Next Article in Journal
Effects of Using Thermocomposted Frass from Black Soldier Fly Larvae as a Germination Substrate on the Phytotoxicity, Germination Index, Growth and Antioxidant Contents in Kale (Brassica oleracea)
Previous Article in Journal
Potential of Thermal and RGB Imaging Combined with Artificial Neural Networks for Assessing Salt Tolerance of Wheat Genotypes Grown in Real-Field Conditions
Previous Article in Special Issue
Drought Tolerance Evaluation and Growth Response of Chinese Cabbage Seedlings to Water Deficit Treatment
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 14
Issue 7
10.3390/agronomy14071391
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Peanut NAC Transcription Factor AhNAPa Negatively Regulates Salt Tolerance in Transgenic Arabidopsis

by
Cuiling Yuan
1,
Haocui Miao
2,
Quanxi Sun
1,* and
Shihua Shan
1,*
1
Shandong Peanut Research Institute, Qingdao 266100, China
2
Institute of Crop Germplasm Resource, Xinjiang Academy of Agricultural Sciences, Urumqi 830000, China
*
Authors to whom correspondence should be addressed.
Agronomy 2024, 14(7), 1391; https://doi.org/10.3390/agronomy14071391
Submission received: 15 May 2024 / Revised: 22 June 2024 / Accepted: 25 June 2024 / Published: 27 June 2024
(This article belongs to the Special Issue Advances in the Industrial Crops)
Browse Figures
Versions Notes

Abstract

:
Soil salinity greatly impacts the planting area of cultivated peanut. It is necessary to breed salt-tolerant cultivars. However, few salt-resistant genes have been identified in peanut. Here, we reported the cloning of a peanut NAC transcription factor gene, AhNAPa, which was expressed ubiquitously and significantly upregulated after salt treatment. Furthermore, an AhNAPa-GFP fusion protein was found to be located in the nucleus, which indicated that AhNAPa might perform functions as a transcriptional activator in peanut. Under NaCl treatment, the root length of Arabidopsis plants overexpressing AhNAPa (AhNAPa-OX) were dramatically inhibited compared with the wild type (WT) lines, and the AhNAPa-OX adult plants became sensitive to salt stress. The expression levels of abiotic stress-responsive genes, SnRK2.2, NAC016, RD20, RD29B, and AREB1, significantly decreased in AhNAPa-OX plants, suggesting AhNAPa inhibited the ABA signaling pathway in response to salt stress. Taken together, these results suggest that the salt-inducible peanut transcription factor AhNAPa negatively regulated salt tolerance in transgenic Arabidopsis.

1. Introduction

Salt stress affects global agriculture development [1]. According to the Food and Agriculture Organization (FAO), more than 1 billion ha of arable land is threatened by salt stress. It is estimated that more than 50% of cultivated land will be damaged by salinity by 2050 due to the effects of global warming and the lack of fresh water, thus severely damaging the world’s food security [2]. To meet future food demand for the burgeoning world population, it is urgent that we cultivate salt-tolerant crop varieties that can be grown in the vast areas of the world affected by salinity [3].
From sensing signals to, ultimately, achieving resistance, plants have developed several sophisticated strategies to adapt to salt stress environments, including hormonal regulation, reactive oxygen scavenging, etc. [4,5,6,7]. The activation of stress-responsive gene expression in plants is generally the earliest response to salt stress. These salt-stress-responsive genes are usually regulated by specific transcription factors (TFs), which bind to specific cis-elements in their promoter regions [8,9,10]. A larger number of TFs, such as NAC, MYB, and WRKY, play important roles in regulating plants against various stress conditions [4,7,10,11,12,13]. The NAC (no apical meristem (NAM), Arabidopsis thaliana transcription activation factor (ATAF1/2) and cup-shaped cotyledon (CUC2)) transcription factor (TF) is one of the largest families of TFs among plants and contains a conserved NAM domain at the N-terminus and a highly variable domain at the C-terminus [11]. NAC genes have been shown to play vital roles in response to salt stress via the ABA signaling pathway [14,15,16,17,18,19]. Arabidopsis NAC TF gene AtNAP performs functions as a negative regulator by inhibiting the expression of ABSCISIC ACID-RESPONSIVE ELEMENT BINDING PROTEIN1 (AREB1) under salt treatment conditions [9]. Rice OsNAP, the homologous gene of AtNAP, was significantly induced under abiotic stresses, such as salt, drought, and cold [20]. OsNAP-overexpressed rice plants exhibited enhanced resistant to salt, drought, and cold in their vegetative stage and improved yield under drought stress in their flowering stage [20]. Rice OsNACL35 positively regulated rice salt stress tolerance [21]. OsNAC3 is involved in the ABA response and salt tolerance via regulating the expression of stress-related genes in rice [22]. Overexpressing Populus NAC045 dramatically enhanced salt tolerance in transgenic tobacco [18]. Grapevine NAC17 displayed enhanced salt, cold, and drought tolerance in Arabidopsis [23]. NAC family genes have also been comprehensively explored from both wild and cultivated peanut [24,25]. Overexpressing peanut AhNAC2 and AhNAC3 improved both salt and drought tolerance in transgenic model plants [16,19].
Peanut, or groundnut (Arachis hypogaea L.), is an important oil and cash crop that provides protein and edible oil for human health [26,27]. The whole life of peanut is affected by various abiotic stresses, such as salt stress, which can greatly damage peanut [28]. The mining of salt-tolerant genes is the foundation for salt-tolerant peanut breeding, which can be used in cultivating salt-tolerant peanut varieties through transgenic technology or molecular marker-assisted selection. Cultivated peanut is an allotetraploid with two subgenomes (A and B genomes), and the genome sequences have been released [26,27], which greatly facilitates the cloning of functional genes from peanut species. In recent years, potential gene or metabolite responses to high salinity have been identified through omics analysis [29,30]. Several genes that could enable plants to adapt to high salinity were isolated from peanuts. For example, the overexpression of AhWRKY75 conferred enhanced plant growth under salt stress [10]. Overexpressing the peanut MYB30 gene could enhance the resistance of transgenic Arabidopsis plants under salt stress [13]. The AhCytb6 gene enhanced seed germination efficiency under salt stress conditions in transgenic tobacco [31]. A CBL-interacting protein kinase from the wild peanut Arachis diogoi (AdCIPK5) conferred salt tolerance in transgenic tobacco [32]. The overexpression of peanut CuZnSOD could alleviate drought and salinity stresses in transgenic tobacco [33]. Notably, several genes negatively regulate the salt stress response in peanut. For example, AhABI4-silenced peanut plants exhibited resistance under stress, with an enhanced survival rate and plant growth in peanut seedlings [34].
In this study, a novel NAC transcription factor gene was identified from peanut through re-analyzing our previous transcriptome sequence data [30]. Phylogenetic analysis indicated that it was homologous to the AtNAP gene [9]; thus, we named it AhNAPa. The expression of the AhNAPa gene was highly induced under salt stress conditions. AhNAPa-overexpressing transgenic Arabidopsis was susceptible to high salinity, suggesting that AhNAPa negatively regulated salt tolerance in plants.

