. However, the effects of the C1QBP and STAT5B genes in vector aphids on the transmission of BYDV are not clear.
Here, we studied (1) the expression levels of STAT5B and C1QBP in the vector aphid Sitobion avenae (Fabricius) (Hemiptera: Aphididae) during the AAPS and IAPS of the BYDV species GAV (BYDV-GAV) using the qPCR method and (2) the effects of STAT5B and C1QBP on the acquisition, retention, and transmission of BYDV-GAV in S. avenae using RNA interference (RNAi) assays. This research aimed to reveal the function of the STAT5B and C1QBP genes in the transmission of BYDV-GAV in S. avenae. The findings provide a theoretical basis for further study of the interaction mechanism of BYDV-GAV and S. avenae and potential target genes for further research based on RNAi to control BYDV-GAV.

2. Materials and Methods

2.1. Insect and Plant Virus Maintenance

A single apterous S. avenae adult was collected from a wheat leaf in a field in Yangling, Shaanxi province, transferred to wheat seedlings (Triticum aestivum L. cv. Aikang58), and kept in a cage (35 cm × 35 cm × 35 cm). The cage was placed in an artificial climate incubator under the conditions of (20 ± 1) °C, 60–80% relative humidity, and a 16 h/8 h (L:D) photoperiod. Fresh wheat seedlings, devoid of any apparent virus infection, were introduced every 15 days. The aphids were reared for more than 20 generations to establish a laboratory clone.
A single BYDV-GAV-infected wheat seedling was collected from a field in Yangling, Shaanxi province, and kept in a cage (35 cm × 35 cm × 35 cm). This cage was also kept in an artificial climate incubator under the conditions described above. Every 30 days, BYDV-GAV was transmitted to a new wheat seedling using the vector S. avenae. The method used was described by Hu et al. [6].
Every 30 days, the reverse transcription–polymerase chain reaction (RT-PCR) method was used to detect all four species of BYDV (i.e., PAV, GAV, GPV, and RMV) in the S. avenae clone and the BYDV-infected wheat seedling to ensure their status (i.e., that the S. avenae clone was virus-free and that the viruliferous plant was only infected with BYDV-GAV). The method and primer pairs used were described by Hu et al. [6].

2.2. Design of Primers

Specific primers were designed to amplify segments from the transcripts that contained the following genes (Table 1): BYDV-GAV CP (accession No: NC_004666.1), S. avenae STAT5B (accession No: PP 458364.1), S. avenae C1QBP (accession No: PP 480099.1), S. avenae β-actin (accession No: AY581121.1), and S. avenae green fluorescent protein (GFP, accession No: AB062168.1). S. avenae β-actin was used as an internal control gene in qPCR, and S. avenae GFP served as a negative control for interfering primers [27]. The primers used in this experiment were designed with Primer Premier 5.0 software, and the interfering primers were designed using SnapDragon-dsRNA Design (https://www.flyrnai.org/snapdragon, accessed on 25 October 2023).

2.3. Expression Analysis of STAT5B and C1QBP

Within 24 h of molting, the adult aphids were collected from the healthy wheat seedlings and transferred to the wheat seedlings infected with BYDV-GAV. Subsequently, at the end of 5 different AAPs (0 h (the aphids were not transferred to BYDV-GAV-infected wheat seedlings), 24 h, 48 h, 72 h, and 96 h), the aphids were collected and stored at −80 °C as separate acquisition treatments for the quantification of STAT5B and C1QBP. Similarly, within 24 h of molting, the adult aphids were collected from the BYDV-GAV-infected wheat seedlings and transferred to the healthy wheat seedlings. At the end of 5 different IAPs (0 h (the aphids were not transferred to healthy wheat seedlings), 24 h, 48 h, 72 h, and 96 h), the aphids were collected and stored at −80 °C as inoculation treatments for the quantification of STAT5B and C1QBP. A total of 6 biological replicates were used, and each sample contained 10 aphids.

2.4. Quantitative Real-Time Polymerase Chain Reaction (qPCR)

The relative expressions of STAT5B and C1QBP were determined in this study using qPCR assays, as previously described [27]. The total RNA of the aphids was extracted using the TRIZOL method and reverse-transcribed into cDNA using the Fast King RT Kit (Accurate Biology, Changsha, China). The qPCR reaction system was performed using a Quant Studio 5 Real-Time PCR System from Applied Biosystems (Pleasanton, CA, USA) with SYBR Green dye (Transgen, Beijing, China), adhering to the protocol provided by the manufacturer. The system (20 μL) was as follows: 10 μL of premix, 0.4 μL of forward primer, 0.4 μL of reverse primer, 2 μL of cDNA, and 7.2 μL of RNase-free water. The cycling conditions were as follows: 3 min at 95 °C; 40 cycles each of 30 s at 95 °C, 30 s at X °C, and 1 min at 72 °C (X °C indicates the optimal annealing temperature: β-actin—55 °C; STAT5B—57 °C; C1QBP—57 °C). The relative quantification of gene expression in S. avenae was determined using the 2−ΔΔCt method [28]. A total of 6 biological replicates were set in each treatment, with 10 aphids per replicate.
Using the BYDV-GAV CP plasmid constructed by Tong [26], in our laboratory, we built the absolute quantification standard curve for the BYDV-GAV CP gene. The plasmid concentration was detected using an ultraviolet-visible spectrophotometer (Nano-2000, Allsheng, Hangzhou, China), and the plasmid copy number was calculated using the following equation: copy number (copies/μL) = 6.02 × 1023 (copies/μL) × plasmid concentration (g/μL)/plasmid molecular weight (g/mol) [29]. The reaction system was diluted in 10-fold gradients to seven different concentrations (20 μL), with three replicates for absolute quantification, as follows: 10 μL of SuperMix, 0.4 μL each of upstream and downstream primers, 0.4 μL of ROX Reference Dye II, 2 μL of cDNA, and 6.8 μL of RNase-free H2O. The reaction program was as follows: pre-denaturation at 94 °C for 5 min, denaturation at 94 °C for 20 s, annealing at 56 °C for 30 s, and extension at 72 °C for 1 min for 40 cycles. The standard curve equation based on the Ct value and the logarithm of the plasmid copy number was y = −3.3399x + 37.288, with a determination coefficient R2 = 0.9991 and amplification efficiency of E = 99.3%. There was a good linear relationship between the two online plasmid dilution quality concentrations, indicating that this standard curve can accurately reflect the amplification of BYDV-GAV CP. Since the CP gene of BYDV-GAV is a single-copy gene, the CP gene copy number can be used as the copy number of BYDV-GAV.

2.5. Synthesis of dsRNA

STAT5B and C1QBP transcriptional templates were produced from the total S. avenae cDNA using gene-specific primers. The extended sequence of the T7 polymerase promoter (5′-TAATACGACTCACTATAGG-3′) was fused to the 5′-end of the gene-specific primers. Two separate PCR reactions, each with a single T7 promoter, were required to generate two separate single-promoter templates. The PCR products were purified using a universal DNA purification kit (Tiangen Biotech, Beijing, China) and used as a template for in vitro transcription. The dsRNA was synthesized using the T7 RiboMAX Express RNA interference (RNAi) System (Promega, Madison, WI, USA). The dsRNA was suspended in nuclease-free water, diluted from 1 mL to 10 μL, quantified with NanoDrop 2000, and analyzed using 1% agarose gel electrophoresis. The dsRNA was stored at −80 °C for future use. GFP dsRNA (dsGFP), serving as a negative control, was synthesized using the above method.

2.6. Injected dsRNA Assay of STAT5B, C1QBP and RNAi Efficiency

Within 24 h of molting, the virus-free adult aphids were placed in Petri dishes. Before the injection, the aphids were fixed on the injection table. A volume of 70 nL of dsGFP, dsSTAT5B, or dsC1QBP (5 μg/μL) was injected at a slow speed using 3.5 Drummond needles and the Nanoinject II nanoinjector (Drummond scientific, Broomall, PA, USA). The injection site was at the junction of the chest and abdomen. The injected adult aphids were transferred to wheat seedlings infected with BYDV-GAV and kept in an artificial climate incubator under the conditions described in Section 2.1. The aphids were collected at the end of 4 different AAPs (24 h, 48 h, 72 h, and 96 h) and stored at −80 °C for the quantification of STAT5B and C1QBP, respectively. A total of 4 biological replicates were used, and each sample contained 10 aphids.
The total RNA was extracted from the aforementioned samples and converted into cDNA through reverse transcription. The expression levels of STAT5B and C1QBP mRNA following dsRNA injection were assessed using qPCR. The efficiency of RNA interference was determined using the following formula [30]: RNAi efficiency = [(relative expression of the target gene in the dsGFP control group − relative expression of the target gene in the specific dsRNA treatment group)/relative expression of the target gene in the dsGFP control group] × 100%.

2.7. Survival and Fecundity of Sitobion avenae After Injection

Within 24 h of molting, the adult aphids were injected with dsSTAT5B, dsC1QBP, and dsGFP using the method described in Section 2.6. After the injection, the aphids were transferred to healthy wheat seedlings and placed in the artificial climate incubator described in Section 2.1. Their survival status was observed and recorded daily over a 10-day period, and their fecundity was observed and recorded daily over a 5-day period. A total of 4 biological replicates were used, and each sample contained 20 aphids.

2.8. Effect of STAT5B and C1QBP Knockdown on the Acquisition, Retention, and Transmission of BYDV-GAV

To test the effects of STAT5B and C1QBP knockdown on the BYDV-GAV acquisition/retention of aphids, within 24 h of molting, the adult aphids collected from the healthy/BYDV-GAV-infected wheat seedlings were injected dsSTA5B, dsC1QBP, or dsGFP, as described in Section 2.6, and then transferred to BYDV-GAV-infected/healthy wheat seedlings. Subsequently, at the end of 3 different AAPs (24 h, 48 h, and 72 h)/3 different IAPs (24 h, 48 h, and 72 h), the aphids were collected and stored at −80 °C for the detection of the number of BYDV-GAV CP gene copies using the absolute quantification method described in Section 2.4. A total of 6 biological replicates were used, and each sample contained 10 aphids.
To test the effects of STAT5B and C1QBP knockdown on BYDV-GAV transmission in aphids, within 24 h of molting, the adult aphids collected from the BYDV-GAV-infected wheat seedlings were injected with dsSTA5B, dsC1QBP, or dsGFP as described in Section 2.6. Ten injected aphids were transferred to a single healthy wheat seedling and kept in an artificial climate incubator under the conditions described in Section 2.1. Subsequently, at the end of 3 different IAPs (24 h, 48 h, and 72 h), the aphids were removed. After 7 d, the wheat leaves were collected for the determination of their viruliferous status using the RT-PCR method described by Hu et al. [6]. The transmission efficiency was calculated with the following formula: transmission efficiency = the number of BYDV-GAV positive plants/total number of plants × 100%. A total of 30 biological replicates were used, and each sample contained 1 wheat seedling.

