An Efficient Method for the Differentiation of Human iPSC-Derived Endoderm toward Enterocytes and Hepatocytes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Human iPSCs
2.2. HiEnd Differentiation
2.3. Differentiation of Small Intestinal Stem Cells
2.4. Small Intestinal Stem Cell-Derived Enterocyte Differentiation
2.5. Hepatic Differentiation
2.6. Real-Time RT-PCR
2.7. Immunofluorescence Staining
2.8. Flow Cytometry
2.9. Bidirectional Transporter Assay
2.10. Calculations
2.11. Activity of Drug-Metabolizing Enzymes
2.12. Statistical Analysis
3. Results
3.1. Evaluation of Differentiation Method with Respect to iPSC-Derived Endoderm, Small Intestinal Stem Cells, and Enterocytes
3.1.1. Verification of 72 h Activin a Treatment in Human iPSC (Feeder-Free) Differentiation into the Endoderm
3.1.2. Duration of Activin a Treatment
3.1.3. Investigation of Differentiation Method to the Anterior Primitive Streak
3.1.4. Evaluation of the Effect of DMSO on the Endoderm, Small Intestinal Stem Cells, and Enterocyte Differentiation
3.2. Differentiation into Enterocytes Using Endoderm Generated by Protocol ACP
3.3. Differentiation into Hepatocytes Using Endoderm Generated by Protocol ACP
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Takahashi, K.; Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 2006, 126, 663–676. [Google Scholar] [CrossRef] [Green Version]
- Park, I.H.; Zhao, R.; West, J.A.; Yabuuchi, A.; Huo, H.; Ince, T.A.; Lerou, P.H.; Lensch, M.W.; Daley, G.Q. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 2008, 451, 141–146. [Google Scholar] [CrossRef]
- Paul, S.M.; Mytelka, D.S.; Dunwiddie, C.T.; Persinger, C.C.; Munos, B.H.; Lindborg, S.R.; Schacht, A.L. How to improve R&D productivity: The pharmaceutical industry’s grand challenge. Nat. Rev. Drug Discov. 2010, 9, 203–214. [Google Scholar]
- Hingorani, A.D.; Kuan, V.; Finan, C.; Kruger, F.A.; Gaulton, A.; Chopade, S.; Sofat, R.; MacAllister, R.J.; Overington, J.P.; Hemingway, H.; et al. Improving the odds of drug development success through human genomics: Modelling study. Sci. Rep. 2019, 9, 18911. [Google Scholar] [CrossRef] [Green Version]
- Kaminsky, L.S.; Zhang, Q.Y. The small intestine as a xenobiotic-metabolizing organ. Drug Metab. Dispos. 2003, 31, 1520–1525. [Google Scholar] [CrossRef] [Green Version]
- Suzuki, H.; Sugiyama, Y. Role of metabolic enzymes and efflux transporters in the absorption of drugs from the small intestine. Eur. J. Pharm. Sci. 2000, 12, 3–12. [Google Scholar] [CrossRef]
- McGinnity, D.F.; Soars, M.G.; Urbanowicz, R.A.; Riley, R.J. Evaluation of fresh and cryopreserved hepatocytes as in vitro drug metabolism tools for the prediction of metabolic clearance. Drug Metab. Dispos. 2004, 32, 1247–1253. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hayeshi, R.; Hilgendorf, C.; Artursson, P.; Augustijns, P.; Brodin, B.; Dehertogh, P.; Fisher, K.; Fossati, L.; Hovenkamp, E.; Korjamo, T.; et al. Comparison of drug transporter gene expression and functionality in Caco-2 cells from 10 different laboratories. Eur. J. Pharm. Sci. 2008, 35, 383–396. [Google Scholar] [CrossRef] [PubMed]
- Sun, D.; Lennernas, H.; Welage, L.S.; Barnett, J.L.; Landowski, C.P.; Foster, D.; Fleisher, D.; Lee, K.D.; Amidon, G.L. Comparison of human duodenum and Caco-2 gene expression profiles for 12,000 gene sequences tags and correlation with permeability of 26 drugs. Pharm. Res. 2002, 19, 1400–1416. [Google Scholar] [CrossRef] [PubMed]
- Lennernäs, H.; Palm, K.; Fagerholm, U.; Artursson, P. Comparison between active and passive drug transport in human intestinal epithelial (caco-2) cells in vitro and human jejunum in vivo. Int. J. Pharm. 1996, 127, 103–107. [Google Scholar] [CrossRef]
- Lake, B.G.; Price, R.J.; Giddings, A.M.; Walters, D.G. In vitro assays for induction of drug metabolism. Methods Mol. Biol. 2009, 481, 47–58. [Google Scholar]
- Brandon, E.F.; Raap, C.D.; Meijerman, I.; Schellens, J.H.M. An update on in vitro test methods in human hepatic drug biotransformation research: Pros and cons. Toxical. Appl. Pharmacol. 2003, 189, 233–246. [Google Scholar] [CrossRef]
- Kondo, Y.; Iwao, T.; Nakamura, K.; Sasaki, T.; Takahashi, S.; Kamada, N.; Matsubara, T.; Gonzalez, F.J.; Akutsu, H.; Miyagawa, Y.; et al. An efficient method for differentiation of human induced pluripotent stem cells into hepatocyte-like cells retaining drug metabolizing activity. Drug Metab. Pharmacokinet. 2014, 29, 237–243. [Google Scholar] [CrossRef]
- Okumura, H.; Nakanishi, A.; Hashita, T.; Iwao, T.; Matsunaga, T. Effect of Celecoxib on Differentiation of Human Induced Pluripotent Stem Cells into Hepatocytes Involves STAT5 Activation. Drug Metab. Dispos. 2018, 46, 1519–1527. [Google Scholar] [CrossRef]
- Takayama, K.; Hagihara, Y.; Toba, Y.; Sekiguchi, K.; Sakurai, F.; Mizuguchi, H. Enrichment of high-functioning human iPS cell-derived hepatocyte-like cells for pharmaceutical research. Biomaterials 2018, 161, 24–32. [Google Scholar] [CrossRef] [PubMed]
- Zorn, A.M.; Wells, J.M. Vertebrate endoderm development and organ formation. Annu. Rev. Cell Dev. Biol. 2009, 25, 221–251. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Noah, T.K.; Donahue, B.; Shroyer, N.F. Intestinal development and differentiation. Exp. Cell Res. 2011, 317, 2702–2710. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Palakkan, A.A.; Nanda, J.; Ross, J.A. Human Induced Pluripotent Stem Cell-Derived Definitive Endoderm Bulk Culture and Hepatic Differentiation. Methods Mol. Biol. 2019, 1994, 41–53. [Google Scholar] [PubMed]
- Christodoulou, C.; Longmire, T.A.; Shen, S.S.; Bourdon, A.; Sommer, C.A.; Gadue, P.; Spira, A.; Gouon-Evans, V.; Murphy, G.J.; Mostoslavsky, G.; et al. Mouse ES and iPS cells can form similar definitive endoderm despite differences in imprinted genes. J. Clin. Investig. 2011, 121, 2313–2325. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Iwamuro, M.; Komaki, T.; Kubota, Y.; Seita, M.; Kawamoto, H.; Yuasa, T.; Shahid, J.M.; Hassan, R.A.R.A.; Hassan, W.A.R.A.; Nakaji, S.; et al. Comparative analysis of endoderm formation efficiency between mouse ES cells and iPS cells. Cell Transplant. 2010, 19, 831–839. [Google Scholar] [CrossRef] [Green Version]
- McKnight, K.D.; Wang, P.; Kim, S.K. Deconstructing pancreas development to reconstruct human islets from pluripotent stem cells. Cell Stem Cell 2010, 6, 300–308. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Loh, K.M.; Ang, L.T.; Zhang, J.; Kumar, V.; Ang, J.; Auyeong, J.Q.; Lee, K.L.; Choo, S.H.; Lim, C.Y.Y.; Nichane, M.; et al. Efficient endoderm induction from human pluripotent stem cells by logically directing signals controlling lineage bifurcations. Cell Stem Cell 2014, 14, 237–252. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Osafune, K.; Caron, L.; Borowiak, M.; Martinez, R.J.; Fitz-Gerald, C.S.F.; Sato, Y.; Cowan, C.A.; Chien, K.R.; Melton, D.A. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotechnol. 2008, 26, 313–315. [Google Scholar] [CrossRef] [PubMed]
- Ogaki, S.; Morooka, M.; Otera, K.; Kume, S. A cost-effective system for differentiation of intestinal epithelium from human induced pluripotent stem cells. Sci. Rep. 2015, 5, 17297. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Chen, Y.; Ye, Y.; Wang, J.; Wang, H.; Yuan, G.; Lin, Z.; Wu, Y.; Zhang, Y.; Lin, X. Wnt signaling promotes hindgut fate commitment through regulating multi-lineage genes during hESC differentiation. Cell Signal. 2017, 29, 12–22. [Google Scholar] [CrossRef] [Green Version]
- Iwao, T.; Kodama, N.; Kondo, Y.; Kabeya, T.; Nakamura, K.; Horikawa, T.; Niwa, T.; Kurose, K.; Matsunaga, T. Generation of enterocyte-like cells with pharmacokinetic functions from human induced pluripotent stem cells using small-molecule compounds. Drug Metab. Dispos. 2015, 43, 603–610. [Google Scholar] [CrossRef] [Green Version]
- Kabeya, T.; Mima, S.; Imakura, Y.; Miyashita, T.; Ogura, I.; Yamada, T.; Yasujima, T.; Yuasa, H.; Iwao, T.; Matsunaga, T. Pharmacokinetic functions of human induced pluripotent stem cell-derived small intestinal epithelial cells. Drug Metab. Pharmacokinet. 2020, 35, 374–382. [Google Scholar] [CrossRef]
- Qiu, S.; Kabeya, T.; Ogawa, I.; Anno, S.; Hayashi, H.; Kanaki, T.; Hashita, T.; Iwao, T.; Matsunaga, T. Gellan Gum Promotes the Differentiation of Enterocytes from Human Induced Pluripotent Stem Cells. Pharmaceutics 2020, 12, 951. [Google Scholar] [CrossRef]
- Kabeya, T.; Qiu, S.; Hibino, M.; Nagasaki, M.; Kodama, N.; Iwao, T.; Matsunaga, T. Cyclic AMP Signaling Promotes the Differentiation of Human Induced Pluripotent Stem Cells into Intestinal Epithelial Cells. Drug Metab. Dispos. 2018, 46, 1411–1419. [Google Scholar] [CrossRef] [Green Version]
- Gadue, P.; Huber, T.L.; Paddison, P.J.; Keller, G.M. Wnt and TGF-beta signaling are required for the induction of an in vitro model of primitive streak formation using embryonic stem cells. Prot. Natl. Acad. Sci. USA 2006, 103, 16806–16811. [Google Scholar] [CrossRef] [Green Version]
- D’Amour, K.A.; Agulnick, A.D.; Eliazer, S.; Kelly, O.G.; Kroon, E.; Baetge, E.E. Efficient differentiation of human embryonic stem cells to definitive endoderm. Nat. Biotechnol. 2005, 23, 1534–1541. [Google Scholar] [CrossRef] [PubMed]
- Toivonen, S.; Lundin, K.; Balboa, D.; Ustinov, J.; Tamminen, K.; Palgi, J.; Trokovic, R.; Tuuri, T.; Otonkoski, T. Activin A and Wnt-dependent specification of human definitive endoderm cells. Exp. Cell Res. 2013, 319, 2535–2544. [Google Scholar] [CrossRef]
- Matsuno, K.; Mae, S.I.; Okada, C.; Nakamura, M.; Watanabe, A.; Toyoda, T.; Uchida, E.; Osafune, K. Redefining definitive endoderm subtypes by robust induction of human induced pluripotent stem cells. Differentiation 2016, 92, 281–290. [Google Scholar] [CrossRef] [PubMed]
- Sambo, D.; Li, J.; Brickler, T.; Chetty, S. Transient Treatment of Human Pluripotent Stem Cells with DMSO to Promote Differentiation. J. Vis. Exp. 2019, 149, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Choi, M.Y.; Romer, A.I.; Hu, M.; Lepourcelet, M.; Mechoor, A.; Yesilaltay, A.; Krieger, M.; Gray, P.A.; Shivdasani, R.A. A dynamic expression survey identifies transcription factors relevant in mouse digestive tract development. Development 2006, 133, 4119–4129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, X.; Huang, C.T.; Chen, J.; Pankratz, M.T.; Xi, J.; Li, J.; Yang, Y.; Lavaute, T.M.; Li, X.J.; Ayala, M.; et al. Pax6 is a human neuroectoderm cell fate determinant. Cell Stem Cell 2010, 7, 90–100. [Google Scholar] [CrossRef] [Green Version]
- Fanning, A.S.; Jameson, B.J.; Jesaitis, L.A.; Anderson, J.M. The tight junction protein ZO-1 establishes a link between the transmembrane protein occludin and the actin cytoskeleton. J. Biol. Chem. 1998, 273, 29745–29753. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kubo, A.; Shinozaki, K.; Shannon, J.M.; Kouskoff, V.; Kennedy, M.; Woo, S.; Fehling, H.J.; Keller, G. Development of definitive endoderm from embryonic stem cells in culture. Development 2004, 131, 1651–1662. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bock, C.; Kiskinis, E.; Verstappen, G.; Gu, H.; Boulting, G.; Smith, Z.D.; Ziller, M.; Croft, G.F.; Amoroso, M.W.; Oakley, D.H.; et al. Reference Maps of human ES and iPS cell variation enable high-throughput characterization of pluripotent cell lines. Cell 2011, 144, 439–452. [Google Scholar] [CrossRef] [Green Version]
- Matoba, N.; Yamashita, T.; Takayama, K.; Sakurai, F.; Mizuguchi, H. Optimal human iPS cell culture method for efficient hepatic differentiation. Differentiation 2018, 104, 13–21. [Google Scholar] [CrossRef]
- Scheibner, K.; Bakhti, M.; Bastidas-Ponce, A.; Lickert, H. Wnt signaling: Implications in endoderm development and pancreas organogenesis. Curr. Opin. Cell Biol. 2019, 61, 48–55. [Google Scholar] [CrossRef]
- Li, S.; Huang, Q.; Mao, J.; Li, Q. FGF signaling mediates definitive endoderm formation by regulating epithelial-to-mesenchymal transition and cell proliferation. Int. J. Dev. Biol. 2020, 64, 471–477. [Google Scholar] [CrossRef] [PubMed]
- McLean, A.B.; D’Amour, K.A.; Jones, K.L.; Krishnamoorthy, M.; Krishnamoorthy, M.J.; Reynolds, D.M.; Sheppard, A.M.; Liu, H.; Xu, Y.; Baetge, E.E.; et al. Activin a efficiently specifies definitive endoderm from human embryonic stem cells only when phosphatidylinositol 3-kinase signaling is suppressed. Stem Cells 2007, 25, 29–38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, X.; Browning, V.L.; Odorico, J.S. Activin, BMP and FGF pathways cooperate to promote endoderm and pancreatic lineage cell differentiation from human embryonic stem cells. Mech. Dev. 2011, 128, 412–427. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chetty, S.; Pagliuca, F.W.; Honore, C.; Kweudjeu, A.; Rezania, A.; Melton, D.A. A simple tool to improve pluripotent stem cell differentiation. Nat. Methods 2013, 10, 553–556. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene Name | Sense (5′→3′) | Antisense (5′→3′) |
---|---|---|
Oct4 | AGCGAACCAGTATCGAGAAC | TTACAGAACCACACTCGGAC |
SOX17 | TGCAGGCCAGAAGCAGTGTTAC | CCCAAACTGTTCAAGTGGCAGA |
GATA4 | TAGCCTTGTGGGGAGAGCTT | TGGCCTGTCATCTCACTACG |
FOXA1 | AGGCCTGAGTTCATGTTGCT | AGGGCTGGATGGTTGTATTG |
CDX2 | ACCTGTGCGAGTGGATGC | TCCTTTGCTCTTGCGGTTCT |
PAX6 | GCAACATCCGTGGAGAAAAC | AAAAGGCCTCACACATCTGC |
Ki67 | GACTTTGGGTGCGACTTGAC | ACCCCGCTCCTTTTGATAGT |
LGR5 | TGCTCTTCACCAACTGCATC | CTCAGGCTCACCAGATCCTC |
Villin 1 | AGCCAGATCACTGCTGAGGT | TGGACAGGTGTTCCTCCTTC |
P-gp | CCCATCATTGCAATAGCAGG | TGTTCAAACTTCTGCTCCTGA |
CYP3A4 | CTGTGTGTTTCCAAGAGAAGTTAC | TGCATCATCAATTTCCTCCTGCAG |
ALB | GAGCTTTTTGAGCAGCTTGG | GGTTCAGGACCACGGATAGA |
BSEP | TGAGCCTGGTCATCTTGTG | TCCGTAAATATTGGCTTTCTG |
HPRT | CTTTGCTTTCCTTGGTCAGG | TCAAGGGCATATCCTACAACA |
Antibodies | Source | Dilution |
---|---|---|
anti-ZO−1 | Thermo Fisher Scientific | 1:100 |
anti-villin | Santa Cruz Biotechnology | 1:50 |
anti-Muc2 | Santa Cruz Biotechnology | 1:100 |
anti-P-gp | Abcam | 1:25 |
anti-albumin | Abcam | 1:100 |
anti-MRP2 | Bioss Antibodies Inc. | 1:100 |
anti-AFP | Santa Cruz Biotechnology, Inc. | 1:100 |
anti-rabbit (Alexa Fluor 488) | Thermo Fisher Scientific | 1:200 |
anti-mouse (Alexa Fluor 568) | Thermo Fisher Scientific | 1:200 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qiu, S.; Li, Y.; Imakura, Y.; Mima, S.; Hashita, T.; Iwao, T.; Matsunaga, T. An Efficient Method for the Differentiation of Human iPSC-Derived Endoderm toward Enterocytes and Hepatocytes. Cells 2021, 10, 812. https://doi.org/10.3390/cells10040812
Qiu S, Li Y, Imakura Y, Mima S, Hashita T, Iwao T, Matsunaga T. An Efficient Method for the Differentiation of Human iPSC-Derived Endoderm toward Enterocytes and Hepatocytes. Cells. 2021; 10(4):812. https://doi.org/10.3390/cells10040812
Chicago/Turabian StyleQiu, Shimeng, Yaling Li, Yuki Imakura, Shinji Mima, Tadahiro Hashita, Takahiro Iwao, and Tamihide Matsunaga. 2021. "An Efficient Method for the Differentiation of Human iPSC-Derived Endoderm toward Enterocytes and Hepatocytes" Cells 10, no. 4: 812. https://doi.org/10.3390/cells10040812