Implications of the STAT5B and C1QBP Genes of Grain Aphid Sitobion avenae in the Transmission of Barley Yellow Dwarf Virus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Insect and Plant Virus Maintenance
2.2. Design of Primers
2.3. Expression Analysis of STAT5B and C1QBP
2.4. Quantitative Real-Time Polymerase Chain Reaction (qPCR)
2.5. Synthesis of dsRNA
2.6. Injected dsRNA Assay of STAT5B, C1QBP and RNAi Efficiency
2.7. Survival and Fecundity of Sitobion avenae After Injection
2.8. Effect of STAT5B and C1QBP Knockdown on the Acquisition, Retention, and Transmission of BYDV-GAV
2.9. Statistics Analyses
3. Results
3.1. Expression Analysis of STAT5B and C1QBP in Sitobion avenae During AAPs and IAPs of BYDV-GAV
3.2. Efficiency of dsRNA and Sitobion avenae Fitness After Injecting dsRNA
3.3. Effect of STAT5B and C1QBP Silencing on Acquisition, Retention, and Transmission of BYDV-GAV
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mauck, K.E.; Bosque-Pérez, N.A.; Eigenbrode, S.D.; De Moraes, C.M.; Mescher, M.C. Transmission mechanisms shape pathogen effects on host-vector interactions: Evidence from plant viruses. Funct. Ecol. 2012, 26, 1162–1175. [Google Scholar] [CrossRef]
- Mauck, K.E.; Chesnais, Q.; Shapiro, L.R. Evolutionary determinants of host and vector manipulation by plant viruses. Adv. Virus Res. 2018, 101, 189–250. [Google Scholar] [PubMed]
- Nault, L.R. Arthropod transmission of plant viruses: A new synthesis. Ann. Entomol. Soc. Am. 1997, 90, 521–541. [Google Scholar] [CrossRef]
- Stafford, C.A.; Walker, G.P.; Ullman, D.E. Hitching a ride: Vector feeding and virus transmission. Commun. Integr. Biol. 2012, 5, 43–49. [Google Scholar] [CrossRef]
- Liu, C.P.; Zhang, Q.; Shi, X.; Zhu, H.M.; Chai, R.R.; Hu, G.Y.; Desneux, N.; Luo, C.; Hu, Z.Q. Direct effects of barley yellow dwarf virus on the performance, parasitoid resistance, and feeding behavior of its vector Sitobion avenae (Hemiptera: Aphididae). Pest Manag. Sci. 2024, 80, 5112–5119. [Google Scholar] [CrossRef]
- Hu, Z.Q.; Chai, R.R.; Liu, X.; Dong, Y.; Su, D.; Desneux, N.; Tan, X.L.; Luo, C. Barley yellow dwarf virus-infected wheat plant modulated selection behavior of vector aphids. J. Pest Sci. 2022, 95, 1273–1285. [Google Scholar] [CrossRef]
- Carmo-Sousa, M.; Moreno, A.; Garzo, E.; Fereres, A. A non-persistently transmitted-virus induces a pull–push strategy in its aphid vector to optimize transmission and spread. Virus Res. 2014, 186, 38–46. [Google Scholar] [CrossRef]
- Mauck, K.E.; Kenney, J.; Chesnais, Q. Progress and challenges in identifying molecular mechanisms underlying host and vector manipulation by plant viruses. Curr. Opin. Insect Sci. 2019, 33, 7–18. [Google Scholar] [CrossRef]
- Xia, P.L.; Yu, X.L.; Li, Z.T.; Feng, Y. The impacts of Harmonia axyridis cues on foraging behavior of Aphidius gifuensis to Myzus persicae. J. Asia-Pac. Entomol. 2021, 24, 278–284. [Google Scholar] [CrossRef]
- Khanzada, M.S.; Wang, S.; Huang, N.X.; Pang, H.; Tan, X.L.; Khanzada, S.R. Optimization of microencapsulated artificial diets for mass rearing of the predacious big eyed bug, Geocoris pallidipennis. Entomol. Gen. 2019, 39, 353–363. [Google Scholar] [CrossRef]
- Wilson, J.R.; DeBlasio, S.L.; Alexander, M.M.; Heck, M. Looking through the lens of ’Omics Technologies: In-sights into the transmission of insect vector-borne plant viruses. Curr. Issues Mol. Biol. 2019, 34, 113–144. [Google Scholar] [PubMed]
- Li, Z.X.; Ji, M.Q.; Zhang, C.; Yang, Y.B.; Chen, Z.Z.; Zhao, H.P.; Xu, Y.Y.; Kang, Z.W. The influence of host aphids on the performance of Aphelinus asychis. Insects 2022, 13, 795. [Google Scholar] [CrossRef] [PubMed]
- Martinez, A.J.; Doremus, M.R.; Kraft, L.J.; Kim, K.L.; Oliver, K.M. Multi-modal defences in aphids offer redundant protection and increased costs likely impeding a protective mutualism. J. Anim. Ecol. 2018, 87, 464–477. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Lei, T.; Zhang, X.; Yin, T.; Wang, X.; Liu, S. A vector whitefly endocytic receptor facilitates the entry of begomoviruses into its midgut cells via binding to virion capsid proteins. PLoS Pathog. 2020, 16, e1009053. [Google Scholar] [CrossRef]
- Mauck, K.E.; Moraes, C.D.; Mescher, M.C. Effects of pathogens on sensory-mediated interactions between plants and insect vectors. Curr. Opin. Plant Biol. 2016, 32, 53–61. [Google Scholar] [CrossRef]
- Huo, Y.; Yu, Y.L.; Chen, L.Y.; Li, Q.; Zhang, M.T.; Song, Z.Y.; Chen, X.Y.; Fang, R.X.; Zhang, L.L. Insect tissue-specific vitellogenin facilitates transmission of plant virus. PLoS Pathog. 2018, 14, e1006909. [Google Scholar] [CrossRef]
- Mulot, M.; Monsion, B.; Boissinot, S.; Rastegar, M.; Meyer, S.; Bochet, N.; Brault, V. Transmission of turnip yellows virus by Myzus persicae is reduced by feeding aphids on double-stranded RNA targeting the ephrin receptor protein. Front. Microbiol. 2018, 9, 457. [Google Scholar] [CrossRef]
- Liu, Q.; Meng, X.Y.; Song, Z.Y.; Shao, Y.; Zhao, Y.; Fang, R.X.; Huo, Y.; Zhang, L.L. Insect-transmitted plant virus balances its vertical transmission through regulating rab1-mediated receptor localization. Cell Rep. 2024, 43, 114571. [Google Scholar] [CrossRef]
- de Vos, M.; Jander, G. Volatile communication in plant-aphid interactions. Curr. Opin. Plant Biol. 2010, 13, 366–371. [Google Scholar] [CrossRef]
- Joffrey, M.; Chesnais, Q.; Spicher, F.; Verrier, E.; Ameline, A.; Couty, A. Plant virus infection influences bottom-up regulation of a plant-aphid-parasitoid system. J. Pest Sci. 2018, 91, 361–372. [Google Scholar] [CrossRef]
- Belliure, B.; Janssen, A.; Sabelis, M.W. Herbivore benefits from vectoring plant virus through reduction of period of vul-nerability to predation. Oecologia 2008, 156, 797–806. [Google Scholar] [CrossRef] [PubMed]
- Fereres, A.; Moreno, A. Behavioral aspects influencing plant virus transmission by homopteran insects. Virus Res. 2009, 141, 158–168. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; He, Y.; Ye, X.; Guo, T.; Pan, L.; Liu, S.; Ng, J.C.K.; Wang, X. A balance between vector survival and virus transmission is achieved through JAK/STAT signaling inhibition by a plant virus. Proc. Natl. Acad. Sci. USA 2022, 119, e2122099119. [Google Scholar] [CrossRef] [PubMed]
- DeBlasio, S.L.; Wilson, J.R.; Tamborindeguy, C.; Johnson, R.S.; Pinheiro, P.V.; MacCoss, M.J.; Gray, S.M.; Heck, M. Affinity purification–mass spectrometry identifies a novel interaction between a polerovirus and a conserved innate immunity aphid protein that regulates transmission efficiency. J. Phys. Chem. Lett. 2021, 20, 3365–3387. [Google Scholar] [CrossRef] [PubMed]
- Li, D.D.; Zhang, C.; Tong, Z.Q.; Su, D.; Zhang, G.S.; Zhang, S.Z.; Zhao, H.Y.; Hu, Z.Q. Transcriptome response comparison between vector and non-vector aphids after feeding on virus-infected wheat plants. BMC Genom. 2020, 21, 638–652. [Google Scholar] [CrossRef]
- Tong, Z.Q. Screening and Validation of Interacting Proteins of Sitobion miscanthi with Proteins of Barley Yellow Dwarf Virus. Master’s Thesis, Northwest A&F University, Yangling, China, 2021. [Google Scholar]
- Zhang, Y.; Fan, J.; Francis, F.; Chen, J. Molecular characterization and gene silencing of Laccase 1 in the grain aphid, Sitobion avenae. Arch. Insect. Biochem. 2018, 97, e21446. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Li, J.; Zhao, W.; Wang, W.; Zhang, L.; Cui, F. Evaluation of rice stripe virus transmission efficiency by quantification of viral load in the saliva of insect vector. Pest. Manag. Sci. 2019, 75, 1979–1985. [Google Scholar] [CrossRef]
- Liu, X.; He, Y.Y.; Xie, W.; Wu, Q.J.; Zhang, Y.J.; Liu, Y.; Wang, S.L. Infection of tomato by tomato yellow leaf curl virus alters the foraging behaviour and parasitism of the parasitoid, Encarsia formosa on Bemisia tabaci. J. Asia-Pac. Entomol. 2018, 21, 548–552. [Google Scholar] [CrossRef]
- Alvarez, A.; Garzo, E.; Verbeek, M.; Vosman, B.; Dicke, M.; Tjallingii, W.F. Infection of potato plants with Potato leaf roll virus changes attraction and feeding behavior of Myzus persicae. Entomol. Exp. Appl. 2007, 125, 135–144. [Google Scholar] [CrossRef]
- Harrison, A.R.; Moseley, G.W. The dynamic interface of viruses with STATs. J. Virol. 2020, 94, e00856-20. [Google Scholar] [CrossRef] [PubMed]
- Hao, Z.P.; Sheng, L.; Feng, Z.B.; Fei, W.X.; Hou, S.M. Turnip mosaic virus infection differentially modifies cabbage aphid probing behavior in spring and winter oilseed rape (Brassica napus). Insects 2022, 13, 791. [Google Scholar] [CrossRef] [PubMed]
- McGee, A.M.; Douglas, D.L.; Liang, Y.; Hyder, S.M.; Baines, C.P. The mitochondrial protein C1QBP promotes cell proliferation, migration and resistance to cell death. Cell Cycle 2011, 10, 4119–4127. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Wang, C.; Ban, F.; Ghanim, M.; Pan, L.; Qian, L.; Liu, Y.; Wang, X.; Liu, S. Apoptosis in a whitefly vector activated by a Begomovirus enhances viral transmission. mSystems 2020, 5, e00433-20. [Google Scholar] [CrossRef]
- Liu, F.; Wang, X.F.; Liu, Y.; Xie, J.J.; Gray, S.M.; Zhou, G.H.; Gao, B.D. A Chinese isolate of Barley yellow dwarf virus-PAV represents a third distinct species within the PAV serotype. Arch. Virol. 2007, 152, 1365–1373. [Google Scholar] [CrossRef]
- Liu, Y.; Sun, B.; Wang, X.F.; Zheng, C.L.; Zhou, G.H. Three digoxigenin labeled cDNA probes for specific detection of the natural population of Barley yellow dwarf viruses in China by dot-blot hybridization. J. Virol. Methods 2007, 145, 22–29. [Google Scholar] [CrossRef]
- Chen, J.L.; Ni, H.X.; Ding, H.J.; Sun, J.R. Studies on a chemically defined diet of English grain aphid. Sci. Agric. Sin. 2000, 33, 54–59. [Google Scholar]
- Zhang, B.Z.; Su, X.; Xie, L.F.; Zhen, C.A.; Hu, G.L.; Jiang, K.; Huang, Z.Y.; Liu, R.Q.; Gao, Y.F.; Chen, X.L.; et al. Multiple detoxification genes confer imidacloprid resistance to Sitobion avenae Fabricius. Crop Prot. 2020, 128, 105014. [Google Scholar] [CrossRef]
- Christiaens, O.; Sweet, J.; Dzhambazova, T.; Isabella, U.; Guy, S.; Kaloyan, K.; Salvatore, A. Implementation of RNAi-based arthropod pest control: Environmental risks, potential for resistance and regulatory considerations. J. Pest Sci. 2022, 95, 1–15. [Google Scholar] [CrossRef]
Primer | Primer Sequence (5′-3′) | PCR Product Size (bp) | Purpose |
---|---|---|---|
BYDV-GAV-F | GACCACAACCATTCTCCGAACT | 60 | qPCR |
BYDV-GAV-R | AGGAGAAATGGCCCAAGGA | ||
β-actin-F | CGTTACCAACTGGGACGATATG | 110 | |
β-actin-R | GGGTTCAATGGAGCTTCTGTTA | ||
STAT5B-F | CAGAGTGAATTTGGGTCG | 105 | |
STAT5B-R | GTACTTGCCACTAACGATGA | ||
C1QBP-F | CAATCACTCGGTAACAGAAG | 106 | |
C1QBP-R | GCCAAGAATAACATCACCTCGA | ||
STAT5B-F | a AGGTCCTTGGACTGATGGTG | 403 | RNAi |
STAT5B-R | a ATTCATTCCTTGTCCGTTGG | ||
C1QBP-F | a TGTGGTCATCAACAGGGAAA | 182 | |
C1QBP-R | a AGCGCCATCAGCAGATACTT | ||
GFP-F | a GACGTAAACGGCCACAAGTT | 496 | |
GFP-R | a TGCTCAGGTAGTGGTTGTCG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, C.; Zhang, M.; Luo, C.; Hu, Z. Implications of the STAT5B and C1QBP Genes of Grain Aphid Sitobion avenae in the Transmission of Barley Yellow Dwarf Virus. Agronomy 2024, 14, 2787. https://doi.org/10.3390/agronomy14122787
Liu C, Zhang M, Luo C, Hu Z. Implications of the STAT5B and C1QBP Genes of Grain Aphid Sitobion avenae in the Transmission of Barley Yellow Dwarf Virus. Agronomy. 2024; 14(12):2787. https://doi.org/10.3390/agronomy14122787
Chicago/Turabian StyleLiu, Chiping, Manwen Zhang, Chen Luo, and Zuqing Hu. 2024. "Implications of the STAT5B and C1QBP Genes of Grain Aphid Sitobion avenae in the Transmission of Barley Yellow Dwarf Virus" Agronomy 14, no. 12: 2787. https://doi.org/10.3390/agronomy14122787
APA StyleLiu, C., Zhang, M., Luo, C., & Hu, Z. (2024). Implications of the STAT5B and C1QBP Genes of Grain Aphid Sitobion avenae in the Transmission of Barley Yellow Dwarf Virus. Agronomy, 14(12), 2787. https://doi.org/10.3390/agronomy14122787