2. Materials and Methods

2.1. Plant Materials and Growth Conditions

The Arabidopsis plants used in this study were the Columbia-0 (Col-0) ecotype. Arabidopsis seeds were washed with 70% ethanol for about 5 min and then treated with 10% NaClO for 10 min and, finally, washed six times with sterilized water. Then, sterilized seeds were grown on 1/2 MS medium. After two days of 4 °C treatment, the plate was placed in a growth chamber at 22 °C under short-day conditions (8 h light/16 h dark) for germination. When two true leaves grew out, the seedlings were transferred to soil at 22 °C under short-day conditions, and the 30-day-old seedlings were moved to long-day conditions (16 h light/8 h dark) until maturity.
For the seedling assay, three-day-old seedlings were grown on 1/2 MS agar plates containing 125 mm NaCl for another 10 days, and at least three replicates from each transgenic line were performed. For the NaCl treatment for adult WT and AhNAPa-overexpressing (AhNAPa-OX) transgenic plants, 30-day-old plants grown under long-day conditions in a growth chamber (22 °C, 16 h light/8 h dark) were irrigated with 250 mM NaCl for 2 weeks.

2.2. Sequence Alignment and Phylogenetic Analysis

To explore the phylogenetical relationships between AhNAPa and proteins from other organisms, the AhNAPa amino acid sequence was blasted in the NCBI online website (https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 21 May 2023), and the most similar proteins from other organisms were retrieved. The putative amino acid sequences were aligned by the ClustalW program, the phylogenetical trees were constructed by MEGA 6.06 (6140226) using the neighbor-joining (NJ) method, and a bootstrap analysis was calculated for 1000 iterations. A putative amino acid comparison between Arachis NAP proteins was performed using DNAMAN V6 software.

2.3. Gene Expression Pattern Analysis

Total RNA was purified with a MiniBEST Plant RNA extraction kit (Takara, Dalian, China). The first-strand cDNAs were synthesized using a PrimeScript RT-PCR Kit (Takara). To analyze the expression patterns of AhNAPa, the average fragments per kilobase per million reads mapped (FPKM) values of 22 tissues from different developmental stages of A. duranensis and A. ipaensis were retrieved from Clevenger et al. [35]. The FPKM values were log2 transformed and displayed in the form of heatmaps via HemI [36]. Semi-quantitative RT-PCR was amplified using 2*Easy Taq PCR SuperMix (TransGen Biotech, Beijing, China). The PCR program was as follows: 94 °C denaturation for 3 min; 26 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s; and one final 72 °C extension for 10 min.
To analyze relative expression levels, RT-qPCR was performed using RNA samples isolated from 30-day-old seedlings with or without 250 mm NaCl treatment. The reactions were performed with 20 ng of cDNA, forward and reverse primers (400 nM each), and 10 μL of TB Green Premix Ex Taq II (Takara, Dalian, China)) for a total volume of 20 μL with DNase-free water. Reactions were performed using an ABI 7500 Fast Real-Time System (Applied Biosystems, Foster City, CA, USA) with the following reaction process: 50 °C for 2 min; 95 °C for 2 min; and 40 cycles of 95 °C for 15 s and 60 °C for 34 s. Three biological replicates under the same conditions were used for each experiment. The primers used in these reactions are listed in Table 1. The Actin gene [37] was used as an internal control for normalization.

2.4. Plasmid Construction and Plant Transformation

An 861 bp CDS fragment of AhNAPa was amplified using PrimeSTAR GXL DNA Polymerase (Takara, Dalian, China) with primers AhNAPa-F1 and AhNAPa-R1 (Table 1). The PCR product was then separated, purified, and subsequently ligated into BamHI- and SacI-digested pCambia2300EC (a modified pCambia2300 containing a 35S promoter and nos terminator) with an In-Fusion HD Cloning Kit (Takara, Dalian, China) to generate plasmid p35S::AhNAPa. The plasmid was then transformed into Agrobacterium tumefaciens strain GV3101 and used to transform wild-type Arabidopsis plants using the floral dip method [38]. The harvested seeds were surface-sterilized and screened on 1/2 MS medium containing 50 μg ml−1 kanamycin. The kanamycin-resistant Arabidopsis were detected with AhNAPa-specific primers: AhNAPa-F2 and AhNAPa-R2. The PCR-positive transgenic plants were then selfed, and the corresponding T2 transgenic seedlings that segregated with a ratio of 3:1 (resistant/sensitive) were chosen to generate a T3 line for further analysis.

2.5. Chlorophyll Content Measurement

The Soil and Plant Analyzer Development (SPAD) value, which reflects chlorophyll content, was measured using fourth or fifth rosette leaves separated from WT and AhNAPa-OX plants on a SPAD-502 plus chlorophyll meter (Konica Minolta, Inc., Tokyo, Japan).

2.6. Subcellular Localization Analysis

An AhNAPa cDNA fragment without a stop codon was amplified using primers AhNAPa-F3 and AhNAPa-R3 in Table 1 and fused with GFP to construct the expression vector p35S::AhNAPa-GFP. Tobacco leaves were transfected using A. tumefaciens strain GV3101 containing the p35S::AhNAPa-GFP plasmid, with a p35S::GFP plasmid used as a control. DAPI staining was used to determine the location of nuclei. The fluorescence signal was investigated using a confocal laser microscope.

