Selected SNPs of FCN2 Associated with Chronic Tonsillitis in the Polish Adult Population
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Group and Sample Collection
2.2. SNPs Selection
2.3. DNA Isolation
2.4. FCN2 Genotyping
2.5. Statistical Analysis
3. Results
3.1. Study Group
3.2. Distribution of Selected FCN2 SNPs in the Study Group
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Arambula, A.; Brown, J.R.; Neff, L. Anatomy and physiology of the palatine tonsils, adenoids, and lingual tonsils. World J. Otorhinolaryngol. Head Neck Surg. 2021, 7, 155–160. [Google Scholar] [CrossRef] [PubMed]
- Abu Bakar, M.; McKimm, J.; Haque, S.Z.; Majumder, M.A.A.; Haque, M. Chronic tonsillitis and biofilms: A brief overview of treatment modalities. J. Inflamm. Res. 2018, 11, 329–337. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anderson, J.; Paterek, E. Tonsillitis. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2022. Available online: https://www.ncbi.nlm.nih.gov/books/NBK544342/ (accessed on 26 September 2022).
- Bathala, S.; Eccles, R. A review on the mechanism of sore throat in tonsillitis. J. Laryngol. Otol. 2013, 12, 227–232. [Google Scholar] [CrossRef]
- Burton, M.J.; Glasziou, P.P.; Chong, L.Y.; Venekamp, R.P. Tonsillectomy or adenotonsillectomy versus non-surgical treatment for chronic/recurrent acute tonsillitis. Cochrane Database Syst. Rev. 2014, 2014, CD001802. [Google Scholar] [CrossRef] [Green Version]
- Senska, G.; Ellermann, S.; Ernst, S.; Lax, H.; Dost, P. Recurrent tonsillitis in adults: Quality of life after tonsillectomy. Dtsch. Ärzteblatt Int. 2010, 107, 622–628. [Google Scholar] [CrossRef]
- Garred, P.; Honoré, C.; Ma, Y.J.; Rørvig, S.; Cowland, J.; Borregaard, N.; Hummelshøj, T. The genetics of ficolins. J. Innate Immun. 2010, 2, 3–16. [Google Scholar] [CrossRef]
- Hummelshoj, T.; Fog, L.M.; Madsen, H.O.; Sim, R.B.; Garred, P. Comparative study of the human ficolins reveals unique features of Ficolin-3 (Hakata antigen). Mol. Immunol. 2008, 45, 1623–1632. [Google Scholar] [CrossRef] [PubMed]
- Bidula, S.; Sexton, D.W.; Schelenz, S. Ficolins and the Recognition of Pathogenic Microorganisms: An Overview of the Innate Immune Response and Contribution of Single Nucleotide Polymorphisms. J. Immunol. Res. 2019, 2019, 3205072. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ren, Y.; Ding, Q.; Zhang, X. Ficolins and infectious diseases. Virol. Sin. 2014, 29, 25–32. [Google Scholar] [CrossRef]
- Hummelshoj, T.; Munthe-Fog, L.; Madsen, H.O.; Fujita, T.; Matsushita, M.; Garred, P. Polymorphisms in the FCN2 gene determine serum variation and function of Ficolin-2. Hum. Mol. Genet. 2005, 14, 1651–1658. [Google Scholar] [CrossRef]
- Cedzynski, M.; Nuytinck, L.; Atkinson, A.P.; St Swierzko, A.; Zeman, K.; Szemraj, J.; Szala, A.; Turner, M.L.; Kilpatrick, D.C. Extremes of L-ficolin concentration in children with recurrent infections are associated with single nucleotide polymorphisms in the FCN2 gene. Clin. Exp. Immunol. 2007, 150, 99–104. [Google Scholar] [CrossRef]
- Kilpatrick, D.C.; St Swierzko, A.; Matsushita, M.; Domzalska-Popadiuk, I.; Borkowska-Klos, M.; Szczapa, J.; Cedzynski, M. The relationship between FCN2 genotypes and serum ficolin-2 (L-ficolin) protein concentrations from a large cohort of neonates. Hum. Immunol. 2013, 74, 867–871. [Google Scholar] [CrossRef] [PubMed]
- Addobbati, C.; de Azevêdo Silva, J.; Tavares, N.A.; Monticielo, O.; Xavier, R.M.; Brenol, J.C.; Crovella, S.; Chies, J.A.; Sandrin-Garcia, P. Ficolin Gene Polymorphisms in Systemic Lupus Erythematosus and Rheumatoid Arthritis. Ann. Hum. Genet. 2016, 80, 1–6. [Google Scholar] [CrossRef]
- Ouf, E.A.; Ojurongbe, O.; Akindele, A.A.; Sina-Agbaje, O.R.; Van Tong, H.; Adeyeba, A.O.; Kremsner, P.G.; Kun, J.F.; Velavan, T. Ficolin-2 levels and FCN2 genetic polymorphisms as a susceptibility factor in schistosomiasis. J. Infect. Dis. 2012, 206, 562–570. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luz, P.R.; Boldt, A.B.; Grisbach, C.; Kun, J.F.; Velavan, T.P.; Messias-Reason, I.J. Association of L-ficolin levels and FCN2 genotypes with chronic Chagas disease. PLoS ONE 2013, 8, e60237. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cooper, D.N. Functional intronic polymorphisms: Buried treasure awaiting discovery within our genes. Hum. Genom. 2010, 4, 284–288. [Google Scholar] [CrossRef] [PubMed]
- Available online: http://www.ncbi.nlm.nih.gov/SNP/ (accessed on 1 January 2022).
- Solé, X.; Guinó, E.; Valls, J.; Iniesta, R.; Moreno, V. SNPStats: A web tool for the analysis of association studies. Bioinformatics 2006, 22, 1928–1929. [Google Scholar] [CrossRef] [Green Version]
- Munthe-Fog, L.; Hummelshøj, T.; Hansen, B.E.; Koch, C.; Madsen, H.O.; Skjødt, K.; Garred, P. The impact of FCN2 polymorphisms and haplotypes on the Ficolin-2 serum levels. Scand. J. Immunol. 2007, 65, 383–392. [Google Scholar] [CrossRef]
- Ojurongbe, O.; Ouf, E.A.; Van Tong, H.; Toan, N.L.; Song le, H.; Luz, P.R.; Messias-Reason, I.J.; Nurjadi, D.; Zanger, P.; Kun, J.F.; et al. Reliable and rapid characterization of functional FCN2 gene variants reveals diverse geographical patterns. BMC Med. Genet. 2012, 13, 37. [Google Scholar] [CrossRef]
- Hummelshøj, T.; Munthe-Fog, L.; Madsen, H.O.; Garred, P. Functional SNPs in the human ficolin (FCN) genes reveal distinct geographical patterns. Mol. Immunol. 2008, 45, 2508–2520. [Google Scholar] [CrossRef]
- Erkan, A.N.; Oz, I.; Terzi, Y.K.; Aydin, E.; Ozkale, M.; Babakurban, S.T.; Koycu, A.; Sahin, F.I. FCN2 c.772G>T polymorphism is associated with chronic adenoiditis and/or tonsillitis, but not -4 A>G and -602 G>A. Int. J. Pediatr. Otorhinolaryngol. 2016, 87, 1–4. [Google Scholar] [CrossRef] [PubMed]
- Olszowski, T.; Milona, M.; Janiszewska-Olszowska, J.; Safranow, K.; Skonieczna-Żydecka, K.; Walczak, A.; Sikora, M.; Chlubek, D.; Madlani, A.; Adler, G. The Lack of Association between FCN2 Gene Promoter Region Polymorphisms and Dental Caries in Polish Children. Caries Res. 2017, 51, 79–84. [Google Scholar] [CrossRef] [PubMed]
- Chapman, S.J.; Vannberg, F.O.; Khor, C.C.; Segal, S.; Moore, C.E.; Knox, K.; Day, N.P.; Davies, R.J.; Crook, D.W.; Hill, A.V. Functional polymorphisms in the FCN2 gene are not associated with invasive pneumococcal disease. Mol. Immunol. 2007, 44, 3267–3270. [Google Scholar] [CrossRef] [PubMed]
- Ruskamp, J.M.; Hoekstra, M.O.; Postma, D.S.; Kerkhof, M.; Bottema, R.W.; Koppelman, G.H.; Rovers, M.M.; Wijga, A.H.; de Jongste, J.C.; Brunekreef, B.; et al. Exploring the role of polymorphisms in ficolin genes in respiratory tract infections in children. Clin. Exp. Immunol. 2009, 155, 433–440. [Google Scholar] [CrossRef]
- Chen, X.; Katoh, Y.; Nakamura, K.; Oyama, N.; Kaneko, F.; Endo, Y.; Fujita, T.; Nishida, T.; Mizuki, N. Single nucleotide polymorphisms of Ficolin 2 gene in Behçet’s disease. J. Dermatol. Sci. 2006, 43, 201–205. [Google Scholar] [CrossRef]
- Giang, N.T.; Tong, H.V.; Nghia, T.H.; Hung, H.V.; Anh, D.T.; Nam, L.V.; Mao, C.V.; Giang, N.T.; Thanh, L.D.; Son, H.A.; et al. Association of FCN2 polymorphisms and Ficolin-2 levels with dengue fever in Vietnamese patients. Int. J. Infect. Dis. 2020, 95, 253–261. [Google Scholar] [CrossRef]
- Hoang, T.V.; Toan, N.L.; Song le, H.; Ouf, E.A.; Bock, C.T.; Kremsner, P.G.; Kun, J.F.; Velavan, T.P. Ficolin-2 levels and FCN2 haplotypes influence hepatitis B infection outcome in Vietnamese patients. PLoS ONE 2011, 6, e28113. [Google Scholar] [CrossRef]
- Xu, D.D.; Wang, C.; Jiang, F.; Wei, L.L.; Shi, L.Y.; Yu, X.M.; Liu, C.M.; Liu, X.H.; Feng, X.M.; Ping, Z.P.; et al. Association of the FCN2 Gene Single Nucleotide Polymorphisms with Susceptibility to Pulmonary Tuberculosis. PLoS ONE 2015, 10, e0138356. [Google Scholar] [CrossRef]
- Szala, A.; Sawicki, S.; Swierzko, A.S.; Szemraj, J.; Sniadecki, M.; Michalski, M.; Kaluzynski, A.; Lukasiewicz, J.; Maciejewska, A.; Wydra, D.; et al. Ficolin-2 and ficolin-3 in women with malignant and benign ovarian tumours. Cancer Immunol. Immunother. 2013, 62, 1411–1419. [Google Scholar] [CrossRef] [Green Version]
- Sokołowska, A.; Świerzko, A.S.; Gajek, G.; Gołos, A.; Michalski, M.; Nowicki, M.; Szala-Poździej, A.; Wolska-Washer, A.; Brzezińska, O.; Wierzbowska, A.; et al. Associations of ficolins and mannose-binding lectin with acute myeloid leukaemia in adults. Sci. Rep. 2020, 10, 10561. [Google Scholar] [CrossRef]
- Elshamaa, M.F.; Hamza, H.; El Rahman, N.A.; Emam, S.; Elghoroury, E.A.; Farid, T.M.; Zaher, A.Z.; Ibrahim, M.H.; Kamel, S.; El-Aziz, D.A. Association of ficolin-2 (FCN2) functional polymorphisms and protein levels with rheumatic fever and rheumatic heart disease: Relationship with cardiac function. Arch. Med. Sci. Atheroscler. Dis. 2018, 3, e142–e155. [Google Scholar] [CrossRef] [PubMed]
- Marzetti, V.; Di Battista, C.; Ferrante, R.; Carlucci, L.; Balsamo, M.; Stuppia, L.; Lapergola, G.; Antonucci, I.; Chiarelli, F.; Breda, L. MBL2 and FCN2 gene polymorphisms in a cohort of Italian children with rheumatic fever: A case-control study. Semin. Arthritis Rheum. 2017, 47, 264–268. [Google Scholar] [CrossRef] [PubMed]
- Ashmawy, I.; El-Lebedy, D.; Awadallah, E.; Marzouk, H.; Farag, Y.; Ibrahim, A.A. Association of FCN2 gene rs3124954 and STAT4 gene rs7582694 polymorphisms with juvenile onset systemic lupus erythematosus and lupus nephritis in a sample of Egyptian children. Gene Rep. 2020, 21, 100968. [Google Scholar] [CrossRef]
- Slouka, D.; Čejková, Š.; Hanáková, J.; Hrabačka, P.; Kormunda, S.; Kalfeřt, D.; Skálová, A.; Šimánek, V.; Kucera, R. Risk of Postoperative Bleeding in Tonsillectomy for Peritonsillar Abscess, as Opposed to in Recurrent and Chronic Tonsillitis—A Retrospective Study. Int. J. Environ. Res. Public Health 2021, 18, 1946. [Google Scholar] [CrossRef]
- ESCMID Sore Throat Guideline Group; Pelucchi, C.; Grigoryan, L.; Galeone, C.; Esposito, S.; Huovinen, P.; Little, P.; Verheij, T. Guideline for the management of acute sore throat. Clin. Microbiol. Infect. 2012, 18, 1–28. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Falagas, M.E.; Mourtzoukou, E.G.; Vardakas, K.Z. Sex differences in the incidence and severity of respiratory tract infections. Respir. Med. 2007, 101, 1845–1863. [Google Scholar] [CrossRef] [Green Version]
- Gay, L.; Melenotte, C.; Lakbar, I.; Mezouar, S.; Devaux, C.; Raoult, D.; Bendiane, M.K.; Leone, M.; Mège, J.L. Sexual Dimorphism and Gender in Infectious Diseases. Front. Immunol. 2021, 12, 698121. [Google Scholar] [CrossRef]
SNP ID | Allele Change | SNP Type | Sequence (VIC/FAM) |
---|---|---|---|
rs17514136 | A/G | intron | GGCACCTTTTGAAGCAAAGACCAGA[A/G]GAGATGGAGCTGGACAGAGCTGTGG |
rs3124953 | A/G | intron | CTCTTCTCTCCTTTCCCTCCTGTTC[A/G]TGTGCCCCTGTGCTCTACATACTGC |
rs3124954 | C/T | intron | GATTCGTGTCAGGATTTCTGGAATG[C/T]ATGTGAGACACAGAGCTCTGCGGTG |
Characteristic | Chronic Tonsillitis, n (%) | Controls, n (%) | |
---|---|---|---|
Sex | female | 56 (55.45) | 56 (55.45) |
male | 45 (44.55) | 45 (44.55) | |
Median age (range) | 32 (18–64) | 37 (18–69) | |
Smoking | yes | 13 (12.87) | 21 (20.79) |
no | 88 (87.13) | 80 (79.21) | |
Drinking | yes | 33 (32.67) | 81 (80.20) |
no | 68 (67.33) | 20 (19.80) | |
Smoking and drinking | yes | 10 (9.90) | 21 (20.79) |
no | 91 (90.10) | 80 (79.21) |
SNP | Study Group | p-Value |
---|---|---|
rs17514136 (n = 198) | All cases | 0.368 |
Chronic tonsillitis | 0.245 | |
Controls | 0.685 | |
rs3124953 (n = 199) | All cases | 0.816 |
Chronic tonsillitis | 0.112 | |
Controls | 0.172 | |
rs3124954 (n = 194) | All cases | 0.999 |
Chronic tonsillitis | 0.372 | |
Controls | 0.469 |
FCN2 SNP | Variable | Chronic Tonsillitis n (%) | Controls n (%) | Without Adjustment | Adjusted by Age and Alcohol * | ||
---|---|---|---|---|---|---|---|
OR (95%CI) | p-Value | OR (95%CI) | p-Value | ||||
rs17514136 | AA | 43 (43.43) | 28 (28.28) | 0.72 (0.53–0.96) | 0.027 | 0.72 (0.50–1.02) | 0.061 |
AG | 49 (49.50) | 52 (52.53) | 1.06 (0.80–1.40) | 0.700 | 1.04 (0.75–1.44) | 0.830 | |
GG | 7 (7.07) | 19 (19.19) | 1.77 (1.12–2.79) | 0.015 | 1.83 (1.07–3.11) | 0.026 | |
rs3124953 | GG | 60 (60.61) | 70 (70.00) | 1.23 (0.92–1.65) | 0.165 | 1.35 (0.96–1.91) | 0.085 |
AG | 38 (38.38) | 25 (25.00) | 0.73 (0.54–0.99) | 0.044 | 0.66 (0.47–0.95) | 0.024 | |
AA | 1 (1.01) | 5 (5.00) | 2.27 (0.77–6.71) | 0.552 | 2.13 (0.66–6.92) | 0.208 | |
rs3124954 | CC | 41 (41.41) | 66 (69.47) | 1.79 (1.33–2.41) | 1.09 × 10−4 | 1.86 (1.30–2.65) | 0.001 |
CT | 49 (49.50) | 25 (26.32) | 0.60 (0.45–0.82) | 0.001 | 0.58 (0.40–0.83) | 0.003 | |
TT | 9 (9.09) | 4 (4.21) | 0.66 (0.36–1.22) | 0.184 | 0.62 (0.28–1.35) | 0.224 |
rs17514136 Association with Chronic Tonsillitis/Control Probes (n = 198, Adjusted by Age and Alcohol) | |||||
Model | Genotype | Chronic Tonsillitis n (%) | Controls n (%) | OR (95%CI) | p-Value |
Codominant | A/A | 43 (43.4%) | 28 (28.3%) | 1 | 0.028 |
A/G | 49 (49.5%) | 52 (52.5%) | 1.61 (0.78–3.34) | ||
G/G | 7 (7.1%) | 19 (19.2%) | 4.47 (1.41–14.20) | ||
Dominant | A/A | 43 (43.4%) | 28 (28.3%) | 1 | 0.059 |
A/G-G/G | 56 (56.6%) | 71 (71.7%) | 1.95 (0.97–3.93) | ||
Recessive | A/A-A/G | 92 (92.9%) | 80 (80.8%) | 1 | 0.020 |
G/G | 7 (7.1%) | 19 (19.2%) | 3.34 (1.15–9.65) | ||
Over-dominant | A/A-G/G | 50 (50.5%) | 47 (47.5%) | 1 | 0.830 |
A/G | 49 (49.5%) | 52 (52.5%) | 1.07 (0.56–2.07) | ||
rs3124953 association with Chronic tonsillitis/Control probes (n = 199, adjusted by age and alcohol) | |||||
Model | Genotype | Chronic tonsillitis n (%) | Controls n (%) | OR (95%CI) | p-value |
Codominant | G/G | 60 (60.6%) | 70 (70%) | 1 | 0.039 |
A/G | 38 (38.4%) | 25 (25%) | 0.46 (0.23–0.95) | ||
A/A | 1 (1%) | 5 (5%) | 3.49 (0.32–37.66) | ||
Dominant | G/G | 60 (60.6%) | 70 (70%) | 1 | 0.083 |
A/G-A/A | 39 (39.4%) | 30 (30%) | 0.55 (0.27–1.09) | ||
Recessive | G/G-A/G | 98 (99%) | 95 (95%) | 1 | 0.160 |
A/A | 1 (1%) | 5 (5%) | 4.54 (0.43–47.84) | ||
Over-dominant | G/G-A/A | 61 (61.6%) | 75 (75%) | 1 | 0.022 |
A/G | 38 (38.4%) | 25 (25%) | 0.44 (0.22–0.90) | ||
rs3124954 association with Chronic tonsillitis/Control probes (n = 194, adjusted by age and alcohol) | |||||
Model | Genotype | Chronic tonsillitis n (%) | Controls n (%) | OR (95%CI) | p-value |
Codominant | C/C | 41 (41.4%) | 66 (69.5%) | 1 | 0.0022 |
C/T | 49 (49.5%) | 25 (26.3%) | 0.30 (0.14–0.63) | ||
T/T | 9 (9.1%) | 4 (4.2%) | 0.24 (0.05–1.19) | ||
Dominant | C/C | 41 (41.4%) | 66 (69.5%) | 1 | 0.0005 |
C/T-T/T | 58 (58.6%) | 29 (30.5%) | 0.29 (0.14–0.59) | ||
Recessive | C/C-C/T | 90 (90.9%) | 91 (95.8%) | 1 | 0.220 |
T/T | 9 (9.1%) | 4 (4.2%) | 0.38 (0.08–1.81) | ||
Over-dominant | C/C-T/T | 50 (50.5%) | 70 (73.7%) | 1 | 0.0026 |
C/T | 49 (49.5%) | 25 (26.3%) | 0.34 (0.16–0.69) |
Haplotype Frequencies Estimation (n = 202) | |||||||
rs17514136 | rs3124953 | rs3124954 | Total | Chronic Tonsillitis | Controls | Cumulative Frequency | |
1 | G | G | C | 0.3633 | 0.2982 | 0.428 | 0.3633 |
2 | A | G | T | 0.2518 | 0.3244 | 0.1712 | 0.6151 |
3 | A | G | C | 0.1935 | 0.1632 | 0.2258 | 0.8086 |
4 | A | A | C | 0.1689 | 0.1952 | 0.149 | 0.9775 |
5 | G | A | C | 0.0176 | 0.003 | 0.0259 | 0.9951 |
6 | G | G | T | 0.0049 | 0.016 | 0 | 1 |
7 | G | A | T | 0 | NA | 0 | 1 |
8 | A | A | T | 0 | 0 | 0 | 1 |
Haplotype analysis (n = 202, adjusted by age and alcohol) | |||||||
rs17514136 | rs3124953 | rs3124954 | Frequency | OR (95%CI) | p-value | ||
1 | G | G | C | 0.3638 | 1 | --- | |
2 | A | G | T | 0.2489 | 0.31 (0.15–0.62) | 0.0011 | |
3 | A | G | C | 0.1949 | 0.98 (0.47–2.04) | 0.950 | |
4 | A | A | C | 0.17 | 0.46 (0.23–0.95) | 0.038 | |
5 | G | A | C | 0.0166 | 1.58 (0.13–19.17) | 0.720 | |
rare | * | * | * | 0.0058 | 0.00 (-Inf-Inf) | 1.00 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gaździcka, J.; Gołąbek, K.; Hudy, D.; Miśkiewicz-Orczyk, K.; Zięba, N.; Tynior, W.; Asman, M.; Misiołek, M.; Strzelczyk, J.K. Selected SNPs of FCN2 Associated with Chronic Tonsillitis in the Polish Adult Population. Genes 2023, 14, 242. https://doi.org/10.3390/genes14020242
Gaździcka J, Gołąbek K, Hudy D, Miśkiewicz-Orczyk K, Zięba N, Tynior W, Asman M, Misiołek M, Strzelczyk JK. Selected SNPs of FCN2 Associated with Chronic Tonsillitis in the Polish Adult Population. Genes. 2023; 14(2):242. https://doi.org/10.3390/genes14020242
Chicago/Turabian StyleGaździcka, Jadwiga, Karolina Gołąbek, Dorota Hudy, Katarzyna Miśkiewicz-Orczyk, Natalia Zięba, Wojciech Tynior, Marek Asman, Maciej Misiołek, and Joanna Katarzyna Strzelczyk. 2023. "Selected SNPs of FCN2 Associated with Chronic Tonsillitis in the Polish Adult Population" Genes 14, no. 2: 242. https://doi.org/10.3390/genes14020242