Development and Integration of an SSR-Based Molecular Identity Database into Sugarcane Breeding Program
United States Department of Agriculture-Agricultural Research Service, Southeast Area, Sugarcane Research Unit, 5883 USDA Road, Houma, LA 70360, USA
Agronomy 2016, 6(2), 28; https://doi.org/10.3390/agronomy6020028
Submission received: 14 March 2016
/
Revised: 19 April 2016
/
Accepted: 20 April 2016
/
Published: 25 April 2016
Abstract
:Sugarcane breeding is very difficult and it takes 12 to 14 years to develop a new cultivar for commercial production. This is because sugarcane varieties are highly polyploid, inter-specific hybrids with 100 to 130 chromosomes that may vary across geographical areas. Other obstacles/constraints include the small size of flowers that may not synchronize but may self-pollinate, difficulty in distinguishing hybrids from self progenies, extreme (G × E) interactive effect, and potential variety mis-identification during vegetative propagation and varietal exchange. To help cane breeders circumvent these constraints, a simple sequence repeats (SSR)-based molecular identity database has been developed at the United States Department of Agriculture-Agricultural Research Service, Sugarcane Research Unit in Houma, LA. Since 2005, approximately 2000 molecular identities have been constructed for clones of sugarcane and related Saccharum species that cover geographical areas including Argentina, Australia, Bangladesh, China, Colombia, India, Mexico, Pakistan, South Africa, Thailand, USA (Louisiana, Florida, Texas, and Hawaii), and Venezuela. The molecular identity database is updated annually and has been utilized to: (1) provide molecular descriptors to newly registered cultivars; (2) identify in a timely fashion any mislabeled or unidentifiable clones from cross parents and field evaluation plots; (3) develop de novo clones of energy cane with S. spontaneum cytoplasm; (4) provide clone-specific fingerprint information for assessing cross quality and paternity of polycross; (5) determine genetic relatedness of parental clones; (6) select F1 hybrids from (elite × wild) or (wild × elite) crosses; and (7) investigate the inheritance of SSR markers in sugarcane. The integration of the molecular identity database into the sugarcane breeding program may improve the overall efficacy of cultivar development and commercialization.
Generally speaking, there are probably nine key issues that affect both the productivity and the sustainability of sugarcane agriculture and integrated industry. These issues are land, fertility, water, variety, planting density, crop protection, cultural practices, harvesting and processing, and recently, computer information technology [1]. To all sugarcane farmers, it remains of top-most concern to grow the right cultivars. While it is the duty of conventional breeders to develop desirable sugarcane cultivars, biotechnologists can contribute greatly to the variety development process (crossing, selection, and evaluation) through the development and application of molecular breeding tools. Conventional sugarcane breeding is probably the most difficult job of any crop, due to the fact that sugarcane cultivars (Saccharum spp. hybrids) are highly polyploidy inter-specific hybrids containing 100 to 130 chromosomes [2,3]. The number of chromosomes may vary across geographical areas. Other obstacles/constraints include small flower size, the development of the flower which may not synchronize between crossing parents, the likelihood of self-pollination, the difficulty in visually distinguishing F1 hybrids from self progenies, the extreme genotype × environment or G × E interactive effect, and potential variety mis-identification during vegetative propagation and varietal exchange, etc. [3,4]. It takes 12 to 14 years to develop a new sugarcane variety upon selection and evaluation against about 20 traits that include high tonnage, high sugar yield, early maturity, low fiber, harvest-ability, cold tolerance, ratooning ability, and resistance to a number of disease and insect pests [5].
Applied biotechnology projects were initiated at the United States Department of Agriculture-Agricultural Research Service, Sugarcane Research Unit, Houma, Louisiana, USA in 1994, in research areas such as molecular evaluation of germplasm, development of species- and trait-specific DNA markers, genetic linkage mapping, microsatellite or simple sequence repeats (SSR) DNA marker-based molecular identity database, transgenic (GMO) sugarcane, and inheritance of molecular markers [1]. A sugarcane molecular identity database has been developed based on a panel of 21 polymorphic microsatellite (SSR) DNA markers (Table 1). These SSR markers were developed by the Sugarcane Microsatellite Consortium (SMC) supported by the International Consortium of Sugarcane Biotechnologists (ICSB) with 13 institution members. These include four institutions of Australia, namely, the Sugar Research of Australia (formerly the Bureau of Sugar Experiment Station), Centre of Plant Conservation Genetics, Commonwealth Science Industrial Research Organization, and the University of Queensland, the former Copersucar of Brazil, the Cenicaña of Colombia, the CIRAD of France, the Mauritius Sugar Industrial Research Institute, the Philippines Sugar Research Institute, South Africa Sugar Experiment Station, and three members from USA, namely, the American Sugar Cane League, the former Florida Sugar Cane League, and the former Hawaiian Sugar Planters’ Association [6,7]. Unlike morphological traits that may vary due to (G × E) interactions, our research showed that the SSR DNA markers-based molecular identities are stable across years and geographic locations. The molecular identity of a sugarcane clone is defined by the presence (labeled as “A”) or absence (“C”) of 144 DNA distinctive fingerprints/fragments/alleles amplifiable from the clone’s genomic DNA through PCR in a sequential order (Figure 1). The molecular identity of a sugarcane cultivar is unique and remains the same regardless of when or where the cultivar is grown. The quality and reliability of sugarcane molecular identities are ensured by a high throughput SSR genotyping platform, which utilizes leaf DNA samples, a liquid-handling robot, 384-well microplate, blue or green or yellow fluorescence-labeled PCR primers, red fluorescence-labeled DNA size markers, and a capillary electrophoresis (CE)-based DNA Sequencer [4]. Robust, yet distinctive, fluorescence peaks or SSR alleles are revealed from the CE files with genotyping software, either “GeneMapper" (Applied Biosystems, Inc. Foster City, CA, USA), or “GeneMarker” (SoftGenetics, LLC. College Station, PA, USA). Unlike agarose- or polyacrylamide-gel electrophoresis, during the CE process, each sample is run with 15 red fluorescence-labeled size standards in the range of 35 to 500 base pairs for accurate size calibration. Figure 2 shows one example, where eight polymorphic DNA fingerprints were amplified through PCR with a SSR primer pair SMC336BS from the 12 most recent Louisiana sugarcane cultivars. The sizes of these DNA fingerprints are 154, 166, 167, 169, 171, 175, 177, and 183 base pairs (bp), respectively, at a resolution power of just one base pair between 166 bp and 167 bp. Only two cultivars, L 01-299 and L 03-371, share four DNA fingerprints of 166, 169, 171, and 175 bp. Each of the other 10 cultivars has its unique DNA fingerprints.
Since 2005, SSR-based clone-specific molecular identities have been constructed for over 2000 clones of sugarcane cultivars and/or related Saccharum species (S. officinarum, S. spontaneum, S. robustum, S. barberi, S. sinense, and S. edule) [3]. Fingerprinted sugarcane cultivars cover many geographical areas including Argentina, Australia, Bangladesh, China, Colombia, India, Mexico, Pakistan, South Africa, Thailand, the USA (Louisiana, Florida, Texas, and Hawaii), and Venezuela. These molecular identities have been successfully utilized to promote the efficiency of the conventional sugarcane breeding program at the United State Department of Agriculture-Agricultural Research Service, Sugarcane Research Unit:
Firstly, the geneticists and breeders are able to include molecular descriptors to registration articles on both sugarcane and energy cane (*) cultivars; for example, HoCP 96-540 [8], Ho 95-988 [9], Ho 00-950 [10], HoCP 91-552* [11], Ho 00-961* [12], and Ho 02-113* [13] were all registered with a molecular descriptor.
Secondly, the geneticists and breeders are able to identify mis-labeled clones in a timely fashion, and to remove mis-labeled clones from the crossing carts or field evaluation plots [14].
Thirdly, molecular breeding gives the geneticists and breeders an option to hot water emasculate S. spontaneum plants by immersing the flowers in 50 °C circulating water bath for 5 min and cross the S. spontaneum plants as female with superior sugarcane cultivars as male parents. The geneticists and breeders then screen the resulting seedlings by cultivar-specific SSR fingerprints to identify true F1 hybrids for field evaluation and selection and discard self-progeny and off-type progeny derived from stray pollens of unknown source [15]. Within 12 years, the USDA-ARS sugarcane geneticists and breeders were able to release the first energy cane cultivar Ho 02-113 [13] that contains a cytoplasm of SES234, a S. spontaneum clone.
Fourthly, the geneticists and breeders have been successful in using clone-specific SSR fingerprints [15] for several purposes including identifying true F1 hybrids from several other (elite × wild) or (wild × elite) crosses [16], assessing the genetic relatedness of parental clones [17], determining the paternity of polycross progeny [18], and assessing cross quality.
Lastly, basic genetic studies are also being conducted at the USDA-ARS, Sugarcane Research Unit involving both pollens (gamete) and self- and cross-progenies (zygote) [19,20,21]. The geneticists and breeders found that the inheritance of SSR DNA fingerprints is in accordance with the Mendelian laws of segregation and independent assortment and that non-parental SSR fingerprints are encountered very rarely (only 1 out of 2392 PCR-based genotyping reactions). To ensure cross quality, breeders may enforce pollen control by trimming dehisced female flowers followed by hot water treatment and surrounding crosses with cubicles on all sides to prevent stray pollens. If pollen control is not enforced, the breeders may encounter non-parental SSR fingerprints more often.
In sugarcane breeding, crossing, evaluation, and selection are a revolving process with newly selected clones being assigned each year. These newly assigned sugarcane clones need to be fingerprinted using the same protocol. The resulting molecular identities are then added to the database. It is anticipated that before long, the sugarcane geneticists and breeders will be able to use the molecular identity database information to assess the reliability of sugarcane pedigree information recorded in their notebooks.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Pan, Y.-B. Biotechnology: Impact on sugarcane agriculture and industry. Sugar Tech 2012, 14, 1–2. [Google Scholar] [CrossRef]
- Wu, J.; Huang, Y.; Lin, Y.; Fu, C.; Liu, S.; Deng, Z.; Li, Q.; Huang, Z.; Chen, R.; Zhang, M. Unexpected Inheritance Pattern of Erianthus arundinaceus Chromosomes in the Intergeneric Progeny between Saccharum spp. and Erianthus arundinaceus. PLoS ONE 2014, 9, e110390. [Google Scholar] [CrossRef] [PubMed]
- Pan, Y.-B. Databasing molecular identities of sugarcane (Saccharum spp.) clones constructed with microsatellite (SSR) DNA markers. Am. J. Plant Sci. 2010, 1, 87–94. [Google Scholar] [CrossRef]
- Pan, Y.-B.; Scheffler, B.S.; Richard, E.P., Jr. High throughput genotyping of commercial sugarcane clones with microsatellite (SSR) DNA markers. Sugar Tech 2007, 9, 176–181. [Google Scholar]
- Bischoff, K.P.; Gravois, K.A. The development of new sugarcane varieties at the LSU Ag center. J. Am. Sugar Cane Technol. 2004, 24, 142–164. [Google Scholar]
- Cordeiro, G.M.; Taylor, G.O.; Henry, R.J. Characterisation of microsatellite markers from sugarcane (Saccharum sp.), a highly polyploid species. Plant Sci. 2000, 155, 161–168. [Google Scholar] [CrossRef]
- Pan, Y.-B. Highly polymorphic microsatellite DNA markers for sugarcane germplasm evaluation and variety identity testing. Sugar Tech 2006, 8, 246–256. [Google Scholar] [CrossRef]
- Tew, T.L.; White, W.H.; Legendre, B.L.; Grisham, M.P.; Dufrene, E.O.; Garrison, D.D.; Veremis, J.C.; Pan, Y.-B.; Richard, E.P., Jr.; Miller, J.D. Registration of ‘HoCP 96–540’ Sugarcane. Crop Sci. 2004, 45, 785–786. [Google Scholar]
- Tew, T.L.; Burner, D.M.; Legendre, B.L.; White, W.H.; Grisham, M.P.; Dufrene, E.O.; Garrison, D.D.; Veremis, J.C.; Pan, Y.-B.; Richard, E.P., Jr. Registration of ‘Ho 95–988’ Sugarcane. Crop Sci. 2005, 45, 1660–1661. [Google Scholar] [CrossRef]
- Tew, T.L.; Dufrene, E.O., Jr.; Garrison, D.D.; White, W.H.; Grisham, M.P.; Pan, Y.-B.; Richard, E.P., Jr.; Legendre, B.L.; Miller, J.D. Registration of ‘HoCP 00–950’ sugarcane. J. Plant Regist. 2009, 3, 42–50. [Google Scholar] [CrossRef]
- Tew, T.L.; Dufrene, E.O., Jr.; Cobill, R.M.; Garrison, D.D.; White, W.H.; Grisham, M.P.; Pan, Y.-B.; Legendre, B.L.; Richard, E.P., Jr.; Miller, J.D. Registration of ‘HoCP 91–552’ sugarcane. J. Plant Regist. 2011, 5, 181–190. [Google Scholar] [CrossRef]
- White, W.H.; Cobill, R.M.; Tew, T.L.; Burner, D.M.; Grisham, M.P.; Dufrene, E.O., Jr.; Pan, Y.-B.; Richard, E.P., Jr.; Legendre, B.L. Registration of ‘Ho 00–961’ Sugarcane. J. Plant Regist. 2011, 5, 332–338. [Google Scholar] [CrossRef]
- Hale, A.L.; Dufrene, E.O.; Tew, T.L.; Pan, Y.-B.; Viator, R.P.; White, P.M.; Veremis, J.C.; White, W.H.; Cobill, R.; Richard, E.P.; et al. Registration of ‘Ho 02–113’ Sugarcane. J. Plant Regist. 2011, 7, 51–57. [Google Scholar] [CrossRef]
- Pan, Y.-B.; Miller, J.D.; Schnell, R.J.; Richard, E.P.; Wei, Q. Application of microsatellite and RAPD fingerprints in the Florida sugarcane variety program. Sugar Cane Int. 2003, 189, 19–28. [Google Scholar]
- Chandra, A.; Grisham, M.P.; Pan, Y.-B. Allelic divergence and cultivar-specific SSR alleles revealed through fluorescence-labeled SSR markers based capillary electrophoregrams in highly polyploid species sugarcane. Genome 2014, 57, 363–372. [Google Scholar] [CrossRef] [PubMed]
- Pan, Y.-B.; Tew, T.L.; Schnell, R.J.; Viator, R.P.; Richard, E.P., Jr.; Grisham, M.P.; White, W.H. Microsatellite DNA marker-assisted selection of Saccharum spontaneum cytoplasm-derived germplasm. Sugar Tech 2006, 8, 23–29. [Google Scholar] [CrossRef]
- Pan, Y.-B.; Cordeiro, G.M.; Richard, E.P., Jr.; Henry, R.J. Molecular genotyping of sugarcane clones with microsatellite DNA markers. Maydica 2003, 48, 319–329. [Google Scholar]
- Tew, T.L.; Pan, Y.-B. Microsatellite (simple sequence repeat) marker-based paternity analysis of a seven-parent sugarcane polycross. Crop Sci. 2010, 50, 1401–1408. [Google Scholar] [CrossRef]
- Pan, Y.-B.; Liu, P.; Que, Y. Independently segregating simple sequence repeats (SSR) alleles in polyploid sugarcane. Sugar Tech 2015, 17, 235–242. [Google Scholar] [CrossRef]
- Lu, X.; Zhou, Z.; Pan, Y.-B.; Chen, C.Y.; Zhu, J.; Chen, P.H.; Li, Y.-R.; Cai, Q.; Chen, R.K. Segregation analysis of microsatellite (SSR) markers in sugarcane polyploids. Genet. Mol. Res. 2015, 14, 18384–18395. [Google Scholar] [CrossRef] [PubMed]
- Liu, P.; Chandra, A.; Que, Y.; Chen, P.-H.; Grisham, M.P.; White, W.H.; Dalley, C.D.; Tew, T.L.; Pan, Y.-B. Identification of QTLs controlling sucrose content based on an enriched genetic linkage map of sugarcane (Saccharum spp. hybrids) cultivar ‘LCP 85–384’. Euphytica 2016, 207, 527–549. [Google Scholar] [CrossRef]
Figure 1.
Formulation of 144 microsatellite (SSR) DNA fingerprints-based sugarcane molecular identity. These fingerprints are amplifiable from sugarcane genomic DNA through PCR using one of the 21 simple sequence repeats (SSR) markers listed in Table 1. Within each section (I through VIII shown on the left), name of the SSR marker (row 1), allele size (base pairs) (row 2), sequential order (row 3), and number of allele per marker (row 4) are shown. The presence or absence of each of the 144 SSR DNA fingerprints in a sugarcane cultivar, when combined, constitutes its molecular identity.
Figure 1.
Formulation of 144 microsatellite (SSR) DNA fingerprints-based sugarcane molecular identity. These fingerprints are amplifiable from sugarcane genomic DNA through PCR using one of the 21 simple sequence repeats (SSR) markers listed in Table 1. Within each section (I through VIII shown on the left), name of the SSR marker (row 1), allele size (base pairs) (row 2), sequential order (row 3), and number of allele per marker (row 4) are shown. The presence or absence of each of the 144 SSR DNA fingerprints in a sugarcane cultivar, when combined, constitutes its molecular identity.
Figure 2.
Capillary electrophoregrams of eight microsatellite (SSR) DNA fingerprints (filled in black color) from 12 Louisiana sugarcane cultivars, namely (from top), LCP 04-838, HoCP 85-845, HoCP 96-540, L 97-128, L 01-283, L 01-299, L 03-371, L 99-226, LCP 85-384, L 99-233, HoCP 07-613, and HoCP 00-950, and three DNA size markers, 139, 150, and 160 base pairs (filled in red color). The fingerprints of cultivars are amplified from the genomic DNA of leaf tissue through PCR primed by SMC336BS primer pair. The values shown on top are size marks and the values shown on left represent relative fluorescence intensity strength or the relative yield of amplified DNA fragment. The size of these eight SSR DNA fingerprints is 154, 166, 167, 169, 171, 175, 177, and 183 bp, respectively.
Figure 2.
Capillary electrophoregrams of eight microsatellite (SSR) DNA fingerprints (filled in black color) from 12 Louisiana sugarcane cultivars, namely (from top), LCP 04-838, HoCP 85-845, HoCP 96-540, L 97-128, L 01-283, L 01-299, L 03-371, L 99-226, LCP 85-384, L 99-233, HoCP 07-613, and HoCP 00-950, and three DNA size markers, 139, 150, and 160 base pairs (filled in red color). The fingerprints of cultivars are amplified from the genomic DNA of leaf tissue through PCR primed by SMC336BS primer pair. The values shown on top are size marks and the values shown on left represent relative fluorescence intensity strength or the relative yield of amplified DNA fragment. The size of these eight SSR DNA fingerprints is 154, 166, 167, 169, 171, 175, 177, and 183 bp, respectively.
Table 1.
Name, repeat motif, nucleotide sequence of forward and reverse primer, and annealing temperature of 21 sugarcane microsatellite markers.
| SSR Name | Repeat Motif | Forward Primer Sequence (5′ to 3′) Reverse Primer Sequence (5′ to 3′) | Annealing Temp (°C) |
|---|---|---|---|
| SMC119CG | (TTG)12 | TTCATCTCTAGCCTACCCCAA | 58 |
| AGCAGCCATTTACCCAGGA | |||
| SMC1604SA | (TGC)7 | AGGGAAAAGGTAGCCTTGG | 58 |
| TTCCAACAGACTTGGGTGG | |||
| SMC18SA | (CGA)10 | ATTCGGCTCGACCTCGGGAT | 62 |
| AGTCGAAAGGTATAATAGTGTTAC | |||
| SMC24DUQ | (TG)13 | CGCAACGACATATACACTTCGG | 64 |
| CGACATCACGGAGCAATCAGT | |||
| SMC278CS | (TG)19 (AG)25 | TTCTAGTGCCAATCCATCTCAGA | 64 |
| CATGCCAACTTCCAAACAGACT | |||
| SMC31CUQ | (TC)10 (AC)22 | CATGCCAACTTCCAATACAGACT | 62 |
| AGTGCCAATCCATCTCAGAGA | |||
| SMC334BS | (TG)36 | CAATTCTGACCGTGCAAAGAT | 60 |
| CGATGAGCTTGATTGCGAATG | |||
| SMC336BS | (TG)23(AG)19 | ATTCTAGTGCCAATCCATCTCA | 62 |
| CATGCCAACTTCCAAACAGAC | |||
| SMC36BUQ | (TTG)7 | GGGTTTCATCTC TAGCCTACC | 64 |
| TCAGTAGCAGAGTCAGACGCTT | |||
| SMC486CG | (CA)34 | GAAATTGCCTCCCAGGATTA | 58 |
| CCAACTTGAGAATTGAGATTCG | |||
| SMC569CS | (TG)37 | GCGATGGTTCCTATGCAACTT | 62 |
| TTCGTGGCTGAGATTCACACTA | |||
| SMC7CUQ | (CA)10 (C)4 | GCCAAAGCAAGGGTCACTAGA | 60 |
| AGCTCTATCAGTTGAAACCGA | |||
| SMC597CS | (AG)31 | GCACACCACTCGAATAACGGAT | 64 |
| AGTATATCGTCCCTGGCATTCA | |||
| SMC703BS | (CA)12 | GCCTTTCTCCAAACCAATTAGT | 62 |
| GTTGTTTATGGAATGGTGAGGA | |||
| SMC851MS | (AG)29 | ACTAAAATGGCAAGGGTGGT | 58 |
| CGTGAGCCCACATATCATGC | |||
| mSSCIR66 | (GT)43GC (GT)6 | AGGTGATTTAGCAGCATA | 48 |
| CACAAATAAACCCAATGA | |||
| mSSCIR3 | (GT)28 | ATAGCTCCCACACCAAATGC | 60 |
| GGACTACTCCACAATGATGC | |||
| SMC1751CL | (TGC)7 | GCCATGCCCATGCTAAAGAT | 60 |
| ACGTTGGTCCCGGAACCG | |||
| SMC22DUQ | (CAG)5C (AGG)5 | CCATTCGACGAAAGCGTCCT | 62 |
| CAAGCGTTGTGCTGCCGAGT | |||
| mSSCIR43 | (GT)3(AT)2(GT)29 | ATTCAACGATTT TCACGAG | 52 |
| AACCTAGCAATTTACAAGAG | |||
| mSSCIR74 | (CGC)9 | GCGCAAGCCACACTGAGA | 54 |
| ACGCAACGCAAAACAACG |
© 2016 by the author; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Pan, Y.-B. Development and Integration of an SSR-Based Molecular Identity Database into Sugarcane Breeding Program. Agronomy 2016, 6, 28. https://doi.org/10.3390/agronomy6020028
AMA Style
Pan Y-B. Development and Integration of an SSR-Based Molecular Identity Database into Sugarcane Breeding Program. Agronomy. 2016; 6(2):28. https://doi.org/10.3390/agronomy6020028
Chicago/Turabian StylePan, Yong-Bao. 2016. "Development and Integration of an SSR-Based Molecular Identity Database into Sugarcane Breeding Program" Agronomy 6, no. 2: 28. https://doi.org/10.3390/agronomy6020028
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