2.7. Stress-Responsive Gene Analysis in Transgenic Arabidopsis

The expression levels of stress-responsive marker genes, such as SnRK2.2, NAC016, RD20, RD29B, and AREB1, were analyzed using RT-qPCR quantification. Leaves were harvested for each reaction under 250 mM NaCl solution treatment for twelve hours. The AtACTIN2 gene was used as an internal control. Expression levels at 0 h in WT plants were set as 1. Three biological replicates were taken for each sample, and two technical replicates were performed for each biological replicate.

3. Results

3.1. Identification and Characterization of NAP Proteins in Arachis Species

To identify genes involved in salt response, previous transcriptome data were re-analyzed, and the NAC gene was found significantly increased in peanut roots under salt stress [30]. The full-length open reading frame was retrieved from an online website (https://mines.legumeinfo.org/arachismine/begin.do (accessed on 23 April 2023). Its putative amino acid sequence was used as a query to blast in the NCBI database, and homologous proteins from other organisms were obtained. A phylogenetic tree was constructed based on their similarity and found that it had a very high similarity with genes such as AtNAP from Arabidopsis (Figure 1A), which play key roles in leaf senescence and abiotic stress [9,39]. Further analysis revealed that two orthologous gene copies were present in the A and B subgenomes of cultivated peanut with identical protein sequences, and thus we named them AhNAPa and AhNAPb (Figure 1B). There were also two orthologues in their ancestors, the wild diploid peanuts A. duranensis and A. ipaensis, and we named them AdNAP and AiNAP, respectively; these had more than 98% similarity with the AhNAPa and AhNAPb proteins (Figure 1B).

3.2. AhNAPa Was Expressed Ubiquitously and Induced by Salt Stress

To explore the expression patterns of the peanut NAP gene, we re-analyzed transcriptome data from Clevenger et al. [35] and found that AdNAP and AiNAP were ubiquitous expressed in 22 tissues from different developmental stages of two diploid wild peanuts (Figure 2A). To confirm this result, we performed RT-qPCR using total RNA purified from different tissues, including roots, stems, flowers, leaves, pegs, siliques, and seeds. Because two AhNAP proteins shared an identical sequence, we chose the AhNAPa gene for RT-qPCR analysis. The results showed that AhNAPa expression was detected in all examined tissues and was more strongly detected in roots and flowers (Figure 2B), which was in accordance with the re-analyzed transcriptome results (Figure 2A). We further analyzed the expression level of AhNAPa under salt stress by RT-qPCR and found that the expression of AhNAPa was upregulated gradually and reached a peak at 24 h in cultivated peanut roots after treatment with 250 mM NaCl solution (Figure 2C). These data indicated that the ubiquitously expressed AhNAPa was a salt-inducible gene.

3.3. AhNAPa Localized in the Nucleus

Several NAC proteins have been shown to localize in the nucleus [8,15,18]. However, we did not detect any obvious nuclear localization signal (NLS) predicted by PredictNLS (https://predictprotein.org/ (accessed on 3 August 2023)) or HMMER (https://www.ebi.ac.uk/Tools/hmmer/search/hmmscan (accessed on 3 August 2023)) analysis. In order to determine the subcellular localization of AhNAPa, the 35S::AhNAPa-GFP and 35S::GPF fusion constructs were transiently expressed in tobacco leaves and the GFP signals were visualized using a confocal microscope. DAPI staining results revealed that green fluorescence signals only existed in the nuclei of 35S::AhNAPa-GFP transformants, while signals were distributed on plasma membranes and in the cytoplasm of 35S::GFP transformants, suggesting that AhNAPa was possibly a nuclear protein (Figure 3).

3.4. AhNAPa-OX Plants Were Sensitive to Salt Stress

In order to determine the function of AhNAPa with regard to salt stress, we analyzed the response of AhNAPa-overexpressed (AhNAPa-OX) Arabidopsis to salt stress. A plasmid containing the AhNAPa gene driven by 35S was constructed and transformed into Arabidopsis. Homozygous T3 transgenic plants were generated and used for further functional analysis. To explore the function of AhNAPa at the seedling stage under salt stress, AhNAPa-OX Arabidopsis seeds were germinated on MS plates without NaCl, and the 3-day-old seedlings were moved onto MS plates containing 0 mM and 125 mM NaCl, respectively. After the seedlings had grown vertically for 10 days on the MS plates without NaCl, the AhNAPa-OX lines were almost indistinguishable from the wild type (WT) plants. However, under NaCl treatment, the root lengths of AhNAPa-OX plants were dramatically inhibited compared with the WT lines (Figure 4A,C). These results suggested that AhNAPa-OX Arabidopsis plants became more sensitive to salinity than WT plants at the seedling stage.
To further investigate the functions of the AhNAPa gene in adult plants under salt stress, 30-day-old seedlings of AhNAPa-OX and WT Arabidopsis plants were irrigated with 0 or 250 mM NaCl solutions for two weeks. The growth of WT and AhNAPa-OX plants exhibited no obvious differences in the absence of NaCl. However, after treatment with a 250 mM NaCl solution, AhNAPa-OX plants almost completely withered and died compared with the WT lines (Figure 4B). The chlorophyll contents were considered to reflect the degree of salt stress [40]. We found that SPAD values were much lower in AhNAPa-OX plants than in WT under 250 mM NaCl treatment (Figure 4D). These results suggested that AhNAPa might function as a negative regulator in response to salt stress in plants.

3.5. AhNAPa Inhibited the Expression of Stress-Responsive Genes

To further explore the molecular mechanism of AhNAPa under salt stress, the expression of selected stress-responsive marker genes was investigated with RT-qPCR. Under normal conditions, these abiotic stress-responsive marker genes, SnRK2.2 (AT3G50500), NAC016 (AT1G34180), RD20 (AT2G33380), RD29B (AT5G52300), and AREB1 (AT1G45249), exhibited no obvious difference between WT and AhNAPa-OX plants. However, under salt stress, the expression levels of SnRK2.2, NAC016, RD20, RD29B, and AREB1 genes all increased dramatically in WT plants but decreased markedly in AhNAPa-OX plants, even more so than without NaCl treatment (except for the RD29B gene) (Figure 5). These results indicated that the AhNAPa gene might mediate salt stress signaling via an ABA-dependent repression of AREB1 expression.

4. Discussion

Salt stress is one of the devastating environmental problems that affects crop productivity and leads to economic losses [1,2]. In order to circumvent salt stress, plants have evolved a series of rigorous strategies [4,5,6,7]. Recently, many TFs have been found to perform functions in the regulation of salt tolerance in different plants, such as MYB, NAC, WRKY, etc. [4,7,10,11,12,13]. The NAC gene family has been comprehensively identified in peanuts [24,25], but only a few NAC genes have been functionally analyzed [16,19]. AhNAC1 and AhNAC3 positively regulated the peanut salt and/or drought response, and transgenic Arabidopsis and tobacco plants exhibited enhanced resistance under abiotic stresses [16,19]. However, the biological functions of AhNAPa have not been yet clarified.
In this study, we analyzed the role of AhNAPa involved in salt stress response, because AhNAPa exhibited high expression levels under salt stress conditions (Figure 2C). Previous studies showed that AtNAP was induced under salt stress, targeted the nucleus, and played a negative role in salt stress response [39]. Phylogenetical analysis showed that AhNAPa exhibited high similarity with AtNAP (AT1G69490), indicating that they shared similar functions. NAP proteins from two subgenomes of cultivated peanut covered the same putative amino acid sequences (Figure 1B), which indicated the possibility that AhNAPa and AhNAPb might function redundantly. RNA-seq analysis showed that AdNAP and AiNAP, the orthologous gene of AhNAPa and AhNAPb, exhibited similar expression patterns (Figure 2A), further implying that the genes functioned redundantly.
Transcript patterns and subcellular localization analysis indicated that AhNAPa was expressed ubiquitously and was a salt-induced nuclear localization gene (Figure 2 and Figure 3). Several NAC proteins that localize to the nucleus have been predicted to contain an NLS when analyzed by PredictNLS and HMMER [8,15,18]. However, no single conserved NLS site was detected with these prediction tools in the AhNAPa sequence. A similar result was also found with the AtNAP gene [39]. The seed germination ratio of AhNAPa-OX plants became much lower than that of the WT under salt stress (Figure 4A). The AhNAPa-OX plants became more susceptible to salt stress than WT plants (Figure 4B–D). These results suggested that AhNAPa might negatively regulate salt tolerance in peanut. OsNAP and AtNAP also have important roles in senescence [39,41]. AhNAPa might also function differently in peanut; however, its roles in regulating senescence need further studies.
NAC transcription factors have been widely analyzed in plants under abiotic stresses, such as salt [22], drought [42], chilling [23,43], etc. NAC TFs performed either negative or positive functions in response to these abiotic stresses [44,45]. In our study, AhNAPa and its homologous gene AtNAP performed functions as negative regulators in the salt stress response; however, the homologous rice gene OsNAP was reported to positively regulate abiotic stress responses [20], suggesting different functions of NAP genes between monocots and dicots in abiotic stress responses. Interestingly, both OsNAP and AtNAP positively regulated senescence [39,41].
AREB1, which encodes a TF protein in the stress-responsive ABA signaling pathway, directly interacted with SnRK2.2, RD29B, and RD20 [9]. Under drought stress, the expression of AREB1 was downregulated by NAC016 [44]. To identify downstream genes of AhNAPa involved in salt stress, we performed RT-qPCR to determine the transcript levels of SnRK2.2, NAC016, RD20, RD29B, and AREB1 genes, which are involved in the ABA-dependent abiotic stress response. Our results showed that transcript levels of SnRK2.2, NAC016, RD20, RD29B, and AREB1 all significantly decreased in AhNAPa-OX plants compared to those of WT plants under salt stress conditions (Figure 5), suggesting that AhNAPa might downregulate the expression of the stress-responsive genes SnRK2.2, NAC016, RD20, RD29B, and AREB1, and thus contribute to the susceptibility of AhNAPa-OX to salt stress. Taken together, these results show that AhNAPa might regulate plant abiotic stress via an ABA-dependent signaling pathway.

5. Conclusions

In this study, we identified a nucleus-localized NAC TF AhNAPa from peanut, which exhibited a ubiquitous expression pattern and was highly induced under salt stress. The expression levels of abiotic stress-responsive genes involved in the ABA signaling pathway were dramatically decreased in AhNAPa-OX plants. The AhNAPa-OX transgenic Arabidopsis plants became sensitive to high salinity, which suggested that AhNAPa performed a negative role in regulating salt tolerance in plants.

Author Contributions

Formal analysis: C.Y., H.M. and Q.S. Funding acquisition: C.Y., H.M. and S.S. Investigation: C.Y. and Q.S. Writing—original draft: C.Y. and Q.S. Writing—review and editing: H.M., Q.S., and S.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (32001585), National Key Research and Development Program (2022YFD1200403), Natural Science Foundation of Shandong Province (ZR2021MC128), Agro-Industry Technology Research System of Shandong Province (SDAIT-04-01), Xinjiang “Tianchi Talent” Program (2nd), and Xinjiang “Tianshan Talent” Program (2022TSYCCX0062).

Data Availability Statement

The original contributions presented in the study are included in the article; further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Hopmans, J.W.; Qureshi, A.S.; Kisekka, I.; Munns, R.; Grattan, S.R.; Rengasamy, P.; Ben-Gal, A.; Assouline, S.; Javaux, M.; Minhas, P.S.; et al. Critical knowledge gaps and research priorities in global soil salinity. Adv. Agron. 2021, 169, 1–191. [Google Scholar]
  2. Zhang, H.; Yu, F.; Xie, P.; Sun, S.; Qiao, X.; Tang, S.; Chen, C.; Yang, S.; Mei, C.; Yang, D.; et al. A Gγ protein regulates alkaline sensitivity in crops. Science 2023, 379, eade8416. [Google Scholar] [CrossRef] [PubMed]
  3. Lal, R. Soil Health and Climate Change: An Overview; Springer: Berlin/Heidelberg, Germany, 2011; Volume 29. [Google Scholar]
  4. Gong, Z.; Xiong, L.; Shi, H.; Yang, S.; Herrera-Estrella, L.R.; Xu, G.; Chao, D.; Li, J.; Wang, P.; Qin, F.; et al. Plant abiotic stress response and nutrient use efficiency. Sci. China Life Sci. 2020, 63, 635–674. [Google Scholar] [CrossRef] [PubMed]
  5. Yu, Z.; Duan, X.; Luo, L.; Dai, S.; Ding, Z.; Xia, G. How Plant Hormones Mediate Salt Stress Responses. Trends Plant Sci. 2020, 25, 1117–1130. [Google Scholar] [CrossRef] [PubMed]
  6. Yang, Y.; Guo, Y. Elucidating the molecular mechanisms mediating plant salt-stress responses. New Phytol. 2018, 217, 523–539. [Google Scholar] [CrossRef]
  7. Zhu, J. Salt and drought stress signal transduction in plants. Annu. Rev. Plant Biol. 2020, 53, 247–273. [Google Scholar] [CrossRef]
  8. Xie, Q.; Frugis, G.; Colgan, D.; Chua, N. Arabidopsis NAC1 transduces auxin signal downstream of TIR1 to promote lateral root development. Genes Dev. 2000, 14, 3024–3036. [Google Scholar] [CrossRef]
  9. Seok, H.Y.; Woo, D.H.; Nguyen, L.V.; Tran, H.T.; Tarte, V.N.; Muntazir Medhdi, S.M.; Lee, S.Y.; Moon, Y.H. Arabidopsis AtNAP functions as a negative regulator via repression of AREB1 in salt stress response. Planta 2017, 245, 329–341. [Google Scholar] [CrossRef] [PubMed]
  10. Zhu, H.; Jiang, Y.; Guo, Y.; Huang, J.; Zhou, M.; Tang, Y.; Sui, J.; Wang, J.; Qiao, L. A novel salt inducible WRKY transcription factor gene, AhWRKY75, confers salt tolerance in transgenic peanut. Plant Physiol. Biochem. 2021, 160, 175–183. [Google Scholar] [CrossRef]
  11. Nakashima, K.; Takasaki, H.; Mizoi, J.; Shinozaki, K.; Yamaguchi-Shinozaki, K. NAC transcription factors in plant abiotic stress responses. Biochim. Biophys. Acta 2011, 1819, 97–103. [Google Scholar] [CrossRef]
  12. Kidokoro, S.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Transcriptional regulatory network of plant cold-stress responses. Trends Plant Sci. 2022, 27, 922–935. [Google Scholar] [CrossRef] [PubMed]
  13. Chen, N.; Pan, L.; Yang, Z.; Su, M.; Xu, J.; Xiao, J.; Yin, X.; Wang, T.; Wan, F.; Chi, X. A MYB-related transcription factor from peanut, AhMYB30, improves freezing and salt stress tolerance in transgenic Arabidopsis through both DREB/CBF and ABA-signaling pathways. Front. Plant Sci. 2023, 14, 1136626. [Google Scholar] [CrossRef]
  14. Cao, L.; Yu, Y.; Ding, X.; Zhu, D.; Yang, F.; Liu, B.; Sun, X.; Duan, X.; Yin, K.; Zhu, Y. The Glycine soja NAC transcription factor GsNAC019 mediates the regulation of plant alkaline tolerance and ABA sensitivity. Plant Mol. Biol. 2017, 95, 253–268. [Google Scholar] [CrossRef] [PubMed]
  15. Fujita, M.; Fujita, Y.; Maruyama, K.; Seki, M.; Hiratsu, K.; Ohme-Takagi, M.; Tran, L.P.; Yamaguchi-Shinozaki, K.; Shinozaki, K. A dehydration-induced NAC protein, RD26, is involved in a novel ABA-dependent stress-signaling pathway. Plant J. 2004, 39, 863–876. [Google Scholar] [CrossRef] [PubMed]
  16. Liu, X.; Hong, L.; Li, X.; Yao, Y.; Hu, B.; Li, L. Improved drought and salt tolerance in transgenic Arabidopsis overexpressing a NAC transcriptional factor from Arachis hypogaea. Biosci. Biotechnol. Biochem. 2011, 75, 443–450. [Google Scholar] [CrossRef] [PubMed]
  17. Meng, X.; Liu, S.; Zhang, C.; He, J.; Ma, D.; Wang, X.; Dong, T.; Guo, F.; Cai, J.; Long, T.; et al. The unique sweet potato NAC transcription factor IbNAC3 modulates combined salt and drought stresses. Plant Physiol. 2023, 191, 747–771. [Google Scholar] [CrossRef]
  18. Zhang, X.; Cheng, Z.; Fan, G.; Yao, W.; Li, W.; Chen, S.; Jiang, T. Functional analysis of PagNAC045 transcription factor that improves salt and ABA tolerance in transgenic tobacco. BMC Plant Biol. 2022, 22, 261. [Google Scholar] [CrossRef] [PubMed]
  19. Liu, X.; Liu, S.; Wu, J.; Zhang, B.; Li, X.; Yan, Y.; Li, L. Overexpression of Arachis hypogaea NAC3 in tobacco enhances dehydration and drought tolerance by increasing superoxide scavenging. Plant Physiol. Biochem. 2013, 70, 354–359. [Google Scholar] [CrossRef] [PubMed]
  20. Chen, X.; Wang, Y.; Lv, B.; Li, J.; Luo, L.; Lu, S.; Zhang, X.; Ma, H.; Ming, F. The NAC family transcription factor OsNAP confers abiotic stress response through the ABA pathway. Plant Cell Physiol. 2014, 55, 604. [Google Scholar] [CrossRef]
  21. Sun, Y.; Song, K.; Guo, M.; Wu, H.; Ji, X.; Hou, L.; Liu, X.; Lu, S. A NAC Transcription Factor from ‘Sea Rice 86’ Enhances Salt Tolerance by Promoting Hydrogen Sulfide Production in Rice Seedlings. Int. J. Mol. Sci. 2022, 23, 6435. [Google Scholar] [CrossRef]
  22. Zhang, X.; Long, Y.; Chen, X.; Zhang, B.; Xin, Y.; Li, L.; Cao, S.; Liu, F.; Wang, Z.; Huang, H.; et al. A NAC transcription factor OsNAC3 positively regulates ABA response and salt tolerance in rice. BMC Plant Biol. 2021, 21, 546. [Google Scholar] [CrossRef] [PubMed]
  23. Ju, L.; Yue, F.; Min, Z.; Wang, H.; Fang, L.; Zhang, X. VvNAC17, a novel stress-responsive grapevine (Vitis vinifera L.) NAC transcription factor, increases sensitivity to abscisic acid and enhances salinity, freezing, and drought tolerance in transgenic Arabidopsis. Plant Physiol. Biochem. 2020, 146, 98–111. [Google Scholar] [CrossRef] [PubMed]
  24. Yuan, C.; Li, C.; Lu, X.; Zhao, X.; Yan, C.; Wang, J.; Sun, Q.; Shan, S. Comprehensive genomic characterization of NAC transcription factor family and their response to salt and drought stress in peanut. BMC Plant Biol. 2020, 20, 454. [Google Scholar] [CrossRef]
  25. Li, P.; Peng, Z.; Xu, P.; Tang, G.; Ma, C.; Zhu, J.; Shan, L.; Wan, S. Genome-Wide Identification of NAC Transcription Factors and Their Functional Prediction of Abiotic Stress Response in Peanut. Front. Genet. 2021, 12, 630292. [Google Scholar] [CrossRef] [PubMed]
  26. Zhuang, W.; Chen, H.; Yang, M.; Wang, J.; Pandey, M.K.; Zhang, C.; Chang, W.; Zhang, L.; Zhang, X.; Tang, R.; et al. The genome of cultivated peanut provides insight into legume karyotypes, polyploid evolution and crop domestication. Nat. Genet. 2019, 51, 865–876. [Google Scholar] [CrossRef] [PubMed]
  27. Bertioli, D.J.; Jenkins, J.; Clevenger, J.; Dudchenko, O.; Gao, D.; Seijo, G.; Leal-Bertioli, S.C.M.; Ren, L.; Famer, A.D.; Pandey, M.K.; et al. The genome sequence of segmental allotetraploid peanut Arachis hypogaea. Nat. Genet. 2019, 51, 877–884. [Google Scholar] [CrossRef] [PubMed]
  28. Krishna, G.; Singh, B.K.; Kim, E.K.; Morya, V.K.; Ramteke, P.W. Progress in genetic engineering of peanut (Arachis hypogaea L.)—A review. Plant Biotechnol. J. 2015, 13, 147–162. [Google Scholar] [CrossRef]
  29. Cui, F.; Sui, N.; Duan, G.; Liu, Y.; Han, Y.; Liu, S.; Wan, S.; Li, G. Identification of Metabolites and Transcripts Involved in Salt Stress and Recovery in Peanut. Front. Plant Sci. 2018, 9, 217. [Google Scholar] [CrossRef] [PubMed]
  30. Zhang, H.; Zhao, X.; Sun, Q.; Yan, C.; Wang, J.; Yuan, C.; Li, C.; Shan, S.; Liu, F. Comparative Transcriptome Analysis Reveals Molecular Defensive Mechanism of Arachis hypogaea in Response to Salt Stress. Int. J. Genom. 2020, 2020, 6524093. [Google Scholar] [CrossRef]
  31. Alexander, A.; Singh, V.K.; Mishra, A. Overexpression of differentially expressed AhCytb6 gene during plant-microbe interaction improves tolerance to N2 deficit and salt stress in transgenic tobacco. Sci. Rep. 2021, 11, 13435. [Google Scholar] [CrossRef]
  32. Singh, N.K.; Shukla, P.; Kirti, P.B. A CBL-interacting protein kinase AdCIPK5 confers salt and osmotic stress tolerance in transgenic tobacco. Sci. Rep. 2020, 10, 418. [Google Scholar] [CrossRef]
  33. Negi, N.P.; Shrivastava, D.C.; Sharma, V.; Sarin, N.B. Overexpression of CuZnSOD from Arachis hypogaea alleviates salinity and drought stress in tobacco. Plant Cell Rep. 2015, 34, 1109–1126. [Google Scholar] [CrossRef] [PubMed]
  34. Luo, L.; Wan, Q.; Zhang, K.; Zhang, X.; Guo, R.; Wang, C.; Zheng, C.; Liu, F.; Ding, Z.; Wan, Y. AhABI4s Negatively Regulate Salt-Stress Response in Peanut. Front. Plant Sci. 2021, 12, 741641. [Google Scholar] [CrossRef] [PubMed]
  35. Clevenger, J.; Chu, Y.; Scheffler, B.; Ozias-Akins, P. A Developmental Transcriptome Map for Allotetraploid Arachis hypogaea. Front. Plant Sci. 2016, 7, 1446. [Google Scholar] [CrossRef] [PubMed]
  36. Deng, W.; Wang, Y.; Liu, Z.; Cheng, H.; Xue, Y. HemI: A toolkit for illustrating heatmaps. PLoS ONE 2014, 9, e111988. [Google Scholar] [CrossRef] [PubMed]
  37. Chi, X.; Hu, R.; Yang, Q.; Zhang, X.; Pan, L.; Chen, N.; Chen, M.; Yang, Z.; Wang, T.; He, Y.; et al. Validation of reference genes for gene expression studies in peanut by quantitative real-time RT-PCR. Mol. Genet. Genom. 2012, 287, 167–176. [Google Scholar] [CrossRef] [PubMed]
  38. Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef]
  39. Guo, Y.; Gan, S. AtNAP, a NAC family transcription factor, has an important role in leaf senescence. Plant J. 2006, 46, 601–612. [Google Scholar] [CrossRef]
  40. Ashraf, M.; Harris, P.J.C. Potential biochemical indicators of salinity tolerance in plants. Plant Sci. 2004, 166, 3–16. [Google Scholar] [CrossRef]
  41. Liang, C.; Wang, Y.; Zhu, Y.; Tang, J.; Hu, B.; Liu, L.; Ou, S.; Wu, H.; Sun, X.; Chu, J.; et al. OsNAP connects abscisic acid and leaf senescence by fine-tuning abscisic acid biosynthesis and directly targeting senescence-associated genes in rice. Proc. Natl. Acad. Sci. USA 2014, 111, 10013. [Google Scholar] [CrossRef]
  42. Mao, H.; Li, S.; Chen, B.; Jian, C.; Mei, F.; Zhang, Y.; Li, F.; Chen, N.; Li, T.; Du, L.; et al. Variation in cis-regulation of a NAC transcription factor contributes to drought tolerance in wheat. Mol. Plant 2022, 15, 276–292. [Google Scholar] [CrossRef] [PubMed]
  43. Zhang, H.; Pei, Y.; Zhu, F.; He, Q.; Zhou, Y.; Ma, B.; Chen, X.; Guo, J.; Khan, A.; Jahangir, M.; et al. CaSnRK2.4-mediated phosphorylation of CaNAC035 regulates abscisic acid synthesis in pepper (Capsicum annuum L.) responding to cold stress. Plant J. 2024, 117, 1377–1391. [Google Scholar] [CrossRef] [PubMed]
  44. Sakuraba, Y.; Kim, Y.; Han, S.; Lee, B.; Paek, N. The Arabidopsis Transcription Factor NAC016 Promotes Drought Stress Responses by Repressing AREB1 Transcription through a Trifurcate Feed-Forward Regulatory Loop Involving NAP. Plant Cell 2015, 27, 1771–1787. [Google Scholar] [CrossRef] [PubMed]
  45. Tran, L. Functional analysis of Arabidopsis NAC transcription factors controlling expression of erd1 gene under drought stress. Plant Cell 2004, 16, 2482–2498. [Google Scholar]
Agronomy 14 01391 g001
Figure 1. Homologous proteins of NAP genes in Arachis and other different plant species. (A) A phylogenetical tree of AhNAPa and its homologous proteins from various plant organisms. (B) Comparison of putative amino acid sequences of NAP proteins from cultivated A. hypogaea and its two wild ancestors, A. duranensis and A. ipaensis. Os: Oryza sativa, Zm: Zea mays, Ta: Triticum aestivum, Gh: Gossypium hirsutum, Gm: Glycine max, Ca: Cicer arietinum, Cc: Cajanus cajan, Sb: Sesbania bispinosa, Mp: Mucuna pruriens, Am: Ammopiptanthus mongolicus, Vv: Vicia villosa, La: Lupinus angustifolius, Tr: Trifolium repens, Ms: Medicago sativa, Gs: Glycine soja.
Figure 1. Homologous proteins of NAP genes in Arachis and other different plant species. (A) A phylogenetical tree of AhNAPa and its homologous proteins from various plant organisms. (B) Comparison of putative amino acid sequences of NAP proteins from cultivated A. hypogaea and its two wild ancestors, A. duranensis and A. ipaensis. Os: Oryza sativa, Zm: Zea mays, Ta: Triticum aestivum, Gh: Gossypium hirsutum, Gm: Glycine max, Ca: Cicer arietinum, Cc: Cajanus cajan, Sb: Sesbania bispinosa, Mp: Mucuna pruriens, Am: Ammopiptanthus mongolicus, Vv: Vicia villosa, La: Lupinus angustifolius, Tr: Trifolium repens, Ms: Medicago sativa, Gs: Glycine soja.
Agronomy 14 01391 g001
Agronomy 14 01391 g002
Figure 2. Expression profile analysis of AhNAPa gene. (A) Expression profile of orthologous genes of AhNAPa (AdNAP and AiNAP) in 22 tissues from different developmental stages of two wild diploid peanuts. The transcriptome data from Clevenger et al. [36] were re-analyzed, the average FPKM values were log2 transformed, and the expression profile is displayed in a heatmap generated by HemI 1.0.3.7. The expression levels are shown in different colors (red, high expression; green, low expression). The symbols at the top are the 22 tissues from different developmental stages. (B) AhNAPa in different tissues investigated by semi-quantitative RT-PCR (26 cycles). AhACTIN was used as an internal control (26 cycles). R, root; S, stem; ML, main stem leaf; LL, lateral stem leaf; F, flower; P, peg; Si, silique; Se, seed. (C) Relative expression of AhNAPa under NaCl treatment analyzed by RT-qPCR. Total RNA was purified from 10-day-old seedlings treated with 250 mm NaCl at 0, 2, 6, 12, 24, and 48 h. These expression data were normalized to the expression of AhACTIN. The bars were calculated from three independent replicates and compared with 0 mM NaCl treatment (0 h).
Figure 2. Expression profile analysis of AhNAPa gene. (A) Expression profile of orthologous genes of AhNAPa (AdNAP and AiNAP) in 22 tissues from different developmental stages of two wild diploid peanuts. The transcriptome data from Clevenger et al. [36] were re-analyzed, the average FPKM values were log2 transformed, and the expression profile is displayed in a heatmap generated by HemI 1.0.3.7. The expression levels are shown in different colors (red, high expression; green, low expression). The symbols at the top are the 22 tissues from different developmental stages. (B) AhNAPa in different tissues investigated by semi-quantitative RT-PCR (26 cycles). AhACTIN was used as an internal control (26 cycles). R, root; S, stem; ML, main stem leaf; LL, lateral stem leaf; F, flower; P, peg; Si, silique; Se, seed. (C) Relative expression of AhNAPa under NaCl treatment analyzed by RT-qPCR. Total RNA was purified from 10-day-old seedlings treated with 250 mm NaCl at 0, 2, 6, 12, 24, and 48 h. These expression data were normalized to the expression of AhACTIN. The bars were calculated from three independent replicates and compared with 0 mM NaCl treatment (0 h).
Agronomy 14 01391 g002
Agronomy 14 01391 g003
Figure 3. Subcellular localization of AhNAPa protein. The AhNAPa-GFP fusion construct and the GFP gene were transiently expressed in tobacco epidermal cells. The bars indicate 100 μm. DAPI indicates 4,6-diamidino-2-phenylindole nuclear staining.
Figure 3. Subcellular localization of AhNAPa protein. The AhNAPa-GFP fusion construct and the GFP gene were transiently expressed in tobacco epidermal cells. The bars indicate 100 μm. DAPI indicates 4,6-diamidino-2-phenylindole nuclear staining.
Agronomy 14 01391 g003
Agronomy 14 01391 g004
Figure 4. The AhNAPa-OX Arabidopsis plants were more sensitive to salt stress compared with WT plants. (A) AhNAPa-OX and WT seedlings grown on 1/2 MS medium containing 0 mM or 125 mM NaCl. Pictures were taken after treatment at 22 °C for 10 d. (B) One-month-old WT and AhNAPa-OX plants under 0 mM and 250 mM NaCl treatment. (C) Primary root length of the seedlings in (A). Error bars represent sd (n = 20). *** p < 0.05 (Student’s t-test). (D) SPAD values of WT and AhNAPa-OX plants in (B). Error bars represent sd (n = 10). *** p < 0.05 (Student’s t-test). SPAD value, which reflected chlorophyll content, was measured with a SPAD-502 plus chlorophyll meter (Konica Minolta, Inc., Tokyo, Japan).
Figure 4. The AhNAPa-OX Arabidopsis plants were more sensitive to salt stress compared with WT plants. (A) AhNAPa-OX and WT seedlings grown on 1/2 MS medium containing 0 mM or 125 mM NaCl. Pictures were taken after treatment at 22 °C for 10 d. (B) One-month-old WT and AhNAPa-OX plants under 0 mM and 250 mM NaCl treatment. (C) Primary root length of the seedlings in (A). Error bars represent sd (n = 20). *** p < 0.05 (Student’s t-test). (D) SPAD values of WT and AhNAPa-OX plants in (B). Error bars represent sd (n = 10). *** p < 0.05 (Student’s t-test). SPAD value, which reflected chlorophyll content, was measured with a SPAD-502 plus chlorophyll meter (Konica Minolta, Inc., Tokyo, Japan).
Agronomy 14 01391 g004
Agronomy 14 01391 g005
Figure 5. Quantitative RT-PCR analysis of stress-related marker genes SnRK2.2, NAC016, RD20, RD29B, and AREB1 in WT and AhNAPa-OX Arabidopsis plants under 250 mM NaCl treatment for 0 and 12 h. The AtACTIN2 gene was used as an internal control. The expression at 0 h in WT plants was set as 1. Three biological replicates were performed for each sample and two technical replicates were performed for each biological replicate. Error bars represent sd (n = 6). * p < 0.05 (Student’s t-test).
Figure 5. Quantitative RT-PCR analysis of stress-related marker genes SnRK2.2, NAC016, RD20, RD29B, and AREB1 in WT and AhNAPa-OX Arabidopsis plants under 250 mM NaCl treatment for 0 and 12 h. The AtACTIN2 gene was used as an internal control. The expression at 0 h in WT plants was set as 1. Three biological replicates were performed for each sample and two technical replicates were performed for each biological replicate. Error bars represent sd (n = 6). * p < 0.05 (Student’s t-test).
Agronomy 14 01391 g005
Table 1. Primers used in this study.
Table 1. Primers used in this study.
PrimersSequences (5′–3′)Objective
AhNAPa-F1TGGAGAGAACACGGGGGATCCATGGAAGGAAGTAGTAAAAGGene cloning
AhNAPa-R1CGATCGGGGAAATTCGAGCTCTTAGTAATATCCTCTTAAATCA
AhNAPa-F2AGGACAGGAATACCCAACAACATransgenic Arabidopsis detection
AhNAPa-R2TTAGTAATATCCTCTTAAATCA
AhNAPa-F3ATGGAAGGAAGTAGTAAAAGSublocalization
AhNAPa-R3TTAGTAATATCCTCTTAAATCA
AhNAPa-qFAGGACAGGAATACCCAACAACART-qPCR
AhNAPa-qRAGGGAACAAGTCCTTGGAAGA
AhACTIN-FTTGGAATGGGTCAGAAGGATGCRT-qPCR
AhACTIN-RAGTGGTGCCTCAGTAAGAAGC
AtSnRK2.2-FCGATCCCAGAGGACTTACACCRT-qPCR
AtSnRK2.2-RGATTCTTGTTGCCGGATCAGC
AtNAC016-FATGTCTAGCTTCAGCCGAGTGRT-qPCR
AtNAC016-RCTGCCCACTCTCTTCGTAGT
AtRD20-FAGCATGGGAGTGATTCGAGCRT-qPCR
AtRD20-RACCGTTAGCGCGTATTTGCT
AtAREB1-FCCAATGTAACAGCTCCGGGTRT-qPCR
AtAREB1-RACCGGTGACAACGACATTGA
AtACTIN2-FGGTAACATTGTGCTCAGTGGTGGRT-qPCR
AtACTIN2-RAACGACCTTAATCTTCATGCTGC
Underlined are BamHI and SacI restriction enzyme sites, respectively.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yuan, C.; Miao, H.; Sun, Q.; Shan, S. Peanut NAC Transcription Factor AhNAPa Negatively Regulates Salt Tolerance in Transgenic Arabidopsis. Agronomy 2024, 14, 1391. https://doi.org/10.3390/agronomy14071391

AMA Style

Yuan C, Miao H, Sun Q, Shan S. Peanut NAC Transcription Factor AhNAPa Negatively Regulates Salt Tolerance in Transgenic Arabidopsis. Agronomy. 2024; 14(7):1391. https://doi.org/10.3390/agronomy14071391

Chicago/Turabian Style

Yuan, Cuiling, Haocui Miao, Quanxi Sun, and Shihua Shan. 2024. "Peanut NAC Transcription Factor AhNAPa Negatively Regulates Salt Tolerance in Transgenic Arabidopsis" Agronomy 14, no. 7: 1391. https://doi.org/10.3390/agronomy14071391

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop