Genetic Evaluation of Kazakhstani Potato Germplasm for Pathogen and Pest Resistance Using DNA Markers

Abstract

Potato is one of the most consumed crops worldwide. One strategy aimed at pathogen and pest management is the cultivation of resistant varieties. In this study, 352 genotypes from the Kazakhstan potato germplasm collection were screened for the presence of loci for resistance to the most harmful pathogens and pests using 30 DNA markers. ‘Rucheek’ and ‘Spiridon’, among the top global varieties, and ‘Janaisan’ and ‘Fedor’, among the top local varieties, were identified as bearing the most resistance loci in the collection, with at least 14 markers each. The specimens carrying the genes Ryadg (ADG1, ADG2), Nb (SPUD237), Ns (SC811, CP16), Rpi-phu1 (GP94), and GroV1 (X02), which demonstrate confirmed resistance to PVY, PVA, PVX, PVS, Phytophthora infestans, and Globodera rostochiensis, were most frequently found in the collection. Loci for resistance to Synchytrium endobioticum and Globodera pallida were less introgressed into the Kazakhstani cultivars and were almost absent in the germplasm collection. The less abundant loci found in the current potato collection were Ryadg (RysC3), Gro1-4 (Gro1-4), and Rladg (RGASC₈₅₀). Screening of the potato collection showed that the markers SPUD237, CP60, 45/X1, and CT214 generated additional polymorphic amplicons, while markers Nl25, C237, GP179, and GP122₇₁₈ were less applicable in robust large-scale screening. The results from this study may greatly contribute to marker-assisted selection and gene pyramiding strategies aimed at developing new potato varieties with multiple resistance to biotic stress

1. Introduction

Potato (Solanum tuberosum ssp. tuberosum L.) is the fourth-most important food crop in the world after rice, wheat, and maize, and among them, it is the most important non-grain crop. Half of the world’s potatoes are grown in Asia, and their total production amounted to 374 million tons in 2022. In Kazakhstan, potato is considered a staple food and is second only to wheat. In recent decades, there has been a noticeable increase in the gross potato harvest in Kazakhstan. However, diseases caused by a number of pathogens and pests, including viruses, nematodes, oomycetes, and fungi, have led to significant crop damage. Potato diseases are significant factors decreasing yield worldwide. Therefore, high-quality and disease-free seed materials remain the main requirement for stable potato productivity. Additionally, approximately 90% of potato seeds utilized in Kazakhstan’s agricultural sector are imported from Europe. This substantial reliance on foreign seed sources leads to the accidental introduction and exchange of various pathogens, including novel strains, isolates, and new species, posing risks to local crop health and biosecurity and requiring stringent monitoring and management practices.

Because potato is a vegetatively propagated crop, there is a constant risk of virus accumulation in seed tubers. Today, there are more than 50 viruses that infect potatoes under natural conditions, and several of them have economic importance for the global potato production industry [1]. Among them, potato leafroll virus (PLRV), potato virus A (PVA), potato virus S (PVS), potato virus X (PVX), and potato virus Y (PVY) cause the most harmful effects, such as tuber quality degradation, spotting, yield reduction, and leaf mosaic, chlorosis, and necrosis [2]. The severity of the economic consequences of viral infections depends on the geographical region, strain of the virus, vector activity, presence of other pathogens and pests, and environmental conditions [3]. Several genes associated with resistance to viruses have been identified in wild potato accessions and subsequently introgressed into cultured relatives. Ryadg from S. tuberosum subsp. andnevzigena, Rysto and Ry-fsto from S. stoloniferum, and Rychc from S. chacoense confer extreme resistance (ER) to PVY [4,5,6]. Rx1 is the major gene responsible for ER to PVX, whereas Nb confers a strain-specific hypersensitive reaction (HR) to the virus. The Ns gene from S. tuberosum ssp. andigena is associated with ER to PVS in potato. Rladg is the major gene affecting resistance to PLRV and was derived from S. tuberosum ssp. andigena.

Another group of potato diseases negatively affecting yield and leading to economic losses is fungal and fungi-like pathogens, such as Phytophthora infestans and Synchytrium endobioticum. The transmission of late blight mostly occurs through infected tubers. To combat this disease, about USD 210 million is spent annually. Late blight caused by P. infestans leads to annual yield losses of up to 10–15% worldwide. Along with viral infections, late blight is one of the most common diseases of potato in Kazakhstan. The R1 gene, Rpi-ber1, Rpi-phu1, and Rpi-Smira1 resistance loci, which are tightly linked to immune responses to P. infestans, confer race-specific late blight resistance [7,8,9,10].

Potato wart or black scab caused by the chytrid fungus Synchytrium endobioticum is another widespread fungal disease of potato and considered one of the most hazardous quarantine infections of cultivated potatoes. Synchytrium endobioticum has not yet been detected in the Republic of Kazakhstan. The Sen1 resistance gene, mapped on chromosome XI, provides immune defense against S. endobioticum race 1. Both P. infestans and S. endobioticum have been shown to infect other members of the Solanaceae family; nevertheless, potato remains their main host.

Potato cyst nematode (PCN) is a major biotic stressor in potato crops, causing up to 30% yield loss [11]. Infected plants are characterized by stunted growth, smaller tuber size, curved stems, and withering of the top leaves. The most harmful PCN species, Globodera rostochiensis and G. pallida, are included in the list of quarantined and especially dangerous harmful organisms of the Republic of Kazakhstan [12], as in many other countries [13]. To date, G. rostochiensis and G. pallida have already been found in 126 countries. Despite the fact that G. pallida and G. rostochiensis have not been officially detected in Kazakhstan, G. rostochiensis partially inhabits the territory according to farmer surveys. Crop losses caused by these two PCN species amount to 9% throughout the world [14]. Several Nem-R genes have been identified in the potato genome, including H1 and GroV1, which are responsible for resistance to G. rostochiensis [15], and Gpa2, which is responsible for resistance to G. pallida pathotype Pa2 [16]. In response to the virulent activity of pests, Nem-R genes encode peptides that activate plant cell necrosis, a result of endoparasite infestation at the feeding site, preventing further pest activity [17].

In Kazakhstan, potato germplasm is mainly located at the Kazakh Fruit and Vegetable Research Institute and maintained under field conditions. Unfortunately, Kazakhstan currently lacks an official potato gene bank preserved through in vitro techniques or cryopreservation, and research in this area remains relatively limited. To date, strategies among local farmers for pest control and pathogen eradication include crop rotation and the use of biological agents, pesticides, and resistant cultivars. However, since chemical methods are not environmentally friendly and crop rotation is time-consuming, the cultivation of resistant varieties against biotic factors constitutes a prospective goal. Conversely, pathogen control measures are limited to controlling the consequences of pathogens but not the cause itself.

In recent decades, marker-assisted selection (MAS) has dominated crop improvement, supporting agricultural sustainability. DNA markers tightly linked to the locus of interest, encoding resistance to a pathogen or pest, allow breeders to select parental lines for breeding. To date, single nucleotide polymorphism (SNP), random amplified polymorphic DNA (RAPD), sequence-characterized amplified region (SCAR), and cleaved amplified polymorphic sequence (CAPS) markers are broadly used in molecular analysis for potato breeding. MAS is less commonly implemented in Kazakhstan, where breeding programs primarily focus on phenotypic traits. Greater emphasis is placed on observable characteristics rather than molecular markers. However, some studies on the genetic background of Kazakhstani potatoes have already been conducted [18,19,20,21,22]. Some attempts have been made to employ cisgenic biolistic transformation to confer resistance to late blight and to use DNA markers associated with PVY for MAS. Nonetheless, the broader approach remains constrained. These techniques play a critical role in enhancing the efficiency and effectiveness of breeding processes. By integrating MAS, breeders can more accurately identify and select desirable traits, ultimately leading to the development of superior potato varieties with improved yield, disease resistance, and other valuable characteristics. This approach not only accelerates the breeding cycle but also ensures the sustainability and resilience of potato crops in the face of various agricultural challenges.

To advance MAS and gene pyramiding strategies for developing new potato varieties resistant to biotic factors for cultivation in climate of central Asia, comprehensive screening was conducted on 352 potato accessions from the Kazakhstani collection. These accessions were evaluated, using 30 DNA markers, for the presence of resistance loci against the most harmful and economically significant pathogens and pests, including PLRV, PVA, PVS, PVX, PVY, P. infestans, S. endobioticum, G. rostochiensis, and G. pallida. This is the first large-scale DNA testing of a potato collection presented in Kazakhstan, including foreign varieties tested in the field for productivity traits and included in ‘State Register of breeding achievements recommended for use in the Republic of Kazakhstan and the list of promising varieties of agricultural plants’.

2. Materials and Methods

2.1. Plant Material

In this study, 352 potato tubers from the collection of the Kazakh Fruit and Vegetable Research Institute (Almaty, Kazakhstan) and the Saken Seifullin Kazakh Agrotechnical University (Astana, Kazakhstan) were analyzed. The plant material comprised 227 cultivars, 38 breeding lines, 86 hybrids, and 1 variety of an unknown type. The majority of these originated in Kazakhstan (166), but some of the tubers originated from Europe, the USA, and East Asia (Table S1). Agronomic properties of the studied cultivars according to the State registry of breeding achievements recommended for use in the Republic of Kazakhstan as well as the data from the potato material providers and other sources are shown in Table S2.

2.2. DNA Isolation

The genomic DNA for each specimen was isolated from potato sprouts. For total DNA extraction, a modified CTAB (cetriltrimethylammonium bromide) method was used [23]. A 100 mg sample of plant material was crushed in 1 mL of preheated extraction buffer (2% CTAB; 1% polyvinylpyrrolidone; 1 M Tris, pH 8.0; 5 M NaCl; 0.5 M EDTA; pH 8.0) and incubated at 65 °C for 1 h with vortexing at 800× g. To separate the aqueous phase containing DNA, an equal volume of pre-chilled chloroform was added to the lysed plant material, followed by centrifugation at 13,000× g for 12 min at 4 °C. The aqueous phase was treated with RNAse A (Thermo Fisher Scientific, Waltham, MA, USA) at 37 °C for 30 min. The DNA solution was purified by the addition of 700 µL of chloroform and centrifuged at 13,000× g for 12 min at 4 °C. The genomic DNA was concentrated and precipitated by adding 800 µL of cold isopropanol (−20 °C), incubating at −20 °C for 60 min, and centrifuging at 13,000× g for 15 min. The DNA pellet was washed with 70% ethanol and then dissolved in 50 µL of ultrapure water. DNA samples were analyzed via the UV absorption method and gel electrophoresis [24].

2.3. PCR and Restriction Analysis

A range of molecular markers, including PCR-based, SCAR, and CAPS markers, previously validated in breeding programs, were used for screening in this study [25,26,27,28] (

Table 1. DNA markers used in present study.

Marker	Gene/QTL	Type	Forward and Reverse Primer Sequences (5′-3′)	PCR Conditions	Size (bp)	Resistance	References
Potato wart
Potato virus
GP122564	Ry-fsto	CAPS/EcoRV	F-TATTTTAGGGGTACTTCTTTCTTATGTT; R-CTGTCAAAAAAATTCACTTGCATAACTAC	94 °C—1 min, 40 cycles (93 °C—20 s, 53 °C—25 s, 72 °C—1 min), 72 °C—5 min	718 bp 564 bp	PVYN,	[1]
GP122718	Ry-fsto	CAPS/EcoRV	F-TATTTTAGGGTACTTCTTTCTTA; R-GCACTCAATAGCCCTTCTT	94 °C—1 min, 40 cycles (93 °C—20 s, 53 °C—25 s, 72 °C—1 min), 72 °C—5 min	718 bp 564 bp 400 bp	PVYN,	[4]
ADG1	Ryadg	PCR-baced, AS	F-CACACTCTCGTATCAGTTTGA; R-ATTTAATAGCGTGACAGT CAAC	93 °C—2 min; 35 × (93 °C—45 s, 55 °C—45 s, 72 °C—80 s), 72 °C –10 min.	356 bp	PVYO, PVYN, PVA	[29]
ADG2	Ryadg	PCR-baced, AS	F-CACACTCTCGTATCAGTTTGA; R-ATTTAATAGCGTGACAGT CAAC	93 °C—2 min; 35 × (93 °C—45 s, 55 °C—45 s, 72 °C—80 s), 72 °C –10 min.	354 bp	PVYO, PVYN, PVA	[29]
RysC3	Ryadg	SCAR	F-ATACACTCATCTAAATTTGATGG; R-AGGATATACGGCATCATTTTTCCGA	93 °C—9 min, 35 × (94 °C—45 s, 60 °C—45 s, 72 °C—60 s), 72 °C—5 min	321 bp	PVY	[30]
RY186	Rychc	PCR-baced, AS	F-TGGTAGGGATATTTTCCTTAGA; R-GCAAATCCTAGGTTATCAACTCA	95 °C—10 min, 35 × (94 °C—30 s, 55 °C—30 s, 72 °C—1.5 min), 72 °C—5 min	587 bp	PVY	[31]
SCARysto4	Rysto	SCAR	F-ATTCGTTCGCCTCTCTCCT R-TCATCACCCCTAACAAATACAA	94 °C—1 min, 35 × (94 °C—30 s; 54 °C –60 s; 72 °C—60 s), 72 °C—10 min	100 bp	PVY	[32,33]
SPUD237	Nb	CAPS/AluI	F-TTCCTGCTGATACTGACTAGAAAACC R-AGCCAAGGAAAAGCTAGCATCCAAG	94 °C—1 min, 35 × (94 °C—15 s; 55 °C—15 s; 72 °C—40 s), 72 °C—10 min	3 resistance products	PVX	[34]
CP60	Rx1	CAPS/DdeI	F-CAGCCTACCGCGAAAGTGCCTTCG R-GCCAACCCCACGAGTTTCTCACTGAC	94 °C—3 min, 35 × (92 °C—45 s, 58 °C—45 s, 72 °C—1 min), 72 °C—10 min	350 bp	PVX	[35]
PVX	Rx1	PCR-baced, AS	ATCTTGGTTTGAATACATGG CACAATATTGGAAGGATTCA	94 °C—10 min, 35 × (94 °C—30 s, 58 °C—30, 72 °C—1 min), 72 °C—5 min	1230 bp	PVX	[36]
RGASC850	Rladg	SCAR	F-GAATGCCAGGAATGGGAAAGACTACTTT R-TCACATCCAAGCAAAACCAA	95 °C—4 min 32 × (95 °C—45 s, 53 °C—1 min, 72 °C—1 min), 72 °C—10 min	850 bp	PLRV	[37]
SC811	Ns	CAPS/MboI	F-CGAACAAAATACGTAATGCATTGAATAA R-GACCT ATATCAGTCCCTTCTAATCCACTAT	94 °C—60 s, 30 × (93 °C—15 s, 56 °C—20 s, 72 °C—60 s), 72 °C—5 min	260 bp	PVS	[38]
CP16	Ns	CAPS/HindIII	F-CTTAAACGCGTCAAGTGAAACT R-TTAGGGACATACAAACAAACCTCA	94 °C—60 s, 35 × (94 °C—15 s, 55 °C—15 s, 72 °C—60 s), 72 °C—3 min	460 bp	PVS	[39]
Potato late blight
GP76	unknown	CAPS/RsaI	F-ATGAAGCAACACTGATGCAA R-TTCTCCAATGAACGCAAACT	93 °C—2 min, 40 × (93 °C—30 s, 55 °C—30 s, 72 °C—1 min), 72 °C—10 min	500 bp	Phytophthora infestans	[28]
BA47f2	R1	PCR-baced, AS	F-TAACCAACATTATCTTCTTTGCC R-GAATTTGGAGAGGGGTTTGCTG	93 °C—2 min, 40 × (93 °C—45 s, 55 °C—45 s and 72 °C—90 s), 72 °C—10 min	650 bp	Phytophthora infestans	[40]
R11400	R1	PCR-baced, AS	F-CACTCGTGACATATCCTCACTA R-CAACCCTGGCATGCCACG	93 °C—2 min, 40 × (93 °C—45 s, 55 °C—45 s and 72 °C—90 s), 72 °C—10 min	1400 bp	Phytophthora infestans	[7]
GP179	R1	PCR-baced, AS	F-GGTTTTAGTGATTGTGCTGC R-AATTTCAGACGAGTAGGCACT	93 °C—2 min, 40 × (93 °C—45 s; 55 °C—45 s; 72 °C—1min 20 s), 72 °C—10 min	570 bp	Phytophthora infestans	[40]
CT214	Rpi-ber1	CAPS/HinfI	F-CGCGAAAGAGTGCTGATAG R-CCGCTGCCTATGGAGAGT	94 °C—5 min, 35 × (94 °C—45s, 55 °C—45 s, 72 °C—1 min), 72 °C—8 min	3 resistance products	Phytophthora infestans	[41]
GP94	Rpi-phu1	PCR-baced, AS	F-ATGTATCACAATCACATTCTTGCTC R-TGTAAAACCAACAAGTAGTGTTGC	2 min— 95 °C, 40 × (93 °C—1 min, 56 °C—1 min, 72 °C—1 min), 72 °C—10 min	350 bp	Phytophthora infestans	[42]
45/XI	Rpi-Smira1	PCR-baced, AS	F-AGAGAGGTTGTTTCCGATAGACC R-TCGTTGTAGTTGTCATTCCACAC	94 °C—3 min; 39 × (94 °C—15 s, 55 °C—15 s, 72 °C—60 s), 72 °C– 7 min	900–1500 bp	Phytophthora infestans	[43]
Potato cyst nematodes
TG689	H1	PCR-baced, AS	F-TAAAACTCTTGGTTATAGCCTAT R-CAATAGAATGTGTTGTTTCACCAA	94 °C—5 min, 35 × (94 °C—45 s, 55 °C—45 s, and 72 °C—1 min), 72 °C—8 min	141 bp	Globodera rostochiensis, Ro 1	[44]
239E4left	H1	CAPS/AluI	F-GGCCCCACAAACAAGAAAAC R-AGGTACCTCCATCTCATTTTGTAAG	94 °C—3 min 35 × (94 °C—30 s, 51 °C—30s, 72 °C—90 s), 72 °C 5 min	230 bp	Globodera rostochiensis	[45]
Gro1-4	Gro1-4	SCAR	F-TCTTTGGAGATACTGATTCTCA R-CGACCTAAAATGAAAAGCATCT	94 °C—3 min, 35 × (92 °C—45 s, 52 °C—45 s, 72 °C—1 min), 72 °C—10 min	602 bp	Globodera rostochiensis, Ro 1	[15]
N146	H1	SCAR	F-AAGCTCTTGCCTAGTGCTC R-AGGCGGAACATGCCATG	94 °C—10 min, 35 × (94 °C—30 s, 55 °C—30 s, 72 °C—1 min), 72 °C—5 min	506 bp	Globodera rostochiensis	[36]
N195	H1	SCAR	F-TGGAAATGGCACCCACTA R-CATCATGGTTTCACTTGTCAC	94 °C—10 min, 35 × (94 °C—30 s, 55 °C—30 s, 72 °C—1 min), 72 °C—5 min	337 bp	Globodera rostochiensis	[36]
U14	GroV1	SCAR	F-GGGCTTGTATAAGACCTCCGAGAGG R-CCCTTCCTTGGGTAGTTTGAGCG	92 °C, 7 min; 25 × (92 °C, 1 min; 57 °C, 1 min; 72 °C, 2 min); 72 °C, 5 min	366 bp	Globodera rostochiensis	[46]
X02	GroV1	PCR-baced, AS	F-CCACCAAACCCATAAAGCTGC R-TGTGAATTGGTATGAATCTGCAACC	92 °C, 7 min; 25 × (92 °C, 1 min; 50 °C, 1 min; 72 °C, 2 min); 72 °C, 5 min	854 bp	Globodera rostochiensis	[46]
C237	GpaIVSadg	CAPS/TaqI	F-GCAGTCCTAATTGCACGTAACA R-CTTACTTGGGCAACCCAGAAT	94 °C—10 min, 35 × (at 94 °C—30 s, 60 °C—30 s, 72 °C—1 min), 72 °C—5 min	423 bp	Globodera pallida, Pa2/3	[47]
GP34	Gpa2	CAPS/TaqI	F-CGTTGCTAGGTAAGCATGAAGAAG R-GTTATCGTTGATTTCTCGTTCCG	94 °C—3 min, 35 × (94 °C—15 s, 62 °C—15 s, 72 °C—1 min), 72 °C, 5 min	495 bp	Globodera pallida, Pa2	[35]
Nl25	Sen1	Pcr-baced, AS	F-TATTGTTAATCGTTACTCCCTC; R-AGAGTCGTTTTACCGACTCC	93 °C—3 min, 35 × (93 °C—2 min, 93 °C—45s, 72 °C—1.5 min), 72 °C—10 min.	1400 bp 1200 bp	Synchytrium endobioticum	[48]

Abbreviations: SCAR—sequence-characterized amplified region (marker), CAPS—cleaved amplified polymorphic sequence (marker), AS—allele-specific. Superscript means the strain of virus.

). These markers were tightly linked to R genes conferring natural resistance to pathogens and pests. Resistance to PVY was evaluated using the following resistance genes: Ryadg (markers ADG1, ADG2, RYSC3), Rysto (SCARysto4), Ry-fsto (GP122₅₆₄, GP122₇₁₈), and Rychc (RY186). CAPS markers SPUD237 and CP60, associated with Nb and Rx, respectively, and the PVX marker linked to the latter gene were used to determine an ER response to PVX. To detect Rladg, which confers resistance to PLRV, the RGA-derived SCAR marker RGASC₈₅₀ was applied. Two CAPS markers, SC811 and CP16, were used to confirm genetic resistance to PVS. Resistance to potato late blight was determined using the following markers: GP76, BA47f2 (R1), R1₁₄₀₀ (R1), GP179 (R1), 45/XI (Rpi-Smira1), CT214 (Rpi-ber1), and GP94 (Rpi-phu1). Nl25 was the only marker used to evaluate resistance to potato wart. The presence of G. rostochiensis resistance genes was assessed using TG689, 239E4left, N146, N195 (H1), Gro1-4 (Gro1-4), U14, and X02 (GroV1) markers. C237 and GP34 were selected to identify GpaIV^Sadg and Gpa2, respectively, which are G. rostochiensis resistance genes.

PCR was performed in a 15 μL reaction solution containing 50 ng of genomic DNA, 1X Standard Taq reaction buffer (New England Biolabs, Ipswich, MA, USA), 10 mM of dNTP, 10 mM of forward- and reverse-specific primers, and 1 unit of Taq DNA polymerase (New England Biolabs, Ipswich, MA, USA). The obtained PCR products were analyzed using 1.5 or 2.0% agarose gel electrophoresis using a 1X TAE buffer comprising 40 mM Tris, 20 mM acetic acid, and 1 mM EDTA. Further, the amplicon sizing was performed (Table 1).

The restriction analysis of PCR products for CAPS markers was conducted in a 20 μL reaction mixture, comprising 150–200 ng (approximately 5–10 μL) of PCR product and not exceeding one-third of the total reaction volume. Additionally, the mixture contained the suitable 1X restriction buffer (Thermo Scientific, Waltham, MA, USA) and 10 U of the endonuclease (Thermo Scientific, Waltham, MA, USA) (Table 1). The reaction conditions were in accordance with the manufacturer’s instructions for enzymes. The resulting restriction products were analyzed via 2.0% agarose gel electrophoresis using 1X TAE buffer comprising 40 mM Tris, 20 mM acetic acid, and 1 mM EDTA.

All results for PCR and restriction analysis are available in Supplementary Materials (Figure S1).

3. Results

In total, 352 potato specimens were tested for the presence of resistance loci. The top specimens with the same number of resistance loci are presented in Figure 1. The top cultivars contained more than 13 loci for resistance to pathogens or PCN. The analysis of potato varieties, hybrids, and breeding lines of local and foreign selection showed that the greatest number of resistance loci were observed in cultivars ‘Rucheek’ and ‘Spiridon’ from Russia. Loci for resistance to all pathogens and pests were identified in Russian, Dutch, German, Kazakhstani, and Ukrainian specimens (Figure 2, Table S3). The following varieties also had top performance: ‘Jigulevskii’, ‘Kolobok’, and ‘Resurs’ (Russia); ‘Fedor’ and ‘Janaisan’ (Kazakhstan); ‘Fioretta’ (Germany); ‘Escort’ and ‘Kondor’ (Netherlands); ‘Montana’ (USA); and ‘Jivica’ and ‘Dina’ (Belarus). Within the Kazakhstani collection, cultivars ‘Berkut’, ‘Janaisan’, ‘Maksim’, and ‘Fedor’ and hybrids ‘42-16-03’ and ‘12-15-03’ tested positive for the greatest number of R genes.

In the present study, markers SPUD237, CP60, 45/X1, and CT214 showed polymorphic amplicons that were not described in previous studies. Additionally, amplification difficulties were also observed for the markers Nl25, C237, GP179, and GP122₇₁₈.

3.1. Virus Resistance Screening

The results of amplification and restriction for markers linked to virus resistance are depicted in Figure 3. The markers ADG1, ADG2, RYSC3, GP122₇₁₈, GP122₅₆₄, RY186, and SCARysto4 were used to identify resistance loci for PVY [1,4,29,30,31,32]. The PCR products were 356, 354, and 321 bp for markers ADG1, ADG2, and RYSC3, respectively, [29,30], and they were associated with the Ryadg gene. These markers were all amplified in ‘Edem’, ‘Kogaly’, ‘Birlik’, ‘Jivica’, ‘Pamyati Ligai’, ‘Il’in’, ‘Yagodnyi-19’, ‘Ushkonyr’, and ‘Janaisan’ cultivars (Figure 3). The SCARysto4 marker, linked to the Rysto gene [33], was amplified in 24 specimens, namely ‘320701’, ‘Kolobok’, ‘Golubizna’, ‘Osen’, ‘K-24089’, ‘Prilkulskii rannii’, ‘42-16-03’, ‘Monte Carlo’, ‘Jigulevskii’, ‘Il’inskii’, ‘103-16-04’, ‘Volgar’, ‘14-01-18’, ‘Doncovskii’, ‘VIR 4’, ‘7-15-02’, ‘z872-3’, ‘Karasaiskii’, ‘Bolashak’, ‘Nartau’, ‘Astana’, ‘Tobol’, ‘NurAlem’, and ‘Buran’. Both CAPS markers, namely GP122₅₆₄ and GP122₇₁₈, which are linked to the Ry-fsto gene, are associated with ER to PVY. The resistant form of the former marker was characterized by the presence of 564- and 754-bp restriction products, resulting from digestion of amplicons with the EcoRV endonuclease, and was identified in 44 specimens, whereas the susceptible profile was assumed to have only a 564 bp product. The latter marker, which identifies a 756-bp-resistant product, was not observed or demonstrated a low level of restriction product in all potato samples. Marker RY186 amplified a 587-bp-resistant product and was identified in 56 specimens [31]. Amplification for marker GP122₇₁₈ was not successful in 63 specimens.

To identify the dominant resistance gene Rx1, responsible for PVX resistance, two markers, CP60 and PVX, were selected [34,35]. CP60 characterizes the resistance genotype by a 350-bp restriction product after digestion with DdeI. Products displaying profiles distinct from those associated with resistance or susceptibility were classified as polymorphisms. Polymorphic amplicons were identified in 52 samples. Resistance alleles for CP60 were detected in 44 specimens, while the PVX marker identified a 1230-bp resistance product in 26 samples. Both markers were detected in Russian and Kazakhstani cultivars, namely ‘Osen’, ‘Jigulevskii’, ‘Il’inskii’, ‘14-07-04’, ‘Resurs’, ‘Maksim’, and ‘Berkut’. The SPUD237 marker was employed to characterize the Nb gene, which is recognized for eliciting HR to PVX. Three products identified after AluI’s amplicon digestion were considered for virus resistance and identified in 202 samples. A lack of restriction activity represented sensitivity to the virus. Furthermore, in 18 samples, two digested products were observed. These samples were classified as polymorphic due to observed variations in their genetic profiles.

The presence of the dominant allele of Ns, conferring resistance to PVS, was determined using two CAPS markers. The SC811 marker identified a 260-bp resistance allele through PCR product restriction with MboI, while the CP16 marker identified a 460-bp resistance allele through HindIII digestion. The resistance allele of the Ns gene was detected in 194 and 222 accessions using markers SC811 and CP16, respectively.

Screening with the RGASC₈₅₀ marker for identification of the Rladg gene responsible for PLRV resistance revealed 15 accessions carrying the 850-bp resistance allele. The specimens ‘Kabardinskii pozdnii’, ‘Alaya zarya’, ‘XS-6’, ‘Gretta’, ‘Golubizna’, ‘Concorde’, ‘Rucheek’, ‘Rannyaya Roza’, ‘K-20422’, ‘Osennii’, ‘K24786’, ‘Grandia’, ‘Bayandy’, and ‘Dina’ were confirmed as positive for the RGASC₈₅₀ marker.

A prevailing number of tested samples possessed alleles for resistance to PVX and PVY. All specimens from the Finland and Monaco selections were negative for markers associated with resistance to PVS, while accessions from other origins were positive with at least one marker linked to the pathogen resistance. Loci for resistance to PLRV were detected in Belarusian, Brazilian, Chinese, Kazakhstani, Kazakhstan–Russian, Dutch, Russian, American, and Ukrainian accessions (Figure 2).

3.2. Late Blight and Potato Wart Screening

Three PCR-based markers—BA47f2, R1₁₄₀₀, and GP179—were used to identify the P. infestans resistance gene R1. Cultivars ‘Bravo’, ‘Lorh’, ‘Rucheek’, ‘Il’inskii’, ‘Spiridon’, ‘14-07-04’, ‘P 132’, and ‘Zile’ were positive for all three markers. The BA47f2 marker revealed the presence of 650-bp resistance alleles in 35 varieties (Figure 4). A total of 96 specimens tested positive for the 1400-bp resistance allele assessed using the R1₁₄₀₀ marker, whereas 76 accessions tested positive for the GP179 marker (570 bp). However, amplification issues led to the inability to analyze 62 accessions for the GP179 marker. Rpi-ber1, mapped on chromosome 10, was identified as another late blight resistance locus. The digestion of a 700-bp long PCR product with HinfI, obtained using marker CT214, resulted in three fragments that were considered resistant genetic profiles and were observed in 80 potato accessions. In addition to positive and negative products, polymorphic amplicons were identified in 75 specimens. Marker GP94 is linked to gene Rpi-phu1 and amplifies a 350 bp resistance allele. The resistant form of the marker was identified in 308 samples. Marker 45/XI (900–1500 bp) was associated with the Rpi-smira1 resistance gene and was positive for 85 potato specimens. In six samples for marker 45/XI, polymorphic amplicons were also identified. The Russian variety ‘Spiridon’ was the only variety positive for all markers associated with P. infestans resistance.

Potato wart resistance was evaluated using the SCAR marker Nl25, characterizing the gene Sen1. Previously, only its resistance to S. endobioticum pathotype 1 was confirmed [45]. PCR products of 1400 and 1200 bp were detected in 57 specimens. This marker was the most problematic due to amplification issues, as no PCR products were obtained for 113 specimens. Moreover, the fragment of 1400 bp was problematic to detect because of low intensity and proximity to 1200 bp band.

Most of the resistance loci to late blight, rather than to other pathogens, were identified in Latvian selections, whereas those identified in South Korean, Finnish, and French potatoes were limited. The accessions from other origins had a moderate number of resistance loci against P. infestans (Figure 5). The best prospective specimens from the Kazakhstani selection were three hybrids, namely ‘42-16-03’, ‘14-07-04’, and ‘37-16-02’, where each had five resistant alleles.

3.3. PCN Resistance Screening

Resistance to G. pallida was evaluated for two genes, GpaIV^Sadg and Gpa2, using the CAPS markers C237 and GP34, respectively. A PCR product obtained with marker C237 was digested with TaqI, resulting in the 423 bp product along with three additional fragments. These results indicate the presence of resistance alleles and were observed in 28 accessions (Figure 6).

This marker was unsuccessful in obtaining amplicons for 74 specimens. The presence of the Gpa2 resistance allele, which confers resistance to pathotype Pa2, was detected in 26 specimens. After digestion with TaqI, a restriction product of 495 bp associated with the immune response to G. pallida was revealed. Both markers were found in the Dutch cultivar ‘Kondor’.

The following PCR markers were used to analyze G. rostochiensis resistance and are linked to the genes H1 and Gro1-4: TG689, 239E4left, N146, N196. The two markers U14 and X02 are linked to the gene GroV1 [48].

A 141 bp PCR product associated with resistance was detected using the SCAR marker TG689 in 80 potato accessions. Marker 239E4left, indicating a 230 bp product linked to resistance after AluI digestion, was detected in 24 specimens. The resistance forms of markers N146 (506 bp) and N196 (337 bp) were confirmed in 127 and 94 varieties, respectively. All the G. rostochiensis resistance markers used in our research were positive for the following genotypes: ‘Gala’, ‘Xisen 6’, ‘Kormilitsa’, ‘Concorde’, ‘Nartau’, ‘Fiovetta’, ‘Spiridon’, ‘Montana’, ‘Berber’, ‘z872-3’, ‘17-205-6’, ‘Tyumen’skii’. SCAR marker Gro1-4, developed by Gebhardt et al. [49], amplified a 602-bp-resistant product in ‘Stobrawa’, ‘Portland grana’, ‘18-07-02’, ‘12-15-05’, ‘Kristall’, ‘VIR-12’ ‘269’, ‘Roko’, ‘720130’, ‘Jivica’, ‘Fedor’, and ‘Maksim’. The 356 bp resistance allele for the marker U14 was amplified in 150 accessions, whereas the 854 bp allele for marker X02 was amplified in 266 accessions (Figure 7).

The GroV1 gene, encoding for receptors that confer immune defense to G. rostochiensis Ro1, was revealed to be the most prevalent source for resistance in present accessions. In contrast, the G.pallida resistance gene, Cpa2, was only detected in a small number of specimens (Figure 5).

4. Discussion

4.1. Top Global Cultivars

To date, the use of molecular technologies to assist potato breeding in Kazakhstan remains limited. In the present study, the assessment of the breeding collection, including local and foreign varieties for the disease resistance markers, was conducted. The results identified the following varieties with high genetic potential for disease resistance: ‘Rucheek’, ‘Spiridon’‘Jigulevskii’, ‘Kolobok’, and ‘Resurs’ (Russia); ‘Fedor’ and ‘Janaisan’ (Kazakhstan); ‘Fioretta’ (Germany); ‘Escor’‘ and ‘Kondor’ (Netherlands); ‘Montana’ (USA); ‘Jivica’, and ‘Dina’ (Belarus); these specimens were positive for at least 14 of 30 markers tested. Of the 13 cultivars of known origin, the top cultivars ‘Rucheek’, ‘Spiridon’, ‘Jigulevskii’, ‘Resurs’, ‘Kondor’, ‘Kolobok’, and ‘Fedor’ were previously subjected to field testing for their resistance to pathogens and pests. However, the available data are still limited, which hinders the complete confirmation of association between these cultivars and resistance to precise pathogens or pests based on genomic or genetic research. Further research and data collection are necessary to fully understand the extent of the relationship between these cultivars and their resistance traits.

The cultivar ‘Rucheek’ was characterized as resistant to the Ro1 pathotype of G. rostochiensis as well as to the main viral diseases and had relatively high resilience to late blight in previous research. In our results, it was positive for at least two markers associated with immune responses to PVY and PVS and with a single marker associated with immune response to PLRV. The genotype was also positive for all markers except CT214, 45/X1, 239E4left, and Gro1-4, linked to resistance against late blight (in the case of the first two) and G. rostochiensis (in the case of the latter two), respectively. However, the cultivar tested negative for all markers associated with resistance to PVX and G. pallida.

The present study showed that only the cultivar ‘Spiridon’ was positive for six of seven markers tightly linked to P. infestans, and this cultivar was highly resistant to late blight in the field experiments using phenotypic assessment in the Southern Ural. It also revealed high resistance against P. infestans in the cultivar ‘Kolobok’, which was evaluated at nine points on a ten-point scale by means of visual assessment in the mountainous zone of North Ossetia–Alania for three years. However, in previous research, resistance to late blight in this variety was assessed at five points through phenotypic evaluation in a seed field from 2015 to 2018. In another study, this cultivar also showed moderate resistance (five points on a ten-point scale) to disease upon visual evaluation and 3% PVX infection via an enzyme-linked immunosorbent assay (ELISA).

Among the cultivars tested in our research, the cultivar ‘Jigulevskii’ was positive for four markers of resistance to P. infestans. Furthermore, according to our research, the cultivar lacked resistance alleles of the Rysto, Ryadg, and Rychc genes tested using the YES3-3A, YES3-3B, RYSC3, and Ry186 markers. This cultivar tested positive for the Ry186 marker in both our research and a previous study. The cultivar ‘Resurs’ was characterized as resistant against PVY and PVX. In this study, ‘Resurs’ tested negative for the PVY resistance markers, except for the marker GP122₅₆₄. Conversely, the cultivar tested positive for all the PVX resistance markers, including SPUD237, PVX, and CP60, as well as for the SC811 and CP16 markers associated with PVS resistance. Biryukova et al. [50] found that this variety was also positive for PVX markers. In a previous study using the ELISA method, the ‘Kondor’ variety was significantly affected by PVY, with more than 70% of the samples showing infection. Additionally, the infection rates for PVS and PVM were 65 and 13%, respectively. However, late blight incidence was recorded in 65% of the plants based on visual assessment.

Most described cultivars have already been tested for productivity traits under potato field conditions in Kazakhstan and other regions with a similar climate. Additionally, some of the foreign cultivars that were studied in this work, namely ‘Gala’, ‘Corinna’, ‘Bora Valley’, ‘Priekulskiy ranniy’, ‘Riviera’, ‘Jelly’, ‘Lorh’, ‘Escort’, ‘Latona’, ‘Udacha’, ‘Romano’, ‘Memphis’, ‘Resurs’, and ‘Picasso’, were confirmed to be on the list of promising varieties of agricultural plants in Kazakhstan.

4.2. Top Local Cultivars

To date, 147 promising potato cultivars have been included in the ‘State Register of breeding achievements recommended for use in the Republic of Kazakhstan and the list of promising varieties of agricultural plants’. Regretfully, the register does not include sufficient data on genetic testing for agronomic traits. That is why it is crucial for governmental contributions to involve molecular markers in potato breeding programs to further industrial agriculture. To the best of our knowledge, this study represents the first comprehensive analysis of confirmed DNA markers for breeding across a diverse collection of local and foreign potato specimens cultivated in Kazakhstan. In this study, within the selections from Kazakhstan, the cultivars ‘Janaisan’ and ‘Fedor’ possessed the most resistance loci, with 14 positive results obtained for both specimens. Additionally, cultivars ‘Berkut’ and ‘Maksim’ and hybrids ‘42-16-03’, ‘14-11-01’, and ‘12-15-03’ had 13 resistance alleles.

According to the Kazakh Fruit and Vegetable Research Institute, ‘Janaisan’ is a cultivar highly resistant to viral and wart disease under field testing conditions (Catalog of the Potato Gene Pool of the Republic of Kazakhstan, Kazakh Research Institute of Potato and Vegetable Growing). Both the ELISA method and visual assessment have shown that this cultivar has ER to PVY. This has also been confirmed in other studies using ELISA assessment, and positive results have been obtained for markers ADG1, ADG2, RysC3, and RY186, which are associated with PVY resistance. ‘Janaisan’ also showed positive results for PVS markers; however, field testing information is currently unavailable. Additionally, Krasavin et al. [51] identified ‘Janaisan’ and ‘Berkut’ as initial sources for breeding potato cultivars resistant to viral diseases. This conclusion is based on field testing conducted from 2007 to 2011 in the foothill and mountain potato cultivation zones of the Almaty region. Unfortunately, any testing data regarding resistance to other pathogens and PCN are not available or are absent.

In a previous study, the cultivar ‘Berkut’ was identified as exhibiting slight susceptibility to late blight, with rare occurrences of pathogen infection observed during visual inspections of leaves in the field, particularly compared to other tested cultivars. A previous study used this cultivar as a standard that elicited high resistance to viral and bacterial infections. In our study, ‘Berkut’ was found to have resistance alleles for all markers linked to PVX and PVS, as well as three markers associated with PVY. This cultivar was also positive for Nl25, which is tightly linked to the wart resistance gene. Moreover, based on the ‘State Register of breeding achievements recommended for use in the Republic of Kazakhstan’, it does not suffer from common diseases and pests in field testing.

All available data concerning the ‘Fedor’ variety are only provided by the Kazakh Fruit and Vegetable Research Institute, which defines it as a cultivar with field resistance to common diseases in Kazakhstan. According to the ‘State Register of breeding achievements recommended for use in the Republic of Kazakhstan’, cultivar ‘Maksim’ is characterized as resistant to late blight and highly resistant to viral diseases. Field testing information among top local cultivars performed in several studies is currently available only for the ‘Janaisan’ and ‘Berkut’ varieties, leaving the potential of other cultivars still unexplored. This challenges the selection of appropriate sources for breeding. Since local varieties are better suited to local needs and preferences in terms of taste, storage, and transportation and are also well adapted to local climate and soil conditions, this makes them valuable sources for MAS and gene pyramiding strategies.

4.3. DNA Marker Applicability

In our work, 30 PCR, SCAR, and CAPS markers were used to identify the genetic profile of potato accessions recommended for cultivation in Kazakhstan and similar climatic conditions. Most markers demonstrated viability and accuracy in accordance with previously researched control cultivars or hybrids. However, markers SPUD237, CP60, 45/X1, and CT214 showed polymorphic amplicons as well as positive and negative ones, which were not described in previous studies. Polymorphism was detected in 20% of specimens for CT214 and 15% for CP60. Only a few accessions were polymorphic for SPUD237 and 45/X1. Amplification difficulties were also observed for the markers Nl25, C237, GP179, and GP122₇₁₈. It was not possible to identify the resistant and susceptible genotypes for the marker NL25 in over 30% of accessions, although other markers were successfully amplified. Moreover, the fragment of 1400 bp previously reported as associated with the resistant genotype, was difficult to distinguish due to its low intensity and proximity to the fragment of 1200 bp. For the other three markers, the percentage of unsuccessful amplifications was also high, accounting for 20%. This indicates that these markers are not suitable for robust large-scale testing due to their unstable performance within the same experimental conditions.

Several markers were tested for reproducibility and accuracy in recent previous studies, making close field testing of the positive specimens essential. The first uncertain marker is CP60, associated with the gene Rx1, which confers resistance to PVX. Several studies have highlighted its ambiguous amplification and the occurrence of false positive results in susceptible varieties. In the present study, positive accessions to the marker did not exceed 14.5%, a suitable restriction profile for resistant genotypes. Markers U14 and X02 have been proposed as useful markers for the detection of the GroV1 gene that controls resilience to G. rostochiensis pathotype Ro1. Previous research used these markers for the screening of 72 genotypes but found them uninformative for this purpose, as the marker was amplified in both resistant and susceptible cultivars. The same pattern was observed in Sudha et al. [52] study. In our study, marker U14 was amplified in 150 accessions, whereas marker X02 was amplified in 268 accessions. The Nl25 marker is associated with the Sen1 gene, which confers resistance to S. endobioticum, specifically to pathotype 1. Early studies confirmed a relatively positive correlation between resistance and the presence of the Nl25 marker. However, the reliability of this marker has been questioned by several studies. Totsky et al. [53] showed the inefficiency of Nl25, revealing a lack of considerable linkage between genotypic and phenotypic results using Spearman’s correlation coefficient (Spearman R = –0.017946, p = 0.881061, p < 0.05). Similarly, Khiutti et al. [54] found a significant discrepancy between the presence of the marker and the phenotypic score. In our research, 58 specimens were positive for Nl25, including 19 genotypes from the Kazakhstan collection. Another questionable marker for PCN resistance is TG689. Galek et al. [53] observed a positive, although not absolute, correlation between the presence of the TG689 marker and resistance to the Ro1 pathotype in Polish accessions phenotypically tested via biological assessment (88% and 94% in resistance cultivars and breeding lines, respectively). Milczarek et al. [55] identified TG689 in 50 of 60 breeding lines and in only one susceptible breeding line. In our study, the highest rates—80% and 60%—were observed in Dutch (8 of 13) and Belarusian accessions (3 of 5), respectively. The only potato from the Austrian selection, ‘Roko’, was also TG689 positive.

Nevertheless, the aforementioned markers are currently used in MAS, and the uncertain results can be explained by complex potato genetic backgrounds, recombination events, and incomplete dominance of the resistance allele. However, our results have identified limitations of the studied markers that should be taken into consideration when used in the breeding practice, such as previously undescribed polymorphisms of markers SPUD237, CP60, 45/X1, and CT214, or low reliability of markers Nl25, C237, GP179, and GP122718. The validity of such markers requires further investigation in general and, particularly, in the case of potato breeding involving Kazakhstani germplasm. Further investigation using next-generation sequencing (NGS) and other modern approaches should reveal the interaction between the genome and these specific loci.

4.4. Perspectives on Potato Breeding

Cultivars with phenotypic resistance to wart and viruses hold the foremost position among the potato collection in Kazakhstan, whereas resistance to PCN and P. infestans is less described. Nevertheless, the sources carrying genes Ryadg (ADG1, ADG2), Nb (SPUD237), Ns (SC811, CP16), Rpi-phu1 (GP94), and GroV1 (X02), confirming resistance to viruses, P. infestans, and G. rostochiensis, are those most frequently found in collections.

Resistance to viral infections is of specific interest to breeders and farmers in Kazakhstan. Widespread potato viruses and their devastating impact on crop yield have been described in many studies in this country. The assessment of potato wart resistance in Kazakhstan is notably absent in research papers and is confined to studies conducted by originators, although no cases of this disease have been found in Kazakhstan. However, the disease is present in neighboring countries as well as in Europe, which is the main exporter of potato seeds to Kazakhstan [56,57,58,59,60,61,62].

Choosing the most prominent resource for further breeding requires balancing resistance potential and productive capacity. The crossbreeding of the researched top cultivars with ‘Golubizna’, ‘Aksor’, and ‘Akjar’, the most productive cultivars, could be considered an appropriate strategy for increasing potato yields and resistance to biotic factors. The recent successful breeding of new long-day cultivars resistant to late blight includes crosses between ‘Cooperation 88’ and the cultivars ‘Prospect’ and ‘Shepody’. ‘Jacqueline Lee’, ‘Missaukee’, ‘PB-06’, and ‘S-60’ are considered promising sources for productivity and late blight resistance. The varieties ‘Bistra’ and ‘Payette Russet’ [63,64] have been identified as potential new sources for ER to PVY, while ‘Longshu-3’, ‘Eugene’, ‘Atlantic’, and ‘Waiyin-2’ have demonstrated ER to PVX. In the past two years, ‘Lehigh’, ‘Innovator’, ‘Lady Anna’, ‘Melody’, and ‘Novano’ have been described as the most promising cultivars for PCN resistance. New sources for resistance to other pathogens, including early blight and wart [65,66], have also been studied.

Expanding the genetic diversity of potato crops is a key strategy for enhancing resilience. This includes both in situ conservation of local varieties and ex situ preservation in gene banks. The International Potato Center and other global repositories play a critical role in maintaining a wide range of potato germplasm that can be accessed for breeding programs worldwide. The introduction of genetic material from international sources can diversify the genetic base of local potato cultivars. However, it is equally important to utilize and preserve local varieties that have naturally adapted to specific regional conditions. These local varieties often possess unique traits that contribute to their resilience, such as resistance to local pests and diseases and tolerance to specific climatic conditions. However, in many countries, including Kazakhstan, most commercial fields are occupied by foreign potato varieties. These varieties require the application of large amounts of pesticides to protect the crop from pathogens and pests prevalent in the country. The main reasons for cultivating foreign varieties include the desire to grow well-known and widely recognized varieties and ensure their standardized and reliable seed quality, widespread availability, and support from agricultural policies. However, the widespread cultivation of foreign potato varieties comes with significant challenges. One major issue is the reduction in genetic diversity. The preference for a limited number of high-performing varieties can lead to a genetic bottleneck in which the genetic base of cultivated potatoes becomes increasingly narrow. This lack of diversity makes crops more susceptible to disease outbreaks, as pathogens and pests can evolve rapidly and overcome resistance. History has shown that reliance on a limited number of genetic lines can have devastating consequences. The Irish Potato Famine in the 1840s is a prime example of the dangers of low genetic diversity, in which a single pathogen, P. infestans, wiped out potato crops that were genetically uniform.

Most commercial potato fields in Kazakhstan have been cultivating the foreign variety ‘Gala’ over the past 5 years, despite having at least 10 promising local varieties among the 166 varieties studied in this work. The local varieties ‘Aksor’, ‘Akjar’, ‘Astana’, and ‘Etyud’ are considered promising sources of productivity for commercial fields. These varieties have demonstrated the potential to yield over 500 quintals per hectare, similar to the most productive varieties in the world, including ‘Russet Burbank’, ‘Yukon Gold’, and ‘Maris Piper’. The introduction of new resistance loci from cultivars ‘Rucheek’, ‘Spiridon’, ‘Jigulevskii’, ‘Resurs’, ‘Kondor’, ‘Kolobok’, and ‘Fedor’ into ‘Aksor’, ‘Akjar’, ‘Astana’, and ‘Etyud’ will enhance the breeding of highly productive and resistant varieties. The main challenge in selecting the right local source for breeding is the lack of information on agronomic traits and insufficient research under field conditions. This work represents the first comprehensive analysis of the genetic potential of a local potato collection and must be followed by field testing experiments. Nevertheless, the collection contains valuable sources for further breeding of potatoes adapted to Central Asia climate conditions. Additionally researched cultivars could also serve as controls in genetic testing and breeding programs as well as in fundamental studies for an in-depth understanding of the mechanisms of pathogen virulence.

5. Conclusions

To the best of our knowledge, this is the first study to evaluate the Kazakhstani potato collection for the presence of loci for resistance to harmful pathogens and pests. The present study revealed that the specimens carrying the Ryadg, Nb, Ns, Rpi-phu1, and GroV1 genes, which possess confirmed resistance to PVY, PVA, PVX, PVS, P. infestans, and G. rostochiensis, were those most frequently found in this collection. The loci for resistance to S. endobioticum and G. pallida were less introgressed into the Kazakhstani cultivars and almost absent in the germplasm collection. The obtained results could have great potential for MAS and the gene pyramiding strategy to develop new ER potato varieties. Further investigations encompassing field testing and whole-genome sequencing will significantly enhance the breeding program by providing comprehensive insights into genetic resistance and enabling the development of more resilient cultivars.