2.9. Statistics Analyses

Data analysis was conducted utilizing IBM SPSS Statistics 21 software. The expressions of STAT5B and C1QBP in S. avenae during the AAPs and IAPs were separately compared using one-way analysis of variance (ANOVA). The means of the significantly different ANOVA results were compared using Tukey’s test at p < 0.05. The relative expression levels of the target gene, the copy numbers of the BYDV-GAV CP gene, and the fecundities in the RNAi assays were separately compared using an independent sample t-test to assess the variance between the treatment and control groups. Additionally, a log-rank (Mantel–Cox) test was applied to compare the survival curves between the treatment and control groups. Furthermore, a chi-square test with a 2 × 2 contingency table was implemented to examine the differences in the transmission efficiency of the aphids between the treatment and control groups. A p-value of less than 0.05 was treated as statistically significant.

3. Results

3.1. Expression Analysis of STAT5B and C1QBP in Sitobion avenae During AAPs and IAPs of BYDV-GAV

To assess the expression profiles of STAT5B and C1QBP in S. avenae across different acquisition and inoculation periods, we measured the relative expression levels of STAT5B and C1QBP in S. avenae after different AAPs and IAPs, as determined using qPCR. The mRNA transcripts of STAT5B in the virus-free S. avenae were significantly upregulated during the AAPs at 24 h, 48 h, and 72 h, which were approximately 3.00-fold, 2.90-fold, and 2.68-fold higher compared with those in the control aphids (0 h, when the aphids had no access to virus-infected plants), respectively (Figure 1A; p = 0.002, p = 0.003, and p = 0.006). Moreover, the mRNA transcripts of STAT5B in viruliferous S. avenae were significantly upregulated during the IAPs at 48 h, 72 h, and 96 h, which were approximately 4.00-fold, 4.52-fold, and 4.17-fold higher compared with those in the control aphids (0 h, when the aphids had no access to healthy plants), respectively (Figure 1B; p < 0.001, p < 0.001, and p < 0.001).
The mRNA transcripts of C1QBP in the virus-free S. avenae were significantly upregulated during the AAPs at 24 h, 48 h, and 72 h, which were approximately 4.71-fold, 5.26-fold, and 3.95-fold higher compared with those in the control aphids (0 h), respectively (Figure 1C; p < 0.001, p < 0.001, and p = 0.001). Moreover, the mRNA transcripts of C1QBP in the viruliferous S. avenae were significantly upregulated during the IAPs at 24 h and 48 h, which were approximately 4.14-fold and 3.15-fold higher compared with those in the control aphids (0 h), respectively (Figure 1D; p < 0.001 and p = 0.001).

3.2. Efficiency of dsRNA and Sitobion avenae Fitness After Injecting dsRNA

To better quantify the RNAi efficiency of injected dsRNA, we examined the transcript levels of STA5B and C1QBP using qPCR. The mRNA abundance of STAT5B decreased after aphid adults were injected with dsSTA5B for 72 h (p = 0.004), with a decrease of up to 55.61% in its expression relative to the controls (Figure 2A). The mRNA abundance of C1QBP substantially decreased after aphid adults were injected with dsC1QBP for 48 h, 72 h, and 96 h (Figure 2B; p = 0.005, p = 0.021, and p = 0.009). In particular, the suppression of C1QBP expression was observed 96 h after injection, with a decrease of up to 65.18% in its expression relative to the controls.
In order to evaluate the effects of RNAi on aphid adaptability, we measured the survival rates and fecundities of the adults after dsRNA injection. The survival curves of the dsSTAT5B- and dsC1QBP-treated adults were not significantly different from those of the dsGFP-treated adults (Figure 3A; log-rank test, p = 0.794 and p = 0.560). The fecundities of the dsSTAT5B- and dsC1QBP-treated adults were not significantly different from those of the dsGFP-treated adults at all five observation times (Figure 3B).

3.3. Effect of STAT5B and C1QBP Silencing on Acquisition, Retention, and Transmission of BYDV-GAV

To examine whether STAT5B or C1QBP silencing had an effect on the acquisition of BYDV-GAV during the AAPs and the retention of BYDV-GAV during the IAPs, we analyzed the impact of STAT5B and C1QBP silencing on the copy number of BYDV-GAV CP using qPCR. As shown in Figure 4A, compared with the dsGFP control aphids, the copy number of BYDV-GAV CP significantly decreased in the dsC1QBP-treated aphids after the AAPs of 48 h and 72 h (p = 0.048 and p = 0.002), while there was no significant difference in the dsSTAT5B-treated aphids after all three AAPs. As shown in Figure 4B, compared with the dsGFP control aphids, the copy number of BYDV-GAV CP significantly increased in the dsSTAT5B- and dsC1QBP-treated aphids after the IAPs of 48 h and 72 h (p = 0.012 and p = 0.017).
To analyze the impact of STAT5B and C1QBP silencing on the transmission of BYDV-GAV during the IAPs, we used the RT-PCR method to assess the presence or absence of BYDV-GAV in the wheat seedling plants fed on by STAT5B- and C1QBP-silencing aphids. As shown in Figure 4C, compared with the dsGFP control aphid, there was no significant difference in the transmission efficiency after all three IAPs in either the dsSTAT5B or dsC1QBP treatments.

4. Discussion

The viruses transmitted in a circulative manner enter the intestinal tract through the oral cavity and esophagus of vector insects, break through the midgut barrier to reach the salivary glands, and are then transmitted to new host plants through the saliva of the vector [14]. Successful cycles of plant virus infection are determined by the efficiency of virus acquisition and inoculation in the vector [31]. Our results show that during the AAPs and IAPs of BYDV-GAV, both STAT5B and C1QBP were markedly upregulated in S. avenae. The silencing of STAT5B led to a significant increase in the copy number of BYDV-GAV CP in S. avenae during the IAPs, implying that STAT5B may play a role in virus inoculation by the vector aphids. Meanwhile, the silencing of C1QBP resulted in a significant decrease in the BYDV-GAV CP copy number during the AAPs and an increase during the IAPs, suggesting that C1QBP may play a role both in virus acquisition and inoculation by the vector aphids.
In this study, the expression levels of STAT5B in the vector S. avenae were significantly upregulated during the IAPs of BYDV-GAV (Figure 1B), and the RNAi-mediated silencing of STAT5B resulted in a significant increase in the copy number of BYDV-GAV CP in S. avenae during the IAPs (Figure 4B). One possible explanation is that STAT5B may interact with viral proteins to facilitate the breaking of the vector’s barrier, thereby enabling viral entry into healthy plants during IAPs. A previous study reported that viruses can activate specific STATs to enhance viral expression and infection in human cells [32]. Conversely, another possible explanation is that STAT5B appears to function as an antiviral factor against BYDV-GAV in S. avenae during the IAPs. Insects rely solely on their innate immune system for defense against viruses and other adverse factors, as they lack acquired immunity [33]. The JAK/STAT pathway is a crucial component of the innate immune response and is known to play a significant role in insect antiviral defenses, with STAT proteins being key regulators of this pathway. Wang et al. [23] demonstrated that the JAK/STAT signaling pathway restricted the accumulation of TYLCV in whiteflies, with two STAT genes, BtCD109-2 and BtCD109-3, activating effector genes to mediate antiviral activity and enhance resistance to viral invasion. Based on the above analysis, the reason that STAT5B regulates viral inoculation is not yet clear, and further experiments, including protein–protein interaction studies and investigations into the JAK/STAT signaling pathway, are needed to elucidate the mechanism of the role of STAT5B in plant virus transmission.
In this study, the expression levels of C1QBP in the vector S. avenae were significantly upregulated during the AAPs of BYDV-GAV (Figure 1C), and the silencing of C1QBP resulted in a significant decrease in the BYDV-GAV CP copy number during the AAPs (Figure 4A). These results suggest that C1QBP may interact with the virus particles to enter the aphids during the AAPs. Our previous study found, through yeast two-hybrid screening, that the C1QBP within the aphid could interact with the CP and ATP of BYDV [26]. The above results confirm that C1QBP may play a positive role in BYDV-GAV acquisition by the vector aphid S. avenae. On the contrary, it has been found that the C1QBP protein interacts with PLRV and acts as a negative regulator of virus accumulation in M. persicae [24]; C1QBP was also reported as inhibitor effector gene of apoptosis [34], and apoptosis can increase the accumulation of TYLCV in B. tabaci [35]. These results suggest that the function of C1QBP could be plant-virus-specific or/and insect-vector-specific and needs to be further examined.
RNAi is an effective technology for verifying the gene functions in insects and other organisms. The common methods of dsRNA delivery are microinjection and oral feeding, where synthesized dsRNA is added to an artificial diet [36,37]. Oral feeding is utilized more than injection, increasing the cost of experiments. Furthermore, dsRNA is transported through the midgut during oral feeding, where it may be degraded by nucleases in the midgut [38]. Our results show that the RNAi efficiencies after the injections of STAT5B and C1QBP in S. avenae were 55.61% and 65.18%, respectively (Figure 2). Previous studies have reported that the RNAi efficiencies of several genes in S. avenae by oral feeding, including cytochrome P450 monooxygenases (CYP6A14-1 and CYP307A1), carboxylesterase (COE2), glutathione-S-transferases (GST1-1-1), and Laccase 1 (Lac1), with efficiencies of 52.9%, 53.7%, 54.5%, 62.4%, and 53.3%, respectively [27,39]. The silencing efficiency of the genes in our experiment is comparable to the silencing efficiency of other genes in S. avenae. Furthermore, the survival and fecundities of the aphids were not significantly different from those of the dsGFP at all observation times (Figure 3). Thus, our results indicate that the knockdown of STAT5B and C1QBP in S. avenae by injecting dsRNA was effective.
Our results indicate that silencing STAT5B and C1QBP did not affect the transmission efficiency of S. avenae during the IAPs (Figure 4C). This suggests that STAT5B and C1QBP in S. avenae have no effect on helping virus particles enter healthy plants during the IAPs. However, since BYDV-GAV is propagative in plants and can successfully infect plants at even low quantities, the number of virus particles entering the plant does not directly affect the transmission efficiency of S. avenae. Further studies are needed to confirm these findings.
RNAi is considered a security strategy in pest management because of its high sequence-dependent specificity [40]. Our results show that the knockdown C1QBP resulted in a significantly reduced BYDV-GAV copy number of S. avenae during the AAPs (Figure 4A). Thus, the C1QBP can be a potential target gene for further RNAi-based studies to control BYDV-GAV. However, the dsRNA delivery system, the RNAi efficacy, the environmental risk, and the potential for resistance need to be further studied for the application of C1QBP dsRNA in the field to control the transmission of BYDV-GAV [40].

5. Conclusions

In summary, this study demonstrated that the expressions of STAT5B and C1QBP in S. avenae were upregulated during the IAPs and AAPs of BYDV-GAV. The RNAi-mediated silencing of STAT5B and C1QBP in S. avenae was effective and did not impact aphid fitness, The silencing of STAT5B led to a significant increase in BYDV-GAV retention during the IAPs, while the silencing of C1QBP resulted in a notable decrease in BYDV-GAV acquisition during the AAPs and a significant increase in BYDV-GAV retention during the IAPs. C1QBP was identified as a potential target gene for controlling the transmission of BYDV-GAV. These findings suggest that receptors in vector insects may play an important role in regulating plant virus transmission. Further research is required to elucidate the molecular mechanisms by which the receptors affect plant virus transmission and to assess the applicability of target gene dsRNA in the field.

Author Contributions

Conceptualization, Z.H., C.L. (Chiping Liu), M.Z. and C.L. (Chen Luo); methodology, Z.H. and C.L. (Chiping Liu); software, Z.H. and C.L. (Chiping Liu); validation, Z.H. and C.L. (Chiping Liu); investigation, C.L. (Chiping Liu) and M.Z.; resources, C.L. (Chiping Liu) and M.Z.; data curation, Z.H., C.L. (Chiping Liu) and M.Z.; formal analysis, Z.H. and C.L. (Chiping Liu); writing—original draft: Z.H., C.L. (Chiping Liu), M.Z. and C.L. (Chen Luo); writing—review and editing: Z.H., C.L. (Chiping Liu), M.Z. and C.L. (Chen Luo); visualization, C.L. (Chiping Liu) and M.Z.; supervision, Z.H.; funding acquisition: Z.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key R&D Program of China (2022YFD1400400), the Key Research and Development Plan Project of Shaanxi Province (2023-YBNY-072), and the Scientific and Technological Innovation and Transformative Project of Experimental Demonstration Station (base) of Northwest A&F University (TGZX2021-36).

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

The authors are grateful to the anonymous referees for their critical comments on this manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Mauck, K.E.; Bosque-Pérez, N.A.; Eigenbrode, S.D.; De Moraes, C.M.; Mescher, M.C. Transmission mechanisms shape pathogen effects on host-vector interactions: Evidence from plant viruses. Funct. Ecol. 2012, 26, 1162–1175. [Google Scholar] [CrossRef]
  2. Mauck, K.E.; Chesnais, Q.; Shapiro, L.R. Evolutionary determinants of host and vector manipulation by plant viruses. Adv. Virus Res. 2018, 101, 189–250. [Google Scholar] [PubMed]
  3. Nault, L.R. Arthropod transmission of plant viruses: A new synthesis. Ann. Entomol. Soc. Am. 1997, 90, 521–541. [Google Scholar] [CrossRef]
  4. Stafford, C.A.; Walker, G.P.; Ullman, D.E. Hitching a ride: Vector feeding and virus transmission. Commun. Integr. Biol. 2012, 5, 43–49. [Google Scholar] [CrossRef]
  5. Liu, C.P.; Zhang, Q.; Shi, X.; Zhu, H.M.; Chai, R.R.; Hu, G.Y.; Desneux, N.; Luo, C.; Hu, Z.Q. Direct effects of barley yellow dwarf virus on the performance, parasitoid resistance, and feeding behavior of its vector Sitobion avenae (Hemiptera: Aphididae). Pest Manag. Sci. 2024, 80, 5112–5119. [Google Scholar] [CrossRef]
  6. Hu, Z.Q.; Chai, R.R.; Liu, X.; Dong, Y.; Su, D.; Desneux, N.; Tan, X.L.; Luo, C. Barley yellow dwarf virus-infected wheat plant modulated selection behavior of vector aphids. J. Pest Sci. 2022, 95, 1273–1285. [Google Scholar] [CrossRef]
  7. Carmo-Sousa, M.; Moreno, A.; Garzo, E.; Fereres, A. A non-persistently transmitted-virus induces a pull–push strategy in its aphid vector to optimize transmission and spread. Virus Res. 2014, 186, 38–46. [Google Scholar] [CrossRef]
  8. Mauck, K.E.; Kenney, J.; Chesnais, Q. Progress and challenges in identifying molecular mechanisms underlying host and vector manipulation by plant viruses. Curr. Opin. Insect Sci. 2019, 33, 7–18. [Google Scholar] [CrossRef]
  9. Xia, P.L.; Yu, X.L.; Li, Z.T.; Feng, Y. The impacts of Harmonia axyridis cues on foraging behavior of Aphidius gifuensis to Myzus persicae. J. Asia-Pac. Entomol. 2021, 24, 278–284. [Google Scholar] [CrossRef]
  10. Khanzada, M.S.; Wang, S.; Huang, N.X.; Pang, H.; Tan, X.L.; Khanzada, S.R. Optimization of microencapsulated artificial diets for mass rearing of the predacious big eyed bug, Geocoris pallidipennis. Entomol. Gen. 2019, 39, 353–363. [Google Scholar] [CrossRef]
  11. Wilson, J.R.; DeBlasio, S.L.; Alexander, M.M.; Heck, M. Looking through the lens of ’Omics Technologies: In-sights into the transmission of insect vector-borne plant viruses. Curr. Issues Mol. Biol. 2019, 34, 113–144. [Google Scholar] [PubMed]
  12. Li, Z.X.; Ji, M.Q.; Zhang, C.; Yang, Y.B.; Chen, Z.Z.; Zhao, H.P.; Xu, Y.Y.; Kang, Z.W. The influence of host aphids on the performance of Aphelinus asychis. Insects 2022, 13, 795. [Google Scholar] [CrossRef] [PubMed]
  13. Martinez, A.J.; Doremus, M.R.; Kraft, L.J.; Kim, K.L.; Oliver, K.M. Multi-modal defences in aphids offer redundant protection and increased costs likely impeding a protective mutualism. J. Anim. Ecol. 2018, 87, 464–477. [Google Scholar] [CrossRef] [PubMed]
  14. Zhao, J.; Lei, T.; Zhang, X.; Yin, T.; Wang, X.; Liu, S. A vector whitefly endocytic receptor facilitates the entry of begomoviruses into its midgut cells via binding to virion capsid proteins. PLoS Pathog. 2020, 16, e1009053. [Google Scholar] [CrossRef]
  15. Mauck, K.E.; Moraes, C.D.; Mescher, M.C. Effects of pathogens on sensory-mediated interactions between plants and insect vectors. Curr. Opin. Plant Biol. 2016, 32, 53–61. [Google Scholar] [CrossRef]
  16. Huo, Y.; Yu, Y.L.; Chen, L.Y.; Li, Q.; Zhang, M.T.; Song, Z.Y.; Chen, X.Y.; Fang, R.X.; Zhang, L.L. Insect tissue-specific vitellogenin facilitates transmission of plant virus. PLoS Pathog. 2018, 14, e1006909. [Google Scholar] [CrossRef]
  17. Mulot, M.; Monsion, B.; Boissinot, S.; Rastegar, M.; Meyer, S.; Bochet, N.; Brault, V. Transmission of turnip yellows virus by Myzus persicae is reduced by feeding aphids on double-stranded RNA targeting the ephrin receptor protein. Front. Microbiol. 2018, 9, 457. [Google Scholar] [CrossRef]
  18. Liu, Q.; Meng, X.Y.; Song, Z.Y.; Shao, Y.; Zhao, Y.; Fang, R.X.; Huo, Y.; Zhang, L.L. Insect-transmitted plant virus balances its vertical transmission through regulating rab1-mediated receptor localization. Cell Rep. 2024, 43, 114571. [Google Scholar] [CrossRef]
  19. de Vos, M.; Jander, G. Volatile communication in plant-aphid interactions. Curr. Opin. Plant Biol. 2010, 13, 366–371. [Google Scholar] [CrossRef]
  20. Joffrey, M.; Chesnais, Q.; Spicher, F.; Verrier, E.; Ameline, A.; Couty, A. Plant virus infection influences bottom-up regulation of a plant-aphid-parasitoid system. J. Pest Sci. 2018, 91, 361–372. [Google Scholar] [CrossRef]
  21. Belliure, B.; Janssen, A.; Sabelis, M.W. Herbivore benefits from vectoring plant virus through reduction of period of vul-nerability to predation. Oecologia 2008, 156, 797–806. [Google Scholar] [CrossRef] [PubMed]
  22. Fereres, A.; Moreno, A. Behavioral aspects influencing plant virus transmission by homopteran insects. Virus Res. 2009, 141, 158–168. [Google Scholar] [CrossRef] [PubMed]
  23. Wang, Y.; He, Y.; Ye, X.; Guo, T.; Pan, L.; Liu, S.; Ng, J.C.K.; Wang, X. A balance between vector survival and virus transmission is achieved through JAK/STAT signaling inhibition by a plant virus. Proc. Natl. Acad. Sci. USA 2022, 119, e2122099119. [Google Scholar] [CrossRef] [PubMed]
  24. DeBlasio, S.L.; Wilson, J.R.; Tamborindeguy, C.; Johnson, R.S.; Pinheiro, P.V.; MacCoss, M.J.; Gray, S.M.; Heck, M. Affinity purification–mass spectrometry identifies a novel interaction between a polerovirus and a conserved innate immunity aphid protein that regulates transmission efficiency. J. Phys. Chem. Lett. 2021, 20, 3365–3387. [Google Scholar] [CrossRef] [PubMed]
  25. Li, D.D.; Zhang, C.; Tong, Z.Q.; Su, D.; Zhang, G.S.; Zhang, S.Z.; Zhao, H.Y.; Hu, Z.Q. Transcriptome response comparison between vector and non-vector aphids after feeding on virus-infected wheat plants. BMC Genom. 2020, 21, 638–652. [Google Scholar] [CrossRef]
  26. Tong, Z.Q. Screening and Validation of Interacting Proteins of Sitobion miscanthi with Proteins of Barley Yellow Dwarf Virus. Master’s Thesis, Northwest A&F University, Yangling, China, 2021. [Google Scholar]
  27. Zhang, Y.; Fan, J.; Francis, F.; Chen, J. Molecular characterization and gene silencing of Laccase 1 in the grain aphid, Sitobion avenae. Arch. Insect. Biochem. 2018, 97, e21446. [Google Scholar] [CrossRef]
  28. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  29. Li, J.; Zhao, W.; Wang, W.; Zhang, L.; Cui, F. Evaluation of rice stripe virus transmission efficiency by quantification of viral load in the saliva of insect vector. Pest. Manag. Sci. 2019, 75, 1979–1985. [Google Scholar] [CrossRef]
  30. Liu, X.; He, Y.Y.; Xie, W.; Wu, Q.J.; Zhang, Y.J.; Liu, Y.; Wang, S.L. Infection of tomato by tomato yellow leaf curl virus alters the foraging behaviour and parasitism of the parasitoid, Encarsia formosa on Bemisia tabaci. J. Asia-Pac. Entomol. 2018, 21, 548–552. [Google Scholar] [CrossRef]
  31. Alvarez, A.; Garzo, E.; Verbeek, M.; Vosman, B.; Dicke, M.; Tjallingii, W.F. Infection of potato plants with Potato leaf roll virus changes attraction and feeding behavior of Myzus persicae. Entomol. Exp. Appl. 2007, 125, 135–144. [Google Scholar] [CrossRef]
  32. Harrison, A.R.; Moseley, G.W. The dynamic interface of viruses with STATs. J. Virol. 2020, 94, e00856-20. [Google Scholar] [CrossRef] [PubMed]
  33. Hao, Z.P.; Sheng, L.; Feng, Z.B.; Fei, W.X.; Hou, S.M. Turnip mosaic virus infection differentially modifies cabbage aphid probing behavior in spring and winter oilseed rape (Brassica napus). Insects 2022, 13, 791. [Google Scholar] [CrossRef] [PubMed]
  34. McGee, A.M.; Douglas, D.L.; Liang, Y.; Hyder, S.M.; Baines, C.P. The mitochondrial protein C1QBP promotes cell proliferation, migration and resistance to cell death. Cell Cycle 2011, 10, 4119–4127. [Google Scholar] [CrossRef] [PubMed]
  35. Wang, X.; Wang, C.; Ban, F.; Ghanim, M.; Pan, L.; Qian, L.; Liu, Y.; Wang, X.; Liu, S. Apoptosis in a whitefly vector activated by a Begomovirus enhances viral transmission. mSystems 2020, 5, e00433-20. [Google Scholar] [CrossRef]
  36. Liu, F.; Wang, X.F.; Liu, Y.; Xie, J.J.; Gray, S.M.; Zhou, G.H.; Gao, B.D. A Chinese isolate of Barley yellow dwarf virus-PAV represents a third distinct species within the PAV serotype. Arch. Virol. 2007, 152, 1365–1373. [Google Scholar] [CrossRef]
  37. Liu, Y.; Sun, B.; Wang, X.F.; Zheng, C.L.; Zhou, G.H. Three digoxigenin labeled cDNA probes for specific detection of the natural population of Barley yellow dwarf viruses in China by dot-blot hybridization. J. Virol. Methods 2007, 145, 22–29. [Google Scholar] [CrossRef]
  38. Chen, J.L.; Ni, H.X.; Ding, H.J.; Sun, J.R. Studies on a chemically defined diet of English grain aphid. Sci. Agric. Sin. 2000, 33, 54–59. [Google Scholar]
  39. Zhang, B.Z.; Su, X.; Xie, L.F.; Zhen, C.A.; Hu, G.L.; Jiang, K.; Huang, Z.Y.; Liu, R.Q.; Gao, Y.F.; Chen, X.L.; et al. Multiple detoxification genes confer imidacloprid resistance to Sitobion avenae Fabricius. Crop Prot. 2020, 128, 105014. [Google Scholar] [CrossRef]
  40. Christiaens, O.; Sweet, J.; Dzhambazova, T.; Isabella, U.; Guy, S.; Kaloyan, K.; Salvatore, A. Implementation of RNAi-based arthropod pest control: Environmental risks, potential for resistance and regulatory considerations. J. Pest Sci. 2022, 95, 1–15. [Google Scholar] [CrossRef]
Figure 1. Relative expression levels of STAT5B (A,B) and C1QBP (C,D) in S. avenae after different acquisition access periods (AAPs) and inoculation access periods (IAPs), as determined using qPCR. The values presented are the means ± SEs. Different lowercase letters above the bars within each panel indicate significant differences (Tukey’s test: p < 0.05).
Figure 1. Relative expression levels of STAT5B (A,B) and C1QBP (C,D) in S. avenae after different acquisition access periods (AAPs) and inoculation access periods (IAPs), as determined using qPCR. The values presented are the means ± SEs. Different lowercase letters above the bars within each panel indicate significant differences (Tukey’s test: p < 0.05).
Agronomy 14 02787 g001
Figure 2. STAT5B (A) and C1QBP (B) transcripts of adult S. avenae fed on BYDV-GAV-infected wheat seedlings after dsRNA treatment as determined using qPCR. The values presented are the means ± SEs. Significant differences among the means were tested using the t-test (ns p ≥ 0.05; * p < 0.05; ** p < 0.01).
Figure 2. STAT5B (A) and C1QBP (B) transcripts of adult S. avenae fed on BYDV-GAV-infected wheat seedlings after dsRNA treatment as determined using qPCR. The values presented are the means ± SEs. Significant differences among the means were tested using the t-test (ns p ≥ 0.05; * p < 0.05; ** p < 0.01).
Agronomy 14 02787 g002
Figure 3. Survival curves (A) and fecundities (B) of adult S. avenae fed BYDV-GAV-infected wheat seedlings after dsRNA treatment. Significant differences among the treatments of survival curves were tested using the log-rank test (ns p > 0.05). The values of fecundity presented are the means ± SEs. Significant differences among the means of fecundity were tested using the t-test (ns p > 0.05).
Figure 3. Survival curves (A) and fecundities (B) of adult S. avenae fed BYDV-GAV-infected wheat seedlings after dsRNA treatment. Significant differences among the treatments of survival curves were tested using the log-rank test (ns p > 0.05). The values of fecundity presented are the means ± SEs. Significant differences among the means of fecundity were tested using the t-test (ns p > 0.05).
Agronomy 14 02787 g003
Figure 4. The effects of STAT5B and C1QBP silencing on the acquisition, retention, and transmission of BYDV-GAV: (A) The acquisition of BYDV-GAV (CP copy number) in S. avenae after target gene silencing during three acquisition access periods (AAPs) was determined using qPCR. (B) The retention of BYDV-GAV (CP copy number) in S. avenae after target gene silencing during three inoculation access periods (IAPs) was determined using qPCR. (C) The transmission efficiency of target-gene-silencing aphids during three IAPs was determined using RT-PCR to detect the BYDV-GAV infected status of the plant. The values presented are the means ± SEs. Significant differences among the means were tested using the t-test (ns p > 0.05; * p < 0.05; ** p < 0.01).
Figure 4. The effects of STAT5B and C1QBP silencing on the acquisition, retention, and transmission of BYDV-GAV: (A) The acquisition of BYDV-GAV (CP copy number) in S. avenae after target gene silencing during three acquisition access periods (AAPs) was determined using qPCR. (B) The retention of BYDV-GAV (CP copy number) in S. avenae after target gene silencing during three inoculation access periods (IAPs) was determined using qPCR. (C) The transmission efficiency of target-gene-silencing aphids during three IAPs was determined using RT-PCR to detect the BYDV-GAV infected status of the plant. The values presented are the means ± SEs. Significant differences among the means were tested using the t-test (ns p > 0.05; * p < 0.05; ** p < 0.01).
Agronomy 14 02787 g004
Table 1. Primers used in this study.
Table 1. Primers used in this study.
PrimerPrimer Sequence (5′-3′)PCR Product Size (bp)Purpose
BYDV-GAV-FGACCACAACCATTCTCCGAACT60qPCR
BYDV-GAV-RAGGAGAAATGGCCCAAGGA
β-actin-FCGTTACCAACTGGGACGATATG110
β-actin-RGGGTTCAATGGAGCTTCTGTTA
STAT5B-FCAGAGTGAATTTGGGTCG105
STAT5B-RGTACTTGCCACTAACGATGA
C1QBP-FCAATCACTCGGTAACAGAAG106
C1QBP-RGCCAAGAATAACATCACCTCGA
STAT5B-Fa AGGTCCTTGGACTGATGGTG403RNAi
STAT5B-Ra ATTCATTCCTTGTCCGTTGG
C1QBP-Fa TGTGGTCATCAACAGGGAAA182
C1QBP-Ra AGCGCCATCAGCAGATACTT
GFP-Fa GACGTAAACGGCCACAAGTT496
GFP-Ra TGCTCAGGTAGTGGTTGTCG
a T7 adaptor sequence: TAATACGACTATAGGG.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, C.; Zhang, M.; Luo, C.; Hu, Z. Implications of the STAT5B and C1QBP Genes of Grain Aphid Sitobion avenae in the Transmission of Barley Yellow Dwarf Virus. Agronomy 2024, 14, 2787. https://doi.org/10.3390/agronomy14122787

AMA Style

Liu C, Zhang M, Luo C, Hu Z. Implications of the STAT5B and C1QBP Genes of Grain Aphid Sitobion avenae in the Transmission of Barley Yellow Dwarf Virus. Agronomy. 2024; 14(12):2787. https://doi.org/10.3390/agronomy14122787

Chicago/Turabian Style

Liu, Chiping, Manwen Zhang, Chen Luo, and Zuqing Hu. 2024. "Implications of the STAT5B and C1QBP Genes of Grain Aphid Sitobion avenae in the Transmission of Barley Yellow Dwarf Virus" Agronomy 14, no. 12: 2787. https://doi.org/10.3390/agronomy14122787

APA Style

Liu, C., Zhang, M., Luo, C., & Hu, Z. (2024). Implications of the STAT5B and C1QBP Genes of Grain Aphid Sitobion avenae in the Transmission of Barley Yellow Dwarf Virus. Agronomy, 14(12), 2787. https://doi.org/10.3390/agronomy14122787

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop