Optimal Irrigation and Fertilization Enhanced Tomato Yield and Water and Nitrogen Productivities by Increasing Rhizosphere Microbial Nitrogen Fixation

Abstract

Irrigation and nitrogen application rates have significant effects on greenhouse tomato yields, as well as water and nitrogen use efficiencies, but little is known regarding how these rates affect plant–microbiome interactions and how the associated changes might impact tomato yields. In this greenhouse study conducted over two years, the effects of three irrigation levels (moderate deficit with 65–75% water holding capacity threshold, slight deficit with 75–85%, and sufficient irrigation with 85–95%) and four nitrogen application levels (60, 120, 240, and 360 kg ha⁻¹) on tomato growth, yield, water and nitrogen productivities, and rhizosphere microbial diversities and functions were investigated. The results demonstrated that the highest tomato leaf area, dry biomass, yield, and water and nitrogen productivities were obtained under the treatment with sufficient irrigation. With increasing nitrogen application, the tomato leaf area, dry biomass, yield, and water and nitrogen productivities showed a trend of first increasing and then decreasing. Overall, the treatment (N2W3) with sufficient irrigation and 240 kg ha⁻¹ N was associated with the highest tomato growth, yield, and water and nitrogen productivities. Moreover, optimal irrigation and nitrogen application obviously altered the structures of rhizosphere bacterial and fungal communities, particularly recruiting microbiota conferring benefits to tomato growth and nitrogen fixation—namely, Lysobacter and Bradyrhizobium. Ultimately, optimal irrigation and nitrogen application significantly increased the relative abundances of functions related to carbon, sulfur, and nitrogen metabolism, especially nitrogen fixation. In summary, optimal irrigation and fertilization enhanced tomato yield, as well as water and nitrogen productivities by increasing the nitrogen fixation functions of the rhizosphere microbiome. Our results provide significant implications for tomato cultivation in greenhouses, in terms of optimized irrigation and fertilization.

1. Introduction

Greenhouse tomatoes are a high-value crop that play a significant role in global agriculture, due to their ability to provide a stable year-round supply [1,2,3]. Tomatoes are planted both in greenhouses and open fields. Greenhouse tomatoes offer the advantage of year-round production, with controlled environments leading to higher yields, reduced pest issues, and consistent quality. In contrast, field-grown tomatoes are subject to seasonal and climate limitations, which can affect both their yield and quality. Amirahmadi et al. (2023) have reported that, compared to greenhouse tomato cultivation, open-field tomato cultivation had negative environmental impacts on human health, ecosystem quality, and resources [3]. Thus, greenhouse cultivation not only effectively mitigates adverse climate conditions but also enhances tomato yield and quality [2]. In this context, water and fertilizer management are critical factors influencing the growth and yield of tomatoes [4]. Proper water and fertilizer management not only increases crop yield but also optimizes resource use efficiency and reduces environmental pollution. Therefore, studying water and fertilizer management strategies for greenhouse tomatoes holds significant theoretical and practical importance.

Numerous studies have explored the impact of water and nitrogen managements on the growth, yield, and water and nitrogen use efficiency of greenhouse tomatoes [5,6,7]. However, there remains controversy regarding the optimal water and nitrogen management approaches. Some studies have found that sufficient irrigation can significantly increase tomato yield and water use efficiency [2,6,8], for several reasons. Adequate water supply ensures that the plants do not experience water stress during critical growth periods, promoting photosynthesis and nutrient transport, which leads to higher yields. It also reduces water stress, allowing plants to allocate more energy to growth and fruit development [9]. Furthermore, sufficient irrigation supports root vitality, thus improving water and nutrient absorption. Proper irrigation practices prevent the soil from becoming too dry and hard, thus maintaining good soil structure and enhancing root expansion and water use efficiency [9]. In contrast, some studies have insisted that deficit irrigation can improve tomato yields as it optimizes the use of water resources, enhancing the plant’s physiological responses and increasing water use efficiency [10,11,12,13]. This practice involves supplying water below the crop’s full water requirements, which can lead to beneficial stress that promotes deeper root growth, more efficient nutrient uptake, and improved fruit quality. Additionally, deficit irrigation can reduce the incidence of diseases associated with over-irrigation and waterlogged soils [14]. According to previous research, implementing a deficit irrigation strategy can significantly improve tomato yield and quality by balancing the trade-off between water savings and crop productivity.

The impact of nitrogen fertilization on tomato yield has also been extensively studied, with findings consistently indicating that the yield initially increases with nitrogen application but subsequently decreases beyond an optimal level [15,16,17]. This response can be attributed to several physiological and agronomic factors. Firstly, nitrogen is a crucial macronutrient that promotes vegetative growth and is essential for the synthesis of amino acids, proteins, and chlorophyll, which are vital for plant growth and development [18]. Adequate nitrogen supply enhances leaf area, photosynthetic rate, and overall biomass production, leading to an increased yield [19]. However, excessive nitrogen application can lead to detrimental effects on plant health and yield. High nitrogen levels can cause excessive vegetative growth at the expense of fruit development, resulting in a lower fruit set and reduced yield [20]. Additionally, over-fertilization with nitrogen can lead to nutrient imbalances, particularly affecting the uptake of other essential nutrients, such as potassium and phosphorus, which are crucial for fruit development and quality [21]. In conclusion, while nitrogen fertilization is essential for enhancing tomato yield, it is crucial to apply it within an optimal range to avoid the negative consequences of over-fertilization. However, different studies have reported varying optimal ranges for nitrogen application [22,23]. Above all, understanding the balance between sufficient and excessive nitrogen applications is key to achieving high yields and sustainable agricultural practices. However, the impacts of microbial mechanisms on tomato growth and yield, in a manner mediated by nitrogen fertilization, remain unclear.

Soil micro-organisms are often referred to as the plant’s “second genome,” due to their crucial role in supporting plant health and growth [24,25,26]. Recognizing this vital relationship, some scholars have embarked on studies to investigate the effects of irrigation and fertilization on soil microbial communities. Irrigation practices and nitrogen fertilization play crucial roles in shaping the root microbiomes of tomato plants, with significant implications for plant health and productivity. Recent studies have highlighted the complex dynamics between water availability, nutrient supply, and microbial communities in the rhizosphere. Adequate irrigation is essential for maintaining soil moisture levels, which directly influence microbial activity and diversity [27]. Studies have shown that optimal irrigation promotes a rich and diverse microbial community, consequently enhancing nutrient cycling and plant growth [28]. Conversely, water stress can lead to a decline in microbial diversity, adversely affecting plant health and yield [29]. While nitrogen is a critical nutrient for tomato growth, its application must be carefully managed to avoid negative environmental impacts. Excessive nitrogen fertilization can disrupt the balance of microbial communities, leading to an increase in pathogenic species and a decrease in beneficial microbes [30]. On the other hand, moderate nitrogen levels have been found to support a more balanced and beneficial microbial community, promoting plant growth and resilience. The interaction between irrigation and nitrogen fertilization is complex and can have synergistic or antagonistic effects on the root microbiome. Recent research has indicated that balanced irrigation and nitrogen management can enhance microbial diversity and function, leading to improved plant health and productivity [28,31]. In summary, sustainable irrigation and nitrogen management practices are crucial for maintaining a healthy and diverse root microbiome in tomato plants. However, whether and how optimal irrigation and nitrogen application alter the rhizosphere microbial community structure and functions related to tomato growth remain largely unclear. Therefore, this study aims to provide valuable insights into microbial mechanisms affecting tomato growth and yield under the impacts of irrigation and nitrogen application.

Based on the abovementioned knowledge gaps, we hypothesized that optimal irrigation and nitrogen application will enhance tomato–microbiome interactions, improving both tomato growth and water and nitrogen productivities. Thus, the specific aims of this study were to (1) determine the impacts of irrigation and nitrogen application on tomato growth and water and nitrogen productivities; (2) clarify the responses of tomato rhizosphere microbial communities (i.e., diversity, structure, and core microbiota) to optimal irrigation and nitrogen application; and (3) elucidate the impacts of optimal irrigation and nitrogen application on the functions of tomato rhizosphere microbiota.

2. Materials and Methods

2.1. Experimental Site

The experiments were conducted from March to December in 2020 and 2021, in solar greenhouse No. 43 at the Shenyang Agricultural University Test Base, located at 41°82′ N, 123°57′ E. This test location is influenced by a monsoon climate, resulting in concentrated precipitation and significant temperature variations. January is the coldest month with an average temperature of −11.0 °C, while July is the hottest month with an average temperature of 24.7 °C. The soil in the greenhouse is brown loam with a bulk density of 1.26 g cm⁻³ and a field capacity of 0.31 cm³ cm⁻³. The available nitrogen (sum of N-NO₃⁻ and N-NH₄⁺) contents of the soil were 54.6 mg kg⁻¹, 164.7 mg kg⁻¹, 27.5 mg kg⁻¹, and 66.4 mg kg⁻¹ in Spring 2020, Autumn 2020, Spring 2021, and Autumn 2021, respectively. The length and width of the greenhouse were 62.5 m and 7 m, respectively, with a total area of 437.5 m².

2.2. Experiment Design

To explore the optimal irrigation and nitrogen fertilizer application with respect to greenhouse tomato growth, yield, and water and nitrogen productivities, a two-year (2020–2021), four-season greenhouse experiment was conducted. This study also aimed to investigate the microbial mechanisms that promote tomato growth under these optimal conditions. The experiment involved two factors; namely, different irrigation and nitrogen fertilization levels. The irrigation factor included three levels: moderate deficit irrigation with a threshold of 65–75% field water holding capacity (W1), slight deficit irrigation with a threshold of 75–85% field water holding capacity (W2), and sufficient irrigation with a threshold of 85–95% field water holding capacity (W3). The irrigation processes are illustrated in Figure 1. The nitrogen fertilizer application rate had four levels: 60 (N0), 120 (N1), 240 (N2), and 360 (N3) kg ha⁻¹ N. The nitrogen fertilizer rates were designed based on the local standard N application rate of 120 kg ha⁻¹. Therefore, there were 12 treatments in this study, denoted as N0W1, N0W2, N0W3, N1W1, N1W2, N1W3, N2W1, N2W2, N2W3, N3W1, N3W2, and N3W3 (Supplementary Materials). Each treatment had nine replicates—three for destroyed biomass measurement and the others for tomato growth, yield, and microbial community measurements. The experiment was conducted in pots with a diameter and height of 40 and 60 cm. Thus, a total of 108 pots were used per growing season in this study. Each pot contained one tomato plant. Drip irrigation with black plastic film mulch was applied. For more details on the experiment, refer to our previous study [32].

The tomato variety “Fenguang No. 1” was applied in this study. In the 2020 Spring season, tomatoes were grown from 15 March to 23 July. In the 2020 Autumn season, tomatoes were grown from 11 August to 20 December. In the 2021 Spring season, tomatoes were grown from 15 March to 25 July. In the 2021 Autumn season, tomatoes were grown from 11 August to 19 December. Applications of 180 kg ha⁻¹ phosphorus (P₂O₅) and 375 kg ha⁻¹ potassium (K₂O) were conducted once, at the beginning of the experiment.

2.3. Sampling and Measurements

2.3.1. Tomato Growth Indices and Yield

To test the impacts of irrigation and fertilization on tomato growth, four growth indices were observed in this study, including tomato plant height, stem diameter, leaf area, and dry biomass. The plant height and stem diameter were measured at the tomato seeding, vegetative, flowering, and fruiting stages, while dry biomass was measured in vegetative, flowering, and fruiting stages in each growing season. The leaf area was measured at the flowering stage in each growing season. Moreover, tomato plant height and stem diameter were measured using a ruler and a Vernier caliper, respectively. The leaf length and width were also measured using a ruler. One plant was cut down and put into an oven to de-enzyme (105 °C) for 30 min, before being dried to a constant weight at 85 °C for measurement of dry biomass. The yields of three plants were harvested for each treatment [33].

2.3.2. Water Consumption and Water and Nitrogen Productivities

The soil water content was monitored using a CR1000X instrument (Campbell Scientific, Inc., Logan, UT, USA). Tomato water consumption and water productivity were calculated using Equations (1) and (2), respectively. Moreover, partial nitrogen productivity was calculated using Equation (3) [33].

$$\mathit{ET}=\mathit{I}+\Delta \mathit{S}$$

(1)

$$\mathit{WP}={\displaystyle \frac{\mathit{Y}}{10\mathit{ET}}}$$

(2)

$$\mathit{PNP}={\displaystyle \frac{Y}{N}}$$

(3)

where ET is the total water consumption of tomato, mm; ΔS is the change in soil water storage for each plot, mm; WP is the water productivity, kg m⁻³; Y is the tomato yield, kg ha⁻¹; PNP is the partial nitrogen productivity, kg kg⁻¹; and N is the applied nitrogen, kg ha⁻¹.

2.3.3. Measurement of Microbial Community

Soil samples were taken from the N1W3 (CK) and N2W3 treatments, for a total of six replicates per treatment, at seeding, vegetative, flowering, and fruiting stages in the third growing season (Spring season of 2021) and frozen at −80 °C until DNA extraction. In each plot, three bulk soils from the surface (0–5 cm) were randomly collected and mixed evenly into one composite soil sample (5 g). Therefore, a total of 48 soil samples (two treatments × six replicates × four stages) were collected and analyzed. It is worth noting that the 48 samples were only taken from the CK and N2W3 treatments. The hypervariable region V3−V4 of the bacterial 16S rRNA gene was amplified using the primer pairs 338F (5′−ACTCCTACGGGAGGCAGCAG−3′) and 806R (5′−GGACTACHVGGGTWTCTAAT−3′). Fungal genes were amplified with the primers ITS1F (5′-CTTGGTCATTTAGAGGAAGTAA-3′) and ITS2R (5′-GCTGCGTTCTTCATCGATGC-3′) [34]. DNA extraction and amplicon sequencing were completed by BIOZERON (Shanghai, China). The raw gene sequencing reads were demultiplexed and quality-filtered using Fastp version 0.20.0 [35]. Operational taxonomic units (OTUs) with a 97% similarity cut-off were clustered using Uparse version 7.1 [36], and chimeric sequences were identified and removed. The taxonomy of each OTU representative sequence was analyzed using the RDP Classifier version 2.2 against the 16S rRNA database (e.g., Silva v138) and Unite 8.0 database [37].

2.4. Statistical Analysis

The differences in tomato growth traits, yield, water and nitrogen productivities, and alpha diversities of bacterial and fungal communities under different irrigation and nitrogen fertilization treatments were analyzed through two-way ANOVA in R (version 4.2). The normality and equal variance tests of the original data were conducted prior to the statistical analysis. The impacts of irrigation and fertilization on structures of bacterial and fungal communities were analyzed through principal coordinates analysis (PCoA). The permutational multivariate analysis (Adonis), analysis of similarities (ANOSIMs), and multiple response permutation procedure (MRPP) methods were applied to evaluate the impacts of optimal irrigation and nitrogen application on the structures of bacterial and fungal communities. The Wilcoxon rank-sum test was applied to test the difference in each genus in the bacterial community. The potential functions (e.g., carbon, nitrogen, sulfur) were predicted based on 16S rRNA using the FAPROTAX databases [38].

3. Results

3.1. Tomato Growth and Biomass

The growth indices of tomatoes are illustrated in Figure 2. The plant heights were scarcely impacted by the irrigation and fertilization treatments. Similarly, the stem diameters of plants under all treatments were similar, showing that irrigation and fertilization had little influence on the stem diameter of tomatoes. However, the leaf area and dry biomass were significantly impacted by irrigation and fertilization. Specifically, with increasing irrigation amount, the leaf area and dry biomass increased, obviously. Compared with moderate and slight deficit irrigation (W1 and W2 treatments), sufficient irrigation (W3 treatment) significantly increased the average leaf area by 65.2% and 15.8%, respectively, and markedly increased dry biomass by 37.0% and 17.4%, respectively (Figure 2C,D). As for the impacts of fertilization on tomato growth, leaf area and dry biomass both showed a trend of first increasing and then decreasing, with the highest values under the treatment with a nitrogen application rate of 240 kg ha⁻¹ (N2 treatment), showing that the application rate of 240 kg ha⁻¹ nitrogen was optimal for greenhouse tomato cultivation in this study. Compared with low (N0), normal (N1), and high (N3) application rates of nitrogen, the optimal application rate of nitrogen (N2) increased the leaf area by 47.5%, 40.2%, and 39.0%, respectively, and improved the dry biomass by 56.2%, 28.8, and 13.9%, respectively (Figure 2C,D).

Among all treatments, the N2W3 treatment, comprising the optimal application of nitrogen and sufficient irrigation, yielded the highest leaf area and dry biomass (Figure 2C,D). Compared with the N1W3 treatment (CK; normal application of nitrogen and sufficient irrigation), the N2W3 treatment increased the leaf area and dry biomass by 35.3% and 22.0%, respectively.

3.2. Tomato Yield, Water and Nitrogen Productivities

The yield and water and nitrogen productivities of tomato plants were significantly impacted by irrigation and fertilization (Figure 3). Generally, tomato yield increased with increasing irrigation amount. Compared with treatments W1 and W2, the W3 treatment obviously increased the average tomato yield by 41.5% and 19.5%, respectively (Figure 3A). Moreover, the tomato yield increased first and then decreased with increasing nitrogen application rate, and the N2 treatment (240 kg ha⁻¹ N) presented the highest tomato yield. Compared with the N0, N1, and N3 treatments, the N2 treatment significantly increased tomato yield by 248.4%, 125.8%, and 43.6%, respectively (Figure 3A). The highest tomato yield was obtained under the N2W3 treatment, which significantly increased tomato yield by 105.4% in comparison with the CK treatment (N1W3).

As shown in Figure 3B, the treatments with 240 kg ha⁻¹ nitrogen application (N2) had higher water consumption than other treatments. Moreover, sufficient irrigation (W3) led to the highest water productivity. Compared with the moderate (W1) and slight (W2) deficit irrigation treatments, the sufficient irrigation treatment increased the water productivity of the tomato by 36.6% and 20.9%, respectively (Figure 3C). The water productivity of the tomato also increased first and then decreased with increasing nitrogen application rate, and the N2 treatment yielded the highest water productivity. Compared with the N0, N1, and N3 treatments, the N2 treatment significantly increased the tomato water productivity by 189.1%, 67.2%, and 39.1%, respectively (Figure 3B). Moreover, the highest water productivity overall was obtained in the N2W3 treatment.

Figure 3 shows the impacts of irrigation and fertilization on partial nitrogen productivity. As shown in Figure 3, sufficient irrigation (W3) had the highest partial nitrogen productivity. Compared with the moderate (W1) and slight (W2) deficit irrigation treatments, the sufficient irrigation treatment increased partial nitrogen productivity by 51.0% and 22.8%, respectively (Figure 3). As for the impacts of fertilization on partial nitrogen productivity, the N0 and N2 treatments led to higher partial nitrogen productivity than N1 and N3 treatments. Additionally, the N2W3 treatment yielded the highest partial nitrogen productively, which obviously increased the partial nitrogen productivity by 36.8% in comparison with the CK treatment.

Above all, the N2W3 treatment led to the highest leaf area, dry biomass, yield, and water and nitrogen productivities, showing that sufficient irrigation and application of 240 kg ha⁻¹ nitrogen was the optimal treatment for tomato cultivation in this study.

3.3. Diversities of Microbial Communities

To explore the microbial mechanisms affecting tomato growth under positive impacts of optimal irrigation and nitrogen application, the tomato rhizosphere microbial communities (i.e., bacterial and fungal communities) were evaluated under the CK (i.e., N1W3) and N2W3 treatments. There were no significant differences in bacterial Chao and Shannon indices between the CK and N2W3 treatments, showing that optimal irrigation and nitrogen application scarcely impacted the alpha diversity of the bacterial community (Figure 4A,B). In contrast, the alpha diversity of the fungal community was significantly impacted by optimal irrigation and nitrogen application. Compared with the CK treatment, the N2W3 treatment resulted in markedly increased Chao index values, by 34.7%, 68.5%, 46.8%, and 43.2% in the tomato seeding, vegetative, flowering, and fruiting stages, respectively (Figure 4C). Similarly, the N2W3 treatment also significantly increased the Shannon index by 17.5%, 27.2%, 35.6%, and 29.3%, respectively (Figure 4). These results demonstrate that optimal irrigation and nitrogen application significantly increased the alpha diversity of the fungal community while having little impact on that of the bacterial community.

As shown in Figure 5, irrigation and fertilization significantly altered the structures of both bacterial and fungal communities. Figure 5A shows that bacterial communities under the CK treatment were obviously different from those under the N2W3 treatment. Moreover, the results of Adonis, ANOSIM, and MRPP analyses all revealed marked differences in bacterial communities at the tomato seeding, vegetative, flowering, and fruiting stages. Similarly, Figure 5B shows that there were also obvious differences in the structures of fungal communities between the CK and N2W3 treatments in all tomato growing stages (i.e., seeding, vegetative, flowering, and fruiting stages). Overall, during all stages of tomato growth, the optimal irrigation and nitrogen application significantly altered both the bacterial and fungal communities.

3.4. Core Microbiota and Functions

To further explore which core microbiota were significantly impacted by optimal irrigation and nitrogen application, the Wilcoxon rank-sum test was applied to test the difference in each genus between the bacterial communities. Figure 6A–C shows that there was different core microbiota in different tomato growth stages. For example, the genus Lysobacter was obtained in both seeding and vegetative stages. Moreover, the nitrogen-fixing genus Bradyrhizobium was obtained in the vegetative, flowering, and fruiting stages. To further explore the impacts of irrigation and fertilization on the potential functions of microbial bacteria, the potential functions of the bacterial community were predicted according to the FAPROTAX database (Figure 6E–H). As shown in Figure 6E–H, although different growth stages presented different core functions, all the enriched functions were related to organic carbon, nitrogen, and sulfur metabolism. This result indicates that optimal irrigation and nitrogen application improved carbon, nitrogen, and sulfur turnover processes. More interestingly, the function of nitrogen fixation was observed in the vegetative, flowering, and fruiting stages, indicating that optimal irrigation and nitrogen application increased microbial nitrogen fixation.

Figure 7A shows that, compared with the CK treatment, the N2W3 treatment significantly increased the relative abundance of Bradyrhizobium species, by 118.6%, 105.3%, and 200.1% in vegetative, flowering, and fruiting stages, respectively. The relative abundances of Lysobactor species in the N2W3 treatment were 603.1% and 411.1% higher than those in the CK treatment in the seeding and vegetative stages, respectively (Figure 7B). Similarly, the N2W3 treatment significantly increased the relative abundances of nitrogen-fixing bacteria, by 123.6%, 90.2%, and 114.7% in the vegetative, flowering, and fruiting stages, respectively. Moreover, the relative abundance of nitrogen-fixing species was significantly related to the relative abundances of Lysobacter and Bradyrhizobium and the Shannon index of the fungal community. This result indicates that altered bacterial and fungal communities under the optimal irrigation and nitrogen application treatment enhanced the microbial function of nitrogen fixation in the tomato rhizosphere.

4. Discussion

4.1. Tomato Growth, Yield, and Water and Nitrogen Productivities

This study investigates the impacts of irrigation and N fertilization on tomato growth, water and nitrogen productivities, and their relationships with the rhizosphere microbial community. Our findings provide evidence that optimal irrigation and nitrogen application can obviously increase tomato growth indices, including leaf area, dry biomass, yield, water and nitrogen productivities, microbial community diversity, and functions of nitrogen fixation. Generally, these findings indicate that optimal irrigation and nitrogen application could enhance the growth of tomatoes by increasing the nitrogen fixation capacity of the rhizosphere microbiota.

In this study, the tomato leaf area and dry biomass were increased under the sufficient irrigation treatment. This is reasonable, as sufficient irrigation provides enough water for tomato plant growth. Many studies have shown that crop growth is linearly related to the irrigation amount [7,39]. However, some studies have found that deficit irrigation could obtain a higher tomato yield than sufficient irrigation [12]. The reason for this is probably that water stress encourages deeper root growth, makes the crop more resilient to drought conditions, and improves nutrient uptake [13]. On the other hand, moderate water stress can stimulate the production of abscisic acid and other growth-regulating hormones, which can enhance the plant’s ability to tolerate stress and improve its growth and productivity [40,41,42]. In this study, tomato growth under sufficient irrigation conditions with a threshold of 85–95% field water holding capacity was optimal. The inconsistent results reported above were mainly due to the impacts of deficit irrigation on tomato growth varying with soil conditions. In this study, the tomato plants were grown in pots, where there was insufficient soil water storage. Under this condition, even though deficit irrigation encouraged deeper root growth, the tomato plants could not obtain enough soil water. Crop yield is largely related to growth indices, such as leaf area and dry biomass, among others. Therefore, the tomato yield also increased with increasing irrigation amount, and the highest tomato yield was obtained under the sufficient irrigation treatment. This result is consistent with Zhang et al. (2020), who reported that the tomato yield was highest under the treatment with sufficient irrigation [8]. This is reasonable as, under sufficient irrigation, the leaf area and dry biomass were significantly higher than those under slight and moderate deficit irrigation treatments. Moreover, the sufficient irrigation treatment also obtained the highest water productivity (Figure 3). Many studies have reported inconsistent results with respect to the impacts of irrigation amount on tomato water productivity. For example, some studies have reported that deficit irrigation could help to increase tomato water productivity [12], while high water productivity has been obtained under sufficient irrigation treatments in many other previous studies. The probable reasons for these inconsistent results are mainly that the impacts of irrigation on crop water productivity vary with soil properties (e.g., soil water and nutrient contents)

In the present study, we observed that the tomato leaf area and dry biomass increased first and then decreased with increasing nitrogen application rate (Figure 3). This is consistent with the results of some previous studies, in which optimal nitrogen application could increase crop growth, while over-use of nitrogen fertilizer significantly reduced crop yield. The reason for this is that excessive nitrogen content has a toxic effect on crop growth [20]. Similarly, the tomato yield also showed a trend of increasing first and then decreasing with increasing nitrogen application. Similar results have been reported in some previous studies [43]. However, although many studies have reported a parabolic relationship between tomato yield and nitrogen application rate, the optimal application rates differed between those studies. Moreover, the optimal nitrogen application was 240 kg ha⁻¹ in this study. The differences in the optimal application rate of nitrogen for tomato plants can be explained by differences in climate and soil conditions.

4.2. Core Microbiota and Functions

The mechanisms underlying the impacts of irrigation and nitrogen fertilizer on tomato growth, yield, and water and nitrogen productivities have been explored in many studies [44,45,46]. However, most of those studies only focused on the responses of crops to irrigation and fertilizer stress. In reality, the soil microbiome, as the “second genome” of plants, also plays an important role. Therefore, to further explore the microbial mechanisms affecting tomato plant growth under the impacts of irrigation and nitrogen fertilizer, we evaluated the influences of irrigation and nitrogen fertilizer on the tomato rhizosphere bacterial and fungal communities. Given that the N2W3 treatment led to the highest tomato yield (Figure 2 and Figure 3), as well as water and nitrogen productivities, we only evaluated the differences in bacterial and fungal communities between the CK (N1W3) and N2W3 treatments; in this way, we obtained some valuable results.

In this study, we observed that the structures of bacterial and fungal communities were both obviously altered by changes in irrigation and nitrogen application during the stages of tomato growth (Figure 5). This is reasonable, as changes in irrigation and nitrogen application lead to changes in soil water and nitrogen content. On the other hand, varying levels of irrigation and nitrogen application also affected changes in the metabolism of tomato roots, causing them to recruit different micro-organisms. Muhammad et al. (2022) also found that different irrigation and nitrogen application treatments altered the microbial community structure [47]. However, we found that the optimal irrigation and nitrogen application treatment only significantly increased fungal diversity, while it scarcely impacted the bacterial community. The results suggested that optimal irrigation and nitrogen application reshaped the bacterial community and that the fungal community was more easily impacted by changing irrigation and nitrogen application conditions. Similar results have also been reported by Bai et al. (2022) [48].

A more interesting question is whether and how changes in the microbial community can improve tomato growth. To answer this question, we focused on the core microbiota and their functions (Figure 7). Interestingly, we found that the genus Lysobacter was present in both seeding and vegetative stage rhizospheres. Moreover, the nitrogen-fixing genus Bradyrhizobium was observed in the vegetative, flowering, and fruiting stages. Those two genera are beneficial microbes in the rhizosphere, especially Bradyrhizobium, as nitrogen-fixing microbes [49,50,51]. Interestingly, the function of nitrogen fixation was obtained in the vegetative, flowering, and fruiting stages. Moreover, the relative abundance of nitrogen-fixing species was significantly related to the relative abundances of Lysobacter and Bradyrhizobium and the Shannon index of the fungal community. The results suggest that the changes in the microbial community induced by the optimal irrigation and nitrogen application treatment increased nitrogen fixation. These results confirmed that optimized irrigation and nitrogen fertilization can enhance the microbiome–tomato nitrogen fixation system, consequently increasing the growth and water and nitrogen productivities of the tomato.

5. Conclusions

In summary, this study revealed the impacts of irrigation and nitrogen applications on the growth, yield, water and nitrogen productivities, and rhizosphere microbial communities of greenhouse tomato plants. The results provided several valuable insights into the impacts of irrigation and fertilization on greenhouse tomato growth and interactions between the tomato plants and rhizosphere communities. First, the sufficient irrigation treatment was associated with the highest tomato growth, yield, and water and nitrogen productivities. The tomato growth, yield, and water and nitrogen productivities increased first and then decreased with increasing nitrogen application. Generally, the treatment with an irrigation limit of 85–95% of the field holding capacity and 240 kg ha⁻¹ N was optimal for greenhouse tomato cultivation in this study. Second, the optimal irrigation and nitrogen application treatment significantly increased the alpha diversity of the fungal community, while it scarcely impacted the diversity of the bacterial community. However, it obviously altered the structures of both fungal and bacterial communities. Third, the optimal irrigation and nitrogen application treatment enriched the microbiota, which are beneficial for tomato growth and nitrogen fixation, with increased relative abundances of those with carbon, sulfur, and nitrogen metabolism-related functions, especially nitrogen fixation. Our results confirmed that optimal irrigation and nitrogen application increased the growth and water and nitrogen productivities of greenhouse tomato plants through enhancing tomato–microbiome interactions, especially with respect to nitrogen fixation, with significant implications for tomato cultivation in greenhouses regarding optimized irrigation and fertilization. The molecular mechanisms involved in the recruitment of nitrogen-fixing microbiota by tomato roots under the optimal irrigation and nitrogen application treatment require further research.