Next Article in Journal
Alternative Phosphorus Fertilisation with Bio-Based Pellet Fertilisers: A Case of Study on Ryegrass (Lollium perenne L.)
Next Article in Special Issue
New Insights into the Regulatory Non-Coding RNAs Mediating Rice–Brown Planthopper Interactions
Previous Article in Journal
Systematic Identification of Phosphate Transporter Family 1 (PHT1) Genes and Their Expression Profiling in Response to Low Phosphorus and Related Hormones in Fagopyrum tataricum (L.) Gaertn.
Previous Article in Special Issue
Genetic Variation and Assessment of Seven Salt-Tolerance Genes in an Indica/Xian Rice Population
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of a Recombinase Polymerase Amplification and CRISPR-Cas12a-Based Assay for Rapid Detection of Rice Bakanae Disease Caused by Fusarium fujikuroi

1
College of Fisheries and Life Science, Shanghai Ocean University, Shanghai 201306, China
2
Shanghai Key Laboratory of Agricultural Genetics and Breeding, Shanghai Academy of Agricultural Sciences, Shanghai 201106, China
3
Key Laboratory of Germplasm Innovation and Genetic Improvement of Grain and Oil Crops (Co-Construction by Ministry and Province), Ministry of Agriculture and Rural Affairs, Crop Breeding and Cultivation Research Institute, Shanghai Academy of Agricultural Sciences, Shanghai 201403, China
4
Development Center of Plant Germplasm Resources, College of Life Sciences, Shanghai Normal University, Shanghai 200234, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Agronomy 2025, 15(3), 577; https://doi.org/10.3390/agronomy15030577
Submission received: 16 January 2025 / Revised: 19 February 2025 / Accepted: 26 February 2025 / Published: 26 February 2025
(This article belongs to the Special Issue New Insights into Pest and Disease Control in Rice)

Abstract

:
Fusarium fujikuroi is the primary causal agent of rice bakanae disease, which can lead to substantial yield losses. Developing a rapid, highly specific, and accurate method for detecting F. fujikuroi is crucial for effective surveillance, prevention, and control of rice bakanae disease. In this study, a novel detection assay, RPA-Cas12a-F, was developed by integrating recombinase polymerase amplification (RPA) and Cas12a for the detection of F. fujikuroi. This assay demonstrated a limit of detection (LOD) of 1 copy/μL of reference plasmid or 0.1 fg/μL of F. fujikuroi genomic DNA (gDNA). Furthermore, to enable on-site detection, the RPA-Cas12a technique was combined with a lateral flow strip (LFS) for visual readout, thereby developing the RPA-Cas12a-LFS assay. The LOD of the RPA-Cas12a-LFS assay was 1000 copies/μL of plasmid or 10 fg/μL of F. fujikuroi gDNA. The RPA-Cas12a-based assays developed in this study enable rapid, highly accurate, sensitive, and specific detection of F. fujikuroi, making them a promising tool for on-site detection without the need for expensive equipment and time-consuming methodologies.

1. Introduction

Rice bakanae is a fungal disease that poses a significant threat to rice cultivation worldwide [1]. The disease is characterized by yellowing and abnormal elongation of infected plants, attributed to the pathogen-secreted gibberellic acid (GA3) [2]. Severely affected rice plants often display necrotic root tissues and typically perish either before or shortly after transplantation [3]. It is well documented that multiple Fusarium species, including F. fujikuroi, F. proliferatum, F. verticillioides, and F. andiyazi, can induce bakanae disease. Of these, F. fujikuroi exhibits superior pathogenicity and is isolated most frequently from bakanae disease samples, surpassing the other three species [4,5]. Crucially, F. fujikuroi is the only species known to produce GA3, a crucial factor for the abnormal elongation symptoms that define rice bakanae disease [6].
F. fujikuroi can infect rice at every stage of its life cycle, from pre-emergence to maturity, leading to poor seed germination or plant wilting [7]. Infected rice plants continuously produce conidia, which are dispersed by wind or water. Peak production of these conidia occurs during the flowering and ripening stages, which is when the conidia can infect or contaminate the seeds [8]. As a result, the primary mode of transmission for rice bakanae is through seeds, with straw also acting as an initial source of infection in the field. Thus, precise detection and identification of F. fujikuroi are crucial for controlling bakanae disease and identifying resistant germplasm for management.
Molecular methods for the identification of F. fujikuroi offer significantly higher specificity and sensitivity and are more time-efficient compared to traditional methods that rely on field symptom observation or post-isolation morphological analysis of pathogens. Notably, molecular techniques are particularly advantageous for the early detection of rice bakanae disease [3]. Over the past decade, several molecular detection methods for F. fujikuroi have been developed, including PCR, quantitative PCR [3,9], and loop-mediated isothermal amplification (LAMP) assays [4,10,11].
In recent years, an advanced molecular detection technique based on the Cas12a effector protein has been developed. The Cas12a effector protein, alternatively known as Cpf1, is a single RNA-guided DNA endonuclease of the type V class 2 CRISPR-Cas system [12,13]. Cas12a is guided by CRISPR RNA (crRNA) that recognizes double-stranded DNA (dsDNA) targets containing a T-rich protospacer adjacent motif (PAM) sequence. Upon forming the Cas12a/crRNA/target DNA ternary complex, Cas12a triggers the trans-cleavage of a quenched fluorescent single-stranded DNA (ssDNA) reporter, thereby releasing the fluorophore [13,14]. This trans-cleavage event triggered by the target-recognition mechanism exhibits multiple-turnover behavior [15]. This feature enables the Cas12a system to achieve highly effective signal amplification, which has facilitated the development of ultra-sensitive diagnostic tools [15,16]. By integrating preamplification of the target nucleic acid with PCR or isothermal amplification, Cas12a-based diagnostic assays have achieved the ability to detect target DNA at concentrations as low as attomolar (aM) levels [15,17,18]. To date, various CRISPR/Cas12a-based methods have been developed for detecting rice pathogens, such as Aphelenchoides besseyi (the cause of rice white tip disease) [19], Magnaporthe oryzae (the cause of rice blast) [20], Xanthomonas oryzae pv. oryzae (the cause of rice bacterial blight), rice stripe virus, and rice black-streaked dwarf virus [21]. However, a detection method based on CRISPR/Cas12a for F. fujikuroi has not yet been established.
In this study, a novel detection method that integrates Cas12a with recombinase polymerase amplification (RPA) for the detection of F. fujikuroi was introduced. The assay consists of three sequential steps: preamplification of target DNA at 37 °C for 20 min, Cas12a reaction at 37 °C for 20 min, and a 5 min readout using either a fluorescence analyzer or a lateral flow strip assay (LFS). This innovative approach offers the capability to detect F. fujikuroi with high precision, sensitivity, and specificity, while eliminating the need for complex equipment. As a result, it provides a simple, straightforward, and efficient method suitable for on-site, rapid detection of F. fujikuroi.

2. Materials and Methods

2.1. Isolation of Fusarium Species

F. fujikuroi isolates were obtained from bakanae-infected rice samples. Bakanae-infected rice leaf sheaths with distinct lesions were cut to a length of 1 cm. Similarly, isolates of F. proliferatum and F. verticillioides were obtained from corn ear rot samples, with kernels from the diseased–healthy boundary peeled off. The rice leaf sheaths and corn kernels were then subjected to surface disinfection with a 10% sodium hypochlorite solution for 2 min. The samples were subsequently rinsed with sterile water 3 times and dried using sterile absorbent paper.
Following this, the samples were placed in Petri dishes containing Potato Dextrose Agar (PDA) and incubated at 28 °C for 3 days. Each suspected Fusarium species strain was then subjected to single-spore isolation according to the Fusarium laboratory manual [22].

2.2. DNA Extraction from Fusarium Strains and Infected Rice Samples

Fusarium strains were cultured on PDA at 28 °C for 5 days. The mycelia were then harvested for genomic DNA extraction using the Fungal Genomic DNA Extraction Kit (Solarbio, Beijing, China) following the manufacturer’s protocols.
For DNA extraction from infected rice plants, approximately 0.1 g of leaf sheath was ground into powder in liquid nitrogen. The powder was combined with 600 µL of CTAB solution (1.5% CTAB, 75 mmol/L Tris-HCl, 15 mmol/L EDTA, and 1.05 mol/L NaCl, pH 8.0) and incubated at 56 °C for 20 min. After incubation, 450 µL of chloroform was added, and the mixture was vigorously shaken and centrifuged at 12,000 rpm for 10 min. The 450 µL supernatant was transferred and mixed with 900 µL of ethanol and then centrifuged at 12,000 rpm for 10 min. The supernatant was discarded, and the pellet was washed with 70% ethanol. After drying, 50 µL of sterile water was added to dissolve the pellet.
The concentration of genomic DNA from each Fusarium strain or rice plant sample was quantified using the NanoDrop™ 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA) and subsequently adjusted to a concentration of 10 ng/µL.

2.3. PCR of the TEF-1α and Phylogenetic Analysis

PCR amplification of the Translation elongation factor 1α (TEF-1α) gene was performed using the primers EF-1 and EF-2 [23]. After amplification, the PCR products were purified using the SanPrep Column DNA Gel Extraction Kit (Sangon Biotech, Shanghai, China). The purified products were then sequenced in both directions with the primers EF-1 and EF-2 at Tsingke Biotech (Beijing, China).
The TEF-1α sequences obtained from each Fusarium isolate were used for phylogenetic analysis using the neighbor-joining method with MEGA X 10.2 software [24]. Additionally, the following TEF-1α sequences of Fusarium isolates, retrieved from GenBank, were included in the analysis: F. fujikuroi isolates BF094, BR129, and AT11-1; F. proliferatum isolates CF598 and WF16; and F. verticillioides isolates K311, FV4, UBOCC-A-101150, and LS21.

2.4. RPA Primer, crRNA, and ssDNA Reporter Design

Intergenic spacer (IGS) region sequences of the 28S rRNA gene of F. fujikuroi (accession number: AJ879945.1), F. proliferatum (accession number: AJ879946.1), F. verticillioides (accession number: AJ880006.1), F. equiseti (accession number: AJ854658.1), F. graminearum (accession number: AJ854657.1), F. culmorum (accession number: AJ854659.1), F. sporotrichioides (accession number: HQ165899.1), and F. sibiricum (accession number: HM060275.1) were obtained from GenBank and aligned using ClustalW 2.1 software. RPA primers specifically targeting the F. fujikuroi IGS sequence were designed according to the manufacturer’s design manual of the TwistAmp Basic kit (TwistDx Ltd., Cambridge, UK) (Figure 1). Seven Cas12a crRNA were designed to target the RPA-amplified product of the IGS sequence of F. fujikuroi. The crRNA comprises a 19-nucleotide direct repeat (DR) and a 19 to 20-nucleotide guide sequence that is complementary to the target sequence adjacent to the protospacer adjacent motif (PAM). Additionally, for target detection utilizing Cas12a trans-cleavage activity, a HEX-BHQ1-labeled ssDNA reporter (HB-reporter) or a FAM-Biotin-labeled ssDNA reporter (FB-reporter) was designed for fluorescence assay or lateral flow strip assay (LFS), correspondingly. The primers and oligos used in this study are listed in Table 1.

2.5. RPA Amplification and Optimizing Reaction Conditions

RPA reactions were performed using the TwistAmp Basic kit (TABAS03KIT, TwistDx, UK). The RPA reaction mixture was prepared by combining 29.5 μL of TwistAmp RPA buffer, 2.4 μL of each 10μM RPA primer, 1 μL of the DNA template, and 12.2 μL of sterile deionized water. After gentle mixing, the reaction mixture was transferred to a TwistAmp Basic reaction tube containing lyophilized enzyme powder. Subsequently, 2.5 μL of 280 mM magnesium acetate was added and thoroughly mixed. The tube was then incubated on a heat block for amplification of the DNA template. For the negative control (NC) reaction, sterile deionized water was substituted into the DNA template.

2.6. RPA-Cas12a Fluorescence (RPA-Cas12a-F) Detection Assay for F. fujikuroi

The RPA-Cas12a fluorescence detection assay was performed in a 20 μL volume reaction, comprising 2 μL of 10× Cas12a reaction buffer, 250 nM crRNA, 50 nM LbCas12a, 10 U of RNase inhibitor, 250 nM HB-reporter (Table 1), and 2 μL of the RPA products. The mixture was loaded onto a PCR plate and incubated at 37 °C in the QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems, Carlsbad, CA, USA). Fluorescence signals were monitored and recorded every 30 s during the incubation process.

2.7. Construction and Purification of Reference Plasmid pUC57-18S

To determine the sensitivity of the RPA-Cas12a assay, a reference plasmid was constructed by cloning the 328 bp RPA fragment of the F. fujikuroi IGS of 28S rRNA gene into the pUC57 vector. The resultant plasmid, pUC57-IGS, was verified through restriction enzyme digestion and sequencing. The concentration of the purified pUC57-18S was determined using a NanoDrop 2000 Spectrophotometer (Thermo Scientific, USA) and calculated in copy numbers per μL. The plasmid was then diluted in TE buffer to a concentration of 1010 copies/μL.

2.8. RPA-Cas12a Lateral Flow Strip (RPA-Cas12a-LFS) Detection Assay for F. fujikuroi

The reaction mix for the RPA-Cas12a flow strip detection assay was configured similarly to the procedure mentioned above, with the exception that the FB-reporter (labeled with 6-FAM at the 5′-end and biotin at the 3′-end) was utilized instead of the HB-reporter (Table 1). Following 20 min of incubation at 37 °C, the reaction products were diluted to a total volume of 100 μL. Subsequently, LFSs were immersed in the diluted reactions. The results can be visualized after a 5 min incubation period at room temperature.

3. Results

3.1. Isolation and Molecular Identification of Fusarium Species

Three Fusarium species isolates were collected from the bakanae-infected rice samples, while five isolates were obtained from the corn ear rot samples. All Fusarium species isolates consistently produced an approximately 700 bp amplicon through PCR amplification using TEF-1α gene-specific primers (Figure S1) [23]. The TEF-1α gene sequences of these eight Fusarium species, along with those from representative F. fujikuroi isolates BF094, BR129, and AT11-1; F. proliferatum isolates CF598 and WF16; and F. verticillioides isolates K311, FV4, UBOCC-A-101150, and LS21, were utilized to construct the phylogenetic tree. The phylogenetic tree revealed three distinct clades with high bootstrap values. The three strains isolated from bakanae-infected rice samples clustered within the F. fujikuroi clade and were thus named FF1, FF2, and FF3. Of the five strains isolated from the corn ear rot samples, three were grouped within the F. verticillioides clade and were named FV1, FV2, and FV3, while the remaining two stains were grouped within the F. proliferatum clade and were named FP1 and FP2 (Figure 2a,b).

3.2. Establishing the RPA-Cas12a Fluorescence (RPA-Cas12a-F) Detection Assay for F. fujikuroi

To evaluate the performance of the RPA primers, RPA amplifications were performed using F. fujikuroi genomic DNA as the template across a temperature range from 10 °C to 65 °C. The results showed that specific amplification products were successfully obtained within the temperature range of 30 °C to 45 °C (Figure 3a). Considering the minimal equipment requirements, 37 °C was chosen for subsequent RPA reactions, as it also coincides with the optimal temperature for Cas12a activity. Additionally, the RPA amplification time was optimized at 37 °C, and it was found that 20 min of incubation provided an optimal amplification output (Figure 3b).
To achieve better trans-cleavage activity of Cas12a, seven crRNAs were designed to target the RPA fragment based on the Cas12a PAM motif (Table 1). The efficacy of these crRNAs was evaluated using an RPA-Cas12a fluorescence assay using a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). Compared to the negative control (NC), significantly higher fluorescence signals were observed for crRNA1, crRNA2, and crRNA7, with crRNA1 exhibiting the highest fluorescence intensity (Figure 3c,d). This result indicates that crRNA1 has the highest activity in detecting target DNA, making it the optimal crRNA for the RPA-Cas12a-F detection assay.

3.3. Specificity Evaluation of the RPA-Cas12a-F Assay

The specificity of the RPA-Cas12a-F assay was evaluated using three F. fujikuroi samples (FF1, FF2, and FF3) and five non-F. fujikuroi controls, including three F. verticillioides (FV1, FV2, and FV3) and two F. proliferatum (FP1 and FP2) (Figure 2). As expected, the RPA amplification results showed that the 328 bp DNA fragment was only amplified from the F. fujikuroi samples (FF1, FF2, and FF3) but not from the non-F. fujikuroi controls, including three F. verticillioides (FV1, FV2, and FV3) and two F. proliferatum (FP1 and FP2), as well as the negative control. This confirms the specificity of the RPA primers (Figure 4a). Furthermore, using RPA-Cas12a-F assays, all three F. fujikuroi samples (FF1, FF2, and FF3) exhibited strong fluorescence signals and did not show cross-reactivity with the non-F. fujikuroi samples (Figure 4b). These findings collectively demonstrate the high specificity of the RPA-Cas12a-F assay for detecting F. fujikuroi.

3.4. Sensitivity Evaluation of the RPA-Cas12a-F Assay

The sensitivity of the RPA-Cas12a-F assay was evaluated and compared with PCR using serial 10-fold dilutions of the plasmid pUC57-IGS. The limit of detection (LOD) for PCR with primers RPA-F/RPA-R (Table 1) was found to be 103 copies/μL (Figure 5a). In contrast, the LOD of the RPA-Cas12a-F method reached 1 copy/μL, demonstrating a sensitivity approximately one thousand times greater than that of PCR (Figure 5b,c).
Additionally, the sensitivity of the RPA-Cas12a-F assay was assessed using serial 10-fold dilutions of F. fujikuroi genomic DNA (gDNA). The LOD for PCR was determined to be 10−4 ng/μL of F. fujikuroi gDNA (Figure 5d). In comparison, the LOD for the RPA-Cas12a-F assay was as low as 10−7 ng/μL of F. fujikuroi gDNA (Figure 5e,f). These results further confirm that the RPA-Cas12a-F assay is over one thousand times more sensitive than PCR.

3.5. Establishing the RPA-Cas12a Lateral Flow Strip (RPA-Cas12a-LFS) Detection Assay

To facilitate on-site detection, the RPA-Cas12a technique was integrated with a lateral flow strip (LFS) assay to test three F. fujikuroi samples (FF1, FF2, and FF3), three F. verticillioides samples (FV1, FV2, and FV3), and two F. proliferatum samples (FP1 and FP2). The results demonstrated that the F. fujikuroi samples (FF1, FF2, and FF3) produced clear test bands, comparable to the positive control. Conversely, no cross-reactivity was detected with the F. verticillioides (FV1, FV2, and FV3) and F. proliferatum (FP1, FP2) samples (Figure 6a). These findings underscore the high specificity of the RPA-Cas12a-LFS assay.
A serial 10-fold dilution series of the reference plasmid pUC57-IGS was used to assess the sensitivity of the RPA-Cas12a-LFS assay. The LOD for the RPA-Cas12a-LFS assay was determined to be 103 copies/μL (Figure 6b). Additionally, the sensitivity of the RPA-Cas12a-LFS assay was evaluated using a series of 10-fold dilutions of F. fujikuroi gDNA. Clear test bands were observed when the gDNA concentration was above 10−5 ng/μL (Figure 6c).

3.6. Evaluation of the Performance of the RPA-Cas12a-F and RPA-Cas12a-LFS Assays for the Detection of F. fujikuroi in Infected Rice Plants

DNA samples extracted from bakanae disease plants (BDPs) and healthy plants (HPs) were used to evaluate the performance of the RPA-Cas12a-F and RPA-Cas12a-LFS assays. In the rice paddy fields, BDPs infected with F. fujikuroi exhibit elongated stems compared to HPs, due to the excessive production of GA3 by F. fujikuroi (Figure 7a). As expected, the BDP DNA sample tested positive, while the HP DNA sample tested negative in both the RPA-Cas12a-F (Figure 7b,c) and RPA-Cas12a-LFS assays (Figure 7d), suggesting the feasibility of these assays. Additionally, the sensitivity of the RPA-Cas12a-F and RPA-Cas12a-LFS assays was compared using a series of mixed samples from BDP DNA and HP DNA (ranging from 1:9 to 1:9999999). The results showed that the detection limit of RPA-Cas12a-F reached a mixed DNA sample ratio of 1:999999 (Figure 7b,c), while the detection limit of RPA-Cas12a-LFS reached a ratio of 1:9999 (Figure 7d). These findings demonstrate that while RPA-Cas12a-F requires instruments such as quantitative PCR machines, it offers significantly higher detection sensitivity compared to the RPA-Cas12a-LFS assay. These two methods can be selectively employed in various scenarios for the effective detection of F. fujikuroi in rice samples.

4. Discussion

Early detection of the bakanae pathogen F. fujikuroi in infected plant samples is crucial for preventing the onset and spread of this rice disease. Conventional diagnostic methods generally entail isolating and cultivating the pathogen in a pure culture, followed by microscopic examination of its morphological characteristics [6,25]. However, identification based on morphological and microbiological traits has been found to be time-consuming and challenging, requiring expertise that may not always be available [26]. Consequently, molecular identification techniques, which rely on DNA analysis, have been widely employed to identify F. fujikuroi [27].
In several studies, various PCR and quantitative PCR methods have been developed to specifically detect F. fujikuroi [3,23,27,28,29,30,31,32,33]. However, due to the need for technical expertise and specialized equipment, these techniques are not suitable for on-site detection [11]. Loop-mediated isothermal amplification (LAMP) is a highly efficient, specific, and sensitive molecular diagnostic method for amplifying DNA sequences at a constant temperature [34]. It offers significant advantages over traditional PCR and quantitative PCR techniques and has been successfully applied to detect F. fujikuroi in various studies [5,10,11,33,35,36]. However, the sensitivity of LAMP methods developed by different research groups for detecting F. fujikuroi varies considerably. For instance, the LOD of the LAMP-based assay developed by Rong et al. [10], which targets the intergenic spacer (IGS) region of the nuclear ribosomal operon, is 67 pg/µL of F. fujikuroi gDNA. In contrast, the LOD of the LAMP assay developed by Sunani et al., which targets the NRPS31 gene, is 10 pg/µL of F. fujikuroi gDNA [33]. In another study, Zhang et al. also developed a LAMP detection method targeting the NRPS31 gene, reporting an LOD of 1 fg/µL [11].
To address these challenges, here, a convenient and highly sensitive assay, named RPA-Cas12a-F, was developed for detecting F. fujikuroi by integrating the RPA and Cas12a techniques. The RPA-Cas12a-F detection method is similar to the LAMP method in that it only requires a constant temperature to complete the detection process. While the LAMP method requires an incubation at 65 °C [34], RPA-Cas12a-F operates effectively at body temperature (37 °C). In this study, a quantitative PCR system was utilized to visualize real-time fluorescence changes during the Cas12a reaction. However, in laboratories without access to quantitative PCR systems, a simple handheld microplate reader can also effectively provide detection results [37]. The entire reaction process of the RPA-Cas12a-F assay takes only 40 min, including 20 min for RPA amplification and 20 min for the Cas12a reaction. In contrast, qPCR or PCR assays typically require 2–3 h, and the LAMP assay usually takes around 1 h to complete. Furthermore, the RPA-Cas12a-F assay demonstrated exceptionally high sensitivity, achieving a LOD of 1 copy/µL of reference plasmid or 0.1 fg/µL (10−7 ng/µL) of F. fujikuroi gDNA, which is approximately 1000 times more sensitive than PCR methods (Figure 5a–f) and is also more sensitive than previously reported LAMP detection assays [5,10,11,33,35,36].
The sequence-specific recognition of target DNA by the Cas12a-crRNA binary complex is a key factor in the high specificity of Cas12a-based detection assays. This recognition process involves the hybridization of the crRNA with the target strand (TS) to form a heteroduplex, and the stabilization of the displaced non-target strand (NTS), leading to the formation of a stable ‘R-loop’ complex that includes Cas12a, crRNA, and target DNA [38,39]. Mismatches between the crRNA and the TS can interfere with or prevent the formation of the R-loop and can also accelerate the dissociation of the target DNA from the complex [40]. This relatively unstable binding of the Cas12a-crRNA complex to its DNA targets ensures the high specificity of the Cas12a-based detection assays. Moreover, in the design of RPA primers, it was carefully ensured that they amplify only specific bands in F. fujikuroi samples (Figure 4a). As a result, the RPA-Cas12a-F assay demonstrates excellent specificity and shows no cross-reactivity with closely related species such as F. proliferatum and F. verticillioides (Figure 4b,c). The specific amplification of F. fujikuroi DNA by the RPA primers, combined with the sequence-specific recognition of the target DNA by the crRNA, provides a robust double assurance for the high specificity of the RPA-Cas12a-F method in detecting F. fujikuroi.
To make this method more practical for field applications, the RPA-Cas12a assay was integrated with a lateral flow strip (RPA-Cas12a-LFS), enabling easy and equipment-free readout of the results at room temperature. The LOD of the RPA-Cas12a-LFS assay was determined to be 1000 copies/µL of the reference plasmid or 10−5 ng/µL of F. fujikuroi gDNA. This sensitivity is comparable to that of conventional PCR methods.

5. Conclusions

An innovative molecular detection protocol for F. fujikuroi was developed by integrating Cas12a with RPA preamplification, enabling result visualization using either a fluorescence analyzer or an LFS. This streamlined assay can be performed rapidly without the need for complex equipment or highly trained personnel. As a result, this novel RPA-Cas12a-based method demonstrates significant potential as a highly accurate, sensitive, and specific molecular tool for the detection of F. fujikuroi.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/agronomy15030577/s1, Figure S1: PCR amplification products of Fusarium species isolates using TEF1-α specific primers EF-1 and EF-2.

Author Contributions

Conceptualization and writing—original draft preparation, H.L. and Y.Q.; methodology, A.Z. and Y.H., validation, C.C. and J.Z.; resources, F.N. and B.S.; formal analysis, Y.D.; data curation, K.X. and Z.F.; visualization, X.D., B.H. and X.Z.; supervision and funding acquisition, L.C.; supervision and writing—review and editing, H.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Shanghai Agricultural Science and Technology Innovation Program (grant No. T2023301), the Shanghai Key Laboratory of Agricultural Genetics and Breeding, and the Agriculture Research System of Shanghai, China (grant No. 2025003).

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
RPARecombinase polymerase amplification
LODLimit of detection
gDNAGenomic DNA
LFSLateral flow strip
LAMPLoop-mediated isothermal amplification
crRNACRISPR RNA
dsDNADouble-stranded DNA
PAMProtospacer adjacent motif
ssDNASingle-stranded DNA
PDAPotato dextrose agar
NCNegative control
HPHealth plant
BDPBakanae disease plant
TSTarget strand
NTSNon-target strand

References

  1. Wulff, E.G.; Sørensen, J.L.; Lübeck, M.; Nielsen, K.F.; Thrane, U.; Torp, J. Fusarium spp. associated with rice Bakanae: Ecology, genetic diversity, pathogenicity and toxigenicity. Environ. Microbiol. 2010, 12, 649–657. [Google Scholar] [CrossRef] [PubMed]
  2. Gupta, A.; Solanki, I.; Bashyal, B.; Singh, Y.; Srivastava, K. Bakanae of rice—An emerging disease in Asia. J. Anim. Plant Sci. 2015, 25, 1499–1514. [Google Scholar]
  3. Carneiro, G.A.; Matić, S.; Ortu, G.; Garibaldi, A.; Spadaro, D.; Gullino, M.L. Development and Validation of a TaqMan Real-Time PCR Assay for the Specific Detection and Quantification of Fusarium fujikuroi in Rice Plants and Seeds. Phytopathology 2017, 107, 885–892. [Google Scholar] [CrossRef]
  4. Yuan, Y.; Rong, Z.; Ye, W.; Zhang, H.; Zhuang, Y.; Zheng, X. Detection of seed-borne rice bakanae pathogens in Jiangsu Province, China using loop-mediated isothermal amplification assays. Chin. J. Rice Sci. 2018, 32, 493–500. [Google Scholar]
  5. Jiang, H.; Wu, N.; Jin, S.; Ahmed, T.; Wang, H.; Li, B.; Wu, X.; Bao, Y.; Liu, F.; Zhang, J.-Z. Identification of Rice Seed-Derived Fusarium spp. and Development of LAMP Assay against Fusarium fujikuroi. Pathogens 2021, 10, 1. [Google Scholar] [CrossRef]
  6. Ain, N.; Zainudin, N.A.I.M.; Razak, A.; Salleh, B. Bakanae Disease of Rice in Malaysia and Indonesia: Etiology of the Causal Agent Based on Morphological, Physiological and Pathogenicity Characteristics. J. Plant Prot. Res. 2008, 48, 475–485. [Google Scholar]
  7. Shakeel, Q.; Mubeen, M.; Sohail, M.A.; Ali, S.; Iftikhar, Y.; Bajwa, R.T.; Aqueel, M.A.; Upadhyay, S.K.; Divvela, P.K.; Zhou, L. An explanation of the mystifying bakanae disease narrative for tomorrow’s rice. Front. Microbiol. 2023, 14, 1153437. [Google Scholar] [CrossRef]
  8. Matic, S.; Gullino, M.L.; Spadaro, D. The puzzle of bakanae disease through interactions between Fusarium fujikuroi and rice. Front. Biosci. 2017, 9, 333–344. [Google Scholar]
  9. Hwang, I.S.; Kang, W.-R.; Hwang, D.-J.; Bae, S.-C.; Yun, S.-H.; Ahn, I.-P. Evaluation of bakanae disease progression caused by Fusarium fujikuroi in Oryza sativa L. J. Microbiol. 2013, 51, 858–865. [Google Scholar] [CrossRef]
  10. Rong, Z.; Yuan, Y.; Ye, W.; Wang, X.; Zheng, X. Rapid diagnosis of rice bakanae caused by Fusarium fujikuroi and F. proliferatum using loop-mediated isothermal amplification assays. J. Phytopathol. 2018, 166, 283–290. [Google Scholar] [CrossRef]
  11. Zhang, S.Y.; Dai, D.J.; Wang, H.D.; Zhang, C.Q. One-step loop-mediated isothermal amplification (LAMP) for the rapid and sensitive detection of Fusarium fujikuroi in bakanae disease through NRPS31, an important gene in the gibberellic acid bio-synthesis. Sci. Rep. 2019, 9, 3726. [Google Scholar] [CrossRef] [PubMed]
  12. Shmakov, S.; Smargon, A.; Scott, D.; Cox, D.; Pyzocha, N.; Yan, W.; Abudayyeh, O.O.; Gootenberg, J.S.; Makarova, K.S.; Wolf, Y.I.; et al. Diversity and evolution of class 2 CRISPR–Cas systems. Nat. Rev. Microbiol. 2017, 15, 169–182. [Google Scholar] [CrossRef]
  13. Zetsche, B.; Gootenberg, J.S.; Abudayyeh, O.O.; Slaymaker, I.M.; Makarova, K.S.; Essletzbichler, P.; Volz, S.E.; Joung, J.; van der Oost, J.; Regev, A.; et al. Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell 2015, 163, 759–771. [Google Scholar] [CrossRef]
  14. Li, S.-Y.; Cheng, Q.-X.; Wang, J.-M.; Li, X.-Y.; Zhang, Z.-L.; Gao, S.; Cao, R.-B.; Zhao, G.-P.; Wang, J. CRISPR-Cas12a-assisted nucleic acid detection. Cell Discov. 2018, 4, 20. [Google Scholar] [CrossRef]
  15. Chen, J.S.; Ma, E.; Harrington, L.B.; Da Costa, M.; Tian, X.; Palefsky, J.M.; Doudna, J.A. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science 2018, 360, 436–439. [Google Scholar] [CrossRef]
  16. East-Seletsky, A.; O’Connell, M.R.; Burstein, D.; Knott, G.J.; Doudna, J.A. RNA Targeting by Functionally Orthogonal Type VI-A CRISPR-Cas Enzymes. Mol. Cell 2017, 66, 373–383.e3. [Google Scholar] [CrossRef]
  17. Gootenberg, J.S.; Abudayyeh, O.O.; Kellner, M.J.; Joung, J.; Collins, J.J.; Zhang, F. Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science 2018, 360, 439–444. [Google Scholar] [CrossRef]
  18. Li, Y.; Li, S.; Wang, J.; Liu, G. CRISPR/Cas Systems towards Next-Generation Biosensing. Trends Biotechnol. 2019, 37, 730–743. [Google Scholar] [CrossRef]
  19. Zhang, A.; Sun, B.; Zhang, J.; Cheng, C.; Zhou, J.; Niu, F.; Luo, Z.; Yu, L.; Yu, C.; Dai, Y.; et al. CRISPR/Cas12a Coupled with Recombinase Polymerase Amplification for Sensitive and Specific Detection of Aphelenchoides besseyi. Front. Bioeng. Biotechnol. 2022, 10, 912959. [Google Scholar] [CrossRef]
  20. Zhang, Y.-m.; Zhang, Y.; Xie, K. Evaluation of CRISPR/Cas12a-based DNA detection for fast pathogen diagnosis and GMO test in rice. Mol. Breed. 2020, 40, 11. [Google Scholar] [CrossRef]
  21. Zhu, Z.; Li, R.; Zhang, H.; Wang, J.; Lu, Y.; Zhang, D.; Yang, L. PAM-free loop-mediated isothermal amplification coupled with CRISPR/Cas12a cleavage (Cas-PfLAMP) for rapid detection of rice pathogens. Biosens. Bioelectron. 2022, 204, 114076. [Google Scholar] [CrossRef] [PubMed]
  22. Leslie, J.F.; Summerell, B.A. Practical Approaches to Identification. In The Fusarium Laboratory Manual; Blackwell: Hoboken, NJ, USA, 2006; pp. 101–110. [Google Scholar]
  23. O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. USA 1998, 95, 2044–2049. [Google Scholar] [CrossRef]
  24. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  25. Leslie, J.F.; Anderson, L.L.; Bowden, R.L.; Lee, Y.-W. Inter- and intra-specific genetic variation in Fusarium. Int. J. Food Microbiol. 2007, 119, 25–32. [Google Scholar] [CrossRef]
  26. Desjardins, A.E.; Manandhar, H.K.; Plattner, R.D.; Manandhar, G.G.; Poling, S.M.; Maragos, C.M. Fusarium Species from Nepalese Rice and Production of Mycotoxins and Gibberellic Acid by Selected Species. Appl. Environ. Microbiol. 2000, 66, 1020–1025. [Google Scholar] [CrossRef]
  27. Amatulli, M.T.; Spadaro, D.; Gullino, M.L.; Garibaldi, A. Conventional and real-time PCR for the identification of Fusarium fujikuroi and Fusarium proliferatum from diseased rice tissues and seeds. Eur. J. Plant Pathol. 2012, 134, 401–408. [Google Scholar] [CrossRef]
  28. Amatulli, M.T.; Spadaro, D.; Gullino, M.L.; Garibaldi, A. Molecular identification of Fusarium spp. associated with bakanae disease of rice in Italy and assessment of their pathogenicity. Plant Pathol. 2010, 59, 839–844. [Google Scholar] [CrossRef]
  29. Qiu, J.; Lu, Y.; He, D.; Lee, Y.-W.; Ji, F.; Xu, J.; Shi, J. Fusarium fujikuroi Species Complex Associated With Rice, Maize, and Soybean From Jiangsu Province, China: Phylogenetic, Pathogenic, and Toxigenic Analysis. Plant Dis. 2020, 104, 2193–2201. [Google Scholar] [CrossRef]
  30. Choi, J.-H.; Lee, S.; Nah, J.-Y.; Kim, H.-K.; Paek, J.-S.; Lee, S.; Ham, H.; Hong, S.K.; Yun, S.-H.; Lee, T. Species composition of and fumonisin production by the Fusarium fujikuroi species complex isolated from Korean cereals. Int. J. Food Microbiol. 2018, 267, 62–69. [Google Scholar] [CrossRef]
  31. Steenkamp Emma, T.; Brenda, D.W.; Teresa, A.C.; Kurt, A.Z.; Michael, J.W.; Walter, F.O.M.; John, F.L. PCR-Based Identification of MAT-1 andMAT-2 in the Gibberella fujikuroi Species Complex. Appl. Environ. Microbiol. 2000, 66, 4378–4382. [Google Scholar] [CrossRef]
  32. Pramunadipta, S.; Widiastuti, A.; Wibowo, A.; Suga, H.; Priyatmojo, A. Development of PCR-RFLP Technique for Identify Several Members of Fusarium incarnatum-equiseti Species Complex and Fusarium fujikuroi Species Complex. Plant Pathol. J. 2022, 38, 254–260. [Google Scholar] [CrossRef] [PubMed]
  33. Sunani, S.K.; Bashyal, B.M.; Rawat, K.; Manjunatha, C.; Sharma, S.; Prakash, G.; Krishnan, S.G.; Singh, A.K.; Aggarwal, R. Development of PCR and loop mediated isothermal amplification assay for the detection of bakanae pathogen Fusarium fujikuroi. Eur. J. Plant Pathol. 2019, 154, 715–725. [Google Scholar] [CrossRef]
  34. Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, e63. [Google Scholar] [CrossRef] [PubMed]
  35. Sanna, M.; Spadaro, D.; Gullino, M.L.; Mezzalama, M. Optimization of a Loop-Mediated Isothermal Amplification Assay for On-Site Detection of Fusarium fujikuroi in Rice Seed. Agronomy 2021, 11, 1580. [Google Scholar] [CrossRef]
  36. Ortega, S.F.; Tomlinson, J.; Hodgetts, J.; Spadaro, D.; Gullino, M.L.; Boonham, N. Development of Loop-Mediated Isothermal Amplification Assays for the Detection of Seedborne Fungal Pathogens Fusarium fujikuroi and Magnaporthe oryzae in Rice Seed. Plant Dis. 2018, 102, 1549–1558. [Google Scholar] [CrossRef]
  37. Jian, D.; Wang, B.; Huang, H.; Meng, X.; Liu, C.; Xue, L.; Liu, F.; Wang, S. Sunlight based handheld smartphone spectrometer. Biosens. Bioelectron. 2019, 143, 111632. [Google Scholar] [CrossRef]
  38. Yamano, T.; Nishimasu, H.; Zetsche, B.; Hirano, H.; Slaymaker, I.M.; Li, Y.; Fedorova, I.; Nakane, T.; Makarova, K.S.; Koonin, E.V.; et al. Crystal Structure of Cpf1 in Complex with Guide RNA and Target DNA. Cell 2016, 165, 949–962. [Google Scholar] [CrossRef]
  39. Swarts, D.C.; van der Oost, J.; Jinek, M. Structural Basis for Guide RNA Processing and Seed-Dependent DNA Targeting by CRISPR-Cas12a. Mol. Cell 2017, 66, 221–233.e4. [Google Scholar] [CrossRef]
  40. Strohkendl, I.; Saifuddin, F.A.; Rybarski, J.R.; Finkelstein, I.J.; Russell, R. Kinetic Basis for DNA Target Specificity of CRISPR-Cas12a. Mol. Cell 2018, 71, 816–824.e3. [Google Scholar] [CrossRef]
Figure 1. Alignment of intergenic spacer (IGS) region sequences of 28S rRNA gene. The sequences of F. fujikuroi (AJ879945.1), F. proliferatum (AJ879946.1), F. verticillioides (AJ880006.1), F. equiseti (AJ854658.1), F. graminearum (AJ854657.1), F. culmorum (AJ854659.1), F. sporotrichioides (HQ165899.1), and F. sibiricum (HM060275.1) were retrieved from GenBank. The RPA primers specifically targeting the IGS of F. fujikuroi are highlighted in blue. Conserved nucleotides across different species are highlighted in yellow. The target sites of crRNA are indicated as arrows.
Figure 1. Alignment of intergenic spacer (IGS) region sequences of 28S rRNA gene. The sequences of F. fujikuroi (AJ879945.1), F. proliferatum (AJ879946.1), F. verticillioides (AJ880006.1), F. equiseti (AJ854658.1), F. graminearum (AJ854657.1), F. culmorum (AJ854659.1), F. sporotrichioides (HQ165899.1), and F. sibiricum (HM060275.1) were retrieved from GenBank. The RPA primers specifically targeting the IGS of F. fujikuroi are highlighted in blue. Conserved nucleotides across different species are highlighted in yellow. The target sites of crRNA are indicated as arrows.
Agronomy 15 00577 g001
Figure 2. Identification of Fusarium isolates. (a) The morphological characterization of the Fusarium isolates; (b) phylogenetic analysis of Fusarium isolates based on TEF-1α sequences. The GenBank accession numbers for representative Fusarium isolates are indicated in brackets following the isolate codes.
Figure 2. Identification of Fusarium isolates. (a) The morphological characterization of the Fusarium isolates; (b) phylogenetic analysis of Fusarium isolates based on TEF-1α sequences. The GenBank accession numbers for representative Fusarium isolates are indicated in brackets following the isolate codes.
Agronomy 15 00577 g002
Figure 3. Establishing the RPA-Cas12a-F detection assay for F. fujikuroi. (a) RPA amplifications conducted using F. Fujikuroi gDNA at varying temperatures for 20 min; (b) RPA amplifications conducted using F. Fujikuroi gDNA at 37 °C for varying times; (c) representative fluorescence kinetics of different crRNA using the Quantstudio 6 flex quantitative PCR system (Applied Biosystems); (d) fluorescence signal values obtained at 10 min Cas12a reaction with different crRNA; (e) fluorescence signal values obtained at 20 min Cas12a reaction with different crRNA. The data are presented as mean ± SD (n =3). crRNAs that are significantly different from each other are labeled with different lowercase letters above each bar. NC, no crRNA control.
Figure 3. Establishing the RPA-Cas12a-F detection assay for F. fujikuroi. (a) RPA amplifications conducted using F. Fujikuroi gDNA at varying temperatures for 20 min; (b) RPA amplifications conducted using F. Fujikuroi gDNA at 37 °C for varying times; (c) representative fluorescence kinetics of different crRNA using the Quantstudio 6 flex quantitative PCR system (Applied Biosystems); (d) fluorescence signal values obtained at 10 min Cas12a reaction with different crRNA; (e) fluorescence signal values obtained at 20 min Cas12a reaction with different crRNA. The data are presented as mean ± SD (n =3). crRNAs that are significantly different from each other are labeled with different lowercase letters above each bar. NC, no crRNA control.
Agronomy 15 00577 g003
Figure 4. Specificity evaluation of the RPA-Cas12a-F assay for F. fujikuroi. (a) RPA amplification of eight Fusarium isolates; (b) representative fluorescence kinetics curves of the RPA-Cas12a-F assay; (c) relative fluorescence values at 20 min Cas12a reaction. Data are mean ± SD (n = 3); significantly different signals are labeled with lowercase letters. M, DL2000 DNA marker; NC, negative control.
Figure 4. Specificity evaluation of the RPA-Cas12a-F assay for F. fujikuroi. (a) RPA amplification of eight Fusarium isolates; (b) representative fluorescence kinetics curves of the RPA-Cas12a-F assay; (c) relative fluorescence values at 20 min Cas12a reaction. Data are mean ± SD (n = 3); significantly different signals are labeled with lowercase letters. M, DL2000 DNA marker; NC, negative control.
Agronomy 15 00577 g004
Figure 5. Sensitivity evaluation of the RPA-Cas12a-F assay for F. fujikuroi. (a) Sensitivity evaluation of the PCR assay using a serial 10-fold dilution (100 to 1010 copies/μL) of the reference plasmid; (b) representative fluorescence kinetics curves of the RPA-Cas12a-F assay using the serial 10-fold dilution (100 to 1010 copies/μL) of the reference plasmid; (c) fluorescence signal values at 20 min Cas12a reaction with serial 10-fold dilution (100 to 1010 copies/μL) of the reference plasmid. Data are mean ± SD (n = 3); significantly different signals are labeled with lowercase letters; (d) sensitivity evaluation of the PCR assay using a serial 10-fold dilution (10 to 10−10 ng/μL) of F. fujikuroi gDNA; (e) representative fluorescence kinetics curves of the RPA-Cas12a-F assay using the serial 10-fold dilution (10−1 to 10−10 ng/μL) of F. fujikuroi gDNA; (f) fluorescence signal values at 20 min Cas12a reaction with serial 10-fold dilution (10−1 to 10−10 ng/μL) of F. fujikuroi gDNA. Data are mean ± SD (n = 3); significantly different signals are labeled with lowercase letters. M, DL2000 DNA marker; NC, negative control.
Figure 5. Sensitivity evaluation of the RPA-Cas12a-F assay for F. fujikuroi. (a) Sensitivity evaluation of the PCR assay using a serial 10-fold dilution (100 to 1010 copies/μL) of the reference plasmid; (b) representative fluorescence kinetics curves of the RPA-Cas12a-F assay using the serial 10-fold dilution (100 to 1010 copies/μL) of the reference plasmid; (c) fluorescence signal values at 20 min Cas12a reaction with serial 10-fold dilution (100 to 1010 copies/μL) of the reference plasmid. Data are mean ± SD (n = 3); significantly different signals are labeled with lowercase letters; (d) sensitivity evaluation of the PCR assay using a serial 10-fold dilution (10 to 10−10 ng/μL) of F. fujikuroi gDNA; (e) representative fluorescence kinetics curves of the RPA-Cas12a-F assay using the serial 10-fold dilution (10−1 to 10−10 ng/μL) of F. fujikuroi gDNA; (f) fluorescence signal values at 20 min Cas12a reaction with serial 10-fold dilution (10−1 to 10−10 ng/μL) of F. fujikuroi gDNA. Data are mean ± SD (n = 3); significantly different signals are labeled with lowercase letters. M, DL2000 DNA marker; NC, negative control.
Agronomy 15 00577 g005
Figure 6. Establishment of the RPA-Cas12a-LFS assay for F. fujikuroi detection. (a) Evaluation of the specificity of the RPA-Cas12a-LFS assay. pUC57-IGS plasmid was used as positive control; (b) sensitivity evaluation of the RPA-Cas12a-LFS assay using a serial 10-fold dilution (100 to 1010 copies/μL) of the pUC57-IGS plasmid; (c) sensitivity evaluation of the RPA-Cas12a-LFS assay using a serial 10-fold dilution (10−1 to 10−10 ng/μL) of F. fujikuroi gDNA. NC, negative control.
Figure 6. Establishment of the RPA-Cas12a-LFS assay for F. fujikuroi detection. (a) Evaluation of the specificity of the RPA-Cas12a-LFS assay. pUC57-IGS plasmid was used as positive control; (b) sensitivity evaluation of the RPA-Cas12a-LFS assay using a serial 10-fold dilution (100 to 1010 copies/μL) of the pUC57-IGS plasmid; (c) sensitivity evaluation of the RPA-Cas12a-LFS assay using a serial 10-fold dilution (10−1 to 10−10 ng/μL) of F. fujikuroi gDNA. NC, negative control.
Agronomy 15 00577 g006
Figure 7. Detection of F. fujikuroi in BDP. (a) Morphology of the HPs and BDPs at the rice tillering stage; (b) representative fluorescence kinetics curves of the detection of F. fujikuroi in the BDPs using the RPA-Cas12a-F assay; (c) relative fluorescence values after 20 min of the Cas12a reaction for the detection of F. fujikuroi in the BDPs using the RPA-Cas12a-F assay. Data are mean ± SD (n = 3); significantly different signals are labeled with lowercase letters; (d) detection of F. fujikuroi in the BDPs using the RPA-Cas12a-LFA assay. BDP DNA, DNA extracted from bakanae disease plants; HP DNA, DNA extracted from healthy plants; 1:n, mixing ratio of BDP DNA and HP DNA. The initial concentration of BDP DNA and HP DNA were 10 ng/μL.
Figure 7. Detection of F. fujikuroi in BDP. (a) Morphology of the HPs and BDPs at the rice tillering stage; (b) representative fluorescence kinetics curves of the detection of F. fujikuroi in the BDPs using the RPA-Cas12a-F assay; (c) relative fluorescence values after 20 min of the Cas12a reaction for the detection of F. fujikuroi in the BDPs using the RPA-Cas12a-F assay. Data are mean ± SD (n = 3); significantly different signals are labeled with lowercase letters; (d) detection of F. fujikuroi in the BDPs using the RPA-Cas12a-LFA assay. BDP DNA, DNA extracted from bakanae disease plants; HP DNA, DNA extracted from healthy plants; 1:n, mixing ratio of BDP DNA and HP DNA. The initial concentration of BDP DNA and HP DNA were 10 ng/μL.
Agronomy 15 00577 g007
Table 1. RPA primer, crRNA, and ssDNA reporter sequences.
Table 1. RPA primer, crRNA, and ssDNA reporter sequences.
NameSequences (5′-3′)
RPA-FTAGGTACAGGGTAGGCACAGGGTAGGTAGAAG
RPA-RACATCTGCTCGGGAAGACCGACTTTCCAATTT
crRNA1AAUUUCUACUGUUGUAGAUCAAAGGUGGGUGUGAAAUUG
crRNA2AAUUUCUACUGUUGUAGAUCAAUUUCACACCCACCUUUG
crRNA3AAUUUCUACUGUUGUAGAUCUUGAGAAACGACGGUCUU
crRNA4AAUUUCUACUGUUGUAGAUCAAAGGUGGGUGUGAAAUU
crRNA5AAUUUCUACUGUUGUAGAUACACCCACCUUUGCAAAGU
crRNA6AAUUUCUACUGUUGUAGAUACCUACCCUUAGAGUAGUC
crRNA7AAUUUCUACUGUUGUAGAUCAAUUUCACACCCACCUUU
HB-reporterHEX-TTTTTTTTTT-BHQ1
FB-reporter6FAM-TTTTTTTTTT-Biotin
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, H.; Qiu, Y.; Zhang, A.; Hu, Y.; Cheng, C.; Zhou, J.; Niu, F.; Sun, B.; Dai, Y.; Xie, K.; et al. Development of a Recombinase Polymerase Amplification and CRISPR-Cas12a-Based Assay for Rapid Detection of Rice Bakanae Disease Caused by Fusarium fujikuroi. Agronomy 2025, 15, 577. https://doi.org/10.3390/agronomy15030577

AMA Style

Li H, Qiu Y, Zhang A, Hu Y, Cheng C, Zhou J, Niu F, Sun B, Dai Y, Xie K, et al. Development of a Recombinase Polymerase Amplification and CRISPR-Cas12a-Based Assay for Rapid Detection of Rice Bakanae Disease Caused by Fusarium fujikuroi. Agronomy. 2025; 15(3):577. https://doi.org/10.3390/agronomy15030577

Chicago/Turabian Style

Li, Hongyu, Yue Qiu, Anpeng Zhang, Yingxiong Hu, Can Cheng, Jihua Zhou, Fuan Niu, Bin Sun, Yuting Dai, Kaizhen Xie, and et al. 2025. "Development of a Recombinase Polymerase Amplification and CRISPR-Cas12a-Based Assay for Rapid Detection of Rice Bakanae Disease Caused by Fusarium fujikuroi" Agronomy 15, no. 3: 577. https://doi.org/10.3390/agronomy15030577

APA Style

Li, H., Qiu, Y., Zhang, A., Hu, Y., Cheng, C., Zhou, J., Niu, F., Sun, B., Dai, Y., Xie, K., Feng, Z., Ding, X., Hu, B., Zhang, X., Cao, L., & Chu, H. (2025). Development of a Recombinase Polymerase Amplification and CRISPR-Cas12a-Based Assay for Rapid Detection of Rice Bakanae Disease Caused by Fusarium fujikuroi. Agronomy, 15(3), 577. https://doi.org/10.3390/agronomy15030577

